Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 18.
Published in final edited form as: Front Med. 2017 Oct 17;12(2):196–205. doi: 10.1007/s11684-017-0560-5

Simultaneous detection and characterization of toxigenic Clostridium difficile directly from clinical stool specimens

Hanjiang Lai 1, Chen Huang 2, Jian Cai 3, Julian Ye 2, Jun She 1, Yi Zheng 4, Liqian Wang 5, Yelin Wei 1, Weijia Fang 4, Xianjun Wang 5, Yi-Wei Tang 6,7, Yun Luo 2,a, Dazhi Jin 2,b
PMCID: PMC6750768  NIHMSID: NIHMS1049834  PMID: 29058256

Abstract

We employed a multiplex polymerase chain reaction (PCR) coupled with capillary electrophoresis (mPCR-CE) targeting six Clostridium difficile genes, including tpi, tcdA, tcdB, cdtA, cdtB, and a deletion in tcdC for simultaneous detection and characterization of toxigenic C. difficile directly from fecal specimens. The mPCR-CE had a limit of detection of 10 colony-forming units per reaction with no cross-reactions with other related bacterial genes. Clinical validation was performed on 354 consecutively collected stool specimens from patients with suspected C. difficile infection and 45 isolates. The results were compared with a reference standard combined with BD MAX Cdiff, real-time cell analysis assay (RTCA), and mPCR-CE. The toxigenic C. difficile species were detected in 36 isolates and 45 stool specimens by the mPCR-CE, which provided a positive rate of 20.3% (81/399). The mPCR-CE had a specificity of 97.2% and a sensitivity of 96.0%, which was higher than RTCA (x2 = 5.67, P =0.017) but lower than BD MAX Cdiff (P = 0.245). Among the 45 strains, 44 (97.8%) were determined as non-ribotype 027 by the mPCR-CE, which was fully agreed with PCR ribotyping. Even though ribotypes 017 (n = 8, 17.8%), 001 (n = 6, 13.3%), and 012 (n = 7, 15.6%) were predominant in this region, ribotype 027 was an important genotype monitored routinely. The mPCR-CE provided an alternative diagnosis tool for the simultaneous detection of toxigenic C. difficile in stool and potentially differentiated between RT027 and non-RT027.

Keywords: Clostridium difficile, multiplex PCR, capillary electrophoresis, detection, characterization

Introduction

Clostridium difficile is a spore-forming anaerobic bacterium colonizing the large intestine as a part of normal microbiota [1]. Toxigenic C. difficile can cause antibiotic-associated diarrheal disease in patients after hospitalization and/or antibiotic treatment [2]. C. difficile infection (CDI) has also been recognized as a cause of pseudomembranous colitis and C. difficile-associated diarrhea since 1977 [3]. After the emergence of hypervirulent ribotype 027 strains, the incidence, complications, morbidity, and mortality of CDI have increased dramatically in the past decade [4,5], and the outbreaks of CDI have been described in several countries [5–9]. Therefore, clinical diagnosis and surveillance for CDI are routinely performed in the United States and Europe [10,11].

CDI-related diseases are mediated by C. difficile toxins. C. difficile produces two high-molecular weight toxins, the enterotoxin A (tcdA) and the cytotoxin B (tcdB), with its coding genes integrated with two regulatory genes (tcdC and tcdD) and a putative holin gene (tcdE), forming a 19.6 kb chromosomal region that named the pathogenicity locus (PaLoc) [12,13]. A third toxin, an actin-specific ADP-ribosyltransferase and encoded by C. difficile cdtA and cdtB genes, is located on the locus of the chromosome separated from the PaLoc. CdtA and cdtB subunits form the binary toxin [14]. The triose phosphate isomerase (tpi), a housekeeping gene with high specificity for C. difficile, has been used for the identification of C. difficile in other assays [15,16]. Meanwhile, an 18 base pairs deletion in tcdC gene has been recognized as a typical gene marker for the identification of epidemic hypervirulent ribotype 027 strains [4,17].

A large number of methods have been available for the laboratory diagnosis of CDI in the past decade. The toxigenic culture assay was recognized as a gold standard for the identification of toxigenic C. difficile. However, this method was time consuming (2–3 days), labor-intensive, and not suitable for wide use in clinical microbiology laboratories [18,19]. Enzyme immunoassays (EIAs) have been adopted for the direct detection of toxins A and/or B, glutamate dehydrogenase (GDH) of C. difficile in stool [20]. However, toxin A/B detection based on EIA is no longer recommended as a primary test due to poor sensitivity, and GDH detection cannot differentiate toxigenic C. difficile from nontoxigenic C. difficile [18,21]. The molecular assays targeting tcdA, tcdB, and/or tcdC gene have shown promising performance in recent years. By far, a total of eight commercial kits have been cleared by the Food and Drug Administration in the United States [15,18–20,22–24]. Some advanced techniques also have been reported for detecting toxigenic C. difficile with satisfactory capability [19,25,26]. However, molecular tests have been indicated too sensitive and have led to overdiagnosis for CDI [27]. Most current molecular assays generally target one gene without any identification/characterization capacity (except for the Cepheid assay) [28]. Therefore, simultaneous detection of multiple genes in the diagnosis of C.difficile might facilitate clinical diagnosis. Moreover, the high cost might be also one of factors that hinders wider usage in clinical setting in developing countries.

CDI has been reported in several cities in China, including two cities which recently revealed ribotype 027 [9,29–31]. CDI has become a main reason of diarrhea-related diseases in Chinese inpatients. Moreover, the morbidity of CDI may be underestimated because of the lack of data reported. Consequently, demanding for clinician to start CDI testing for patients with diarrhea is urgent because CDI cases increase gradually in recent years. In addition, monitoring CDI outbreak and controlling the nosocomial spread of infection in China should be performed by CDC. Nevertheless, only three commercial kits (Mini-VIDAS, BioMerieux, France; GeneXpert, Cepheid, USA; QUIK CHEK complete and A/B II ELISA, TechLab, USA) were approved by the China Food and Drug Administration (CFDA). Thus, the popularization and application of CDI diagnosis might be difficult.

A multiplex PCR coupled with capillary electrophoresis (mPCR-CE) technology has been utilized for the identification of seven foodborne pathogens and discrimination between pathogenic and non-pathogenic Escherichia coli, genetically modified organism, and deletion or duplication genotype [32–34]. In this study, we developed and evaluated a mPCR-CE assay for simultaneous detection of six C. difficile-specific genes and mutations. The clinical validation of the mPCR-CE was performed on a panel of well characterized C. difficile strains and stool specimens collected from patients with diarrhea.

Materials and methods

Bacterial strains and specimen collection

All standard bacterial strains were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) (Table 1). PCR ribotypes were provided at the ATCC website, and the ATCC BAA-1870 strain is PCR ribotype 027. All strains were cultured by the standard micro-biological procedures as previously described [35]. Clinical stool specimens from patients with suspected CDI were consecutively collected between August 13 and December 21, 2013 at three hospitals: Department of Neurosurgery, First People’s Hospital of Xiaoshan District; Department of Medical Oncology, First Affiliated Hospital of Zhejiang University College of Medicine; and Department of Gastroenterology, Hangzhou First People’s Hospital in Hangzhou, Zhejiang. Liquid, soft, or semi-solid stool specimens with sufficient volumes were stored at −80 °C and transported to the Zhejiang Provincial Center for Disease Control and Prevention (ZJCDC) within 72 h for further testing. Aliquots were made for each stool specimen and were tested by the mPCR-CE assay, BD MAX Cdiff assay, and real-time cell analysis assay (RTCA) within 48 h after collection (see below). The stool specimens were cultured for C. difficile using cefoxitin-cycloserine fructose agar plates (UK BioTech Inc., Hangzhou, Zhejiang, China) according to our previous reports [36]. This study as a part of other research was approved by the Institutional Review Boards of ZJCDC.

Table 1.

Bacterial strains

Bacterial origin ATCC number tcdA tcdB cdtA cdtB 18 bp deletion in tcdC
C. difficile 43255 + + − − WTb
C. difficile 700057 − − − − WT
C. difficile BAA-1870 + + + + 18 bp deletion
C. difficile BAA-1804 + + − − WT
C. difficile BAA-1803 + + + + 18 bp deletion
C. difficile BAA-1801 − − − − WT
C. difficile 43598 + + − − WT
C. difficile BAA-1812 + + − − WT
Vibrio cholera BAA-2163, 39541, 25870, 55866 N/Aa
Vibrio parahemolyticus 43996 N/A
Vibrio vulnificus 27562 N/A
Clostridium perfringens 27057 N/A
Clostridium botulinum 19397 N/A
Campylobacter jejuni 33560 N/A
Enterobacter aerogenes 13048 N/A
Escherichia coli O157:H7 43888 N/A
Listeria monocytogenes 19111 N/A
Shigella flexneri 55556 N/A
Salmonella enterica 51960 N/A
Open in a new tab
a

N/A: not applicable.

b

WT: wild type with no 18 bp deletion.

mPCR-CE assay

The genomic DNA of the C. difficile strains was extracted by using the QIAamp DNA mini kit (Cat No. 51304) (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer’s instructions [9]. Genomic DNA was extracted from stool specimens by using a MOKO DNA stool kit (MOKObio Biotechnology R&D Center Inc., Durham, NC, USA) per manufacturer’s instructions. A positive control was prepared by diluting C. difficile BAA-1870 (PCR ribotype 027) 1:10 into pooled C. difficile-negative stool specimens according to the method previously reported [37]. Serial concentrations of the dilutions ranged from 9.0 × 107 to 9.0 × 101 colony-forming units (CFU) per gram of stool specimens.

Six primer sets were designed to detect 5 C. difficile-specific genes (tcdA, tcdB, cdtA, cdtB, and tpi) and 18 base pairs deletion in tcdC gene. All the primer pairs were designed by using Primer Premier 5.00 software, as shown in Table 2. All the forward primers were labeled at the 5′ end with carboxyfluorescein (FAM). Amplification was performed in a 25 μL reaction consisting of 1 × HotStar Taq Master Mix (Qiagen, Inc., Valencia, CA, USA), five primer sets, and 1 μL extracted DNA. Amplification was carried out in an Eppendorf AG PCR instrument with a 10 min initial enzyme activation at 95 °C, and DNA was amplified for 30 cycles consisting of 20 s at 95 °C, 20 s at 58 °C, and 25 s at 72 °C, followed by a 5 min final elongation step at 72 °C. PCR fragments were analyzed in an ABI 3100 genetic analyzer (Applied Biosystems, Foster City, CA, USA) as described previously [38]. Every test run included a positive control, a negative control, and a blank control.

Table 2.

Primer pairs

Gene target Primer name Sequence (5’−3’) Primer concentration (μmol/L) Product size (bp)
Tpi tpi-F AAAGAAGCTACTAAGGGTACAAA 0.80 229
tpi-R CATAATATTGGGTCTATTCCTAC 0.80
tcdA tcdA-F AGGGCTAATAATCTTACTATGTC 0.60 258
tcdA-R ATCTCAAATCAATAAACCTACAG 0.60
tcdB tcdB-F AATGCATTTTTGATAAACACATTG 0.50 329
tcdB-R AAGTTTCTAACATCATTTCCAC 0.50
tcdC tcdC-F TGCTGAACCATGGTTCAA 1.0 177/159
tcdC-R GCTAATTGGTCATAAGTAATAC 1.0
cdtA cdtA-F TTACCTAGAAATACTGGTATGTTA 1.1 303
cdtA-R AATTATTAATTGCAGTATATCCTC 1.1
cdtB cdtB-F CTACAAGATAAAAATTTAGGTTCA 0.85 361
cdtB-R CTGTATATGGATCTCCAGCA 0.85
Open in a new tab

RTCA

RTCA assay uses a real-time cell analysis system (xCELLigence, ACEA Biosciences, San Diego, CA, USA) to detect C. difficile toxin B. 5% (wt/vol, vol/vol) of stool specimen was diluted in cold Hanks buffered salt solution and then centrifuged. Supernatant was collected after centrifugation, and toxin level was tested quantitatively on an xCELLigence RTCA system as previously described [19].

BD MAX

The BD MAX Cdiff assay was performed according to the manufacturer’s instructions as previously described. About 10 μL of stool sample was added to the BD MAX sample buffer, mixed completely, and vortexed for 1 min. DNA extraction was done by using a magnetic-bead technology with a sample-processing control. Afterward, 4.2 μL of the PCR mixture was well amplified in the cartridge. The results were exported using the BD MAX system software. The tcdC gene was directly sequenced as in the previous studies [17,39].

Hands-on time, test turnaround time, and cost per test

Hands-on time and test turnaround time were calculated according to 16 samples. Then, the time of pretreatment, including cell seeding and growing up to the plateau, was excluded for the RTCA assay. The cost of BD MAX Cdiff was a reference price of the kit that we purchased. The cost of the RTCA assay was approximately calculated according to our previous studies [19,40].

PCR ribotyping and sequencing

PCR ribotyping was performed by using a capillary gel electrophoresis with primer pairs as described previously [9,41,42]. After the PCR reaction was completed, the fragments were analyzed with an ABI 3100 genetic analyzer (Applied Biosystems, USA) with 36 cm capillary loaded with a POP4 gel (Applied Biosystems). After the 1 μL PCR fragment was mixed with 10 μL Hi-Di™ formamide (Applied Biosystems) and 0.5 μL AGCU SIZ 680 size standard (AGCU ScienTech Inc., Wuxi, Jiangsu, China), the mixture was injected into a capillary at 3 kV for over 10 s. The total running time was about 30 min at a run voltage of 15 kV. The size of each peak was determined by Genemapper ID-X software 1.3 (Applied Biosystems). The capillary-sequencer-based PCR-ribotyping data were analyzed at WEBRIBO website (https://webribo.ages.at/) [42].

Data analysis

The mPCR-CE results were categorized into (1) no C. difficile, (2) nontoxigenic C. difficile, (3) toxigenic C. difficile, and (4) toxigenic, ribotype 027 C. difficile. The result was considered invalid if any toxin genes were present while the species-specific tpi gene was absent (Table 3). A combined reference standard was defined as concordant results for two or more of the following assays: mPCR-CE, BD MAX Cdiff, and RTCA. For analytical specificity and sensitivity determinations, the known concentrations of toxigenic C. difficile strains with tcdA/tcdB and/or cdtA/cdtB genes, tcdC gene with 18 bp deletion, and nontoxigenic C. difficile, C. botulinum, C. perfringens, and other enterobacteria were evaluated. The clinical sensitivity, specificity, and positive and negative predictive values (PPV and NPV, respectively) of the mPCR-CE assay were determined. Test turnaround time, hands-on time, and cost of reagents were calculated. Odds ratios (OR), 95% confidence interval (CI), and P values were calculated by using the SPSS version 20.0 software (SPSS Inc., Chicago, IL, USA). The P values of ≤ 0.05 were considered statistically significant.

Table 3.

Interpretation of mPCR-CE detection results in 354 stool specimens

tpia tcdA tcdB cdtA cdtB 18 bp deletion in tcdC Interpretation
− N/Ab N/A N/A N/A N/A No C. difficile
+ − − N/A N/A N/A Nontoxigenic C. difficile
+ +/− −/+ − − WTc Toxigenic C. difficile
+ + + − − WT Toxigenic C. difficile
+ + + + + WT Toxigenic C. difficile
Md Toxigenic and ribotype 027 C. difficile
+ + + − + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + + + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − + + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − − + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + + + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ − + + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ − + − + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
− At least one toxin gene positive WT Invalid results
M
Open in a new tab
a

+, positive; –, negative.

b

N/A, not applicable.

c

WT, wild type with no 18 bp deletion.

d

M, mutant type with 18 bp deletion.

Results

The primer pairs of six target genes were designed for amplifying PCR products with different sizes (Table 2). After the analysis of capillary electrophoresis, different PCR amplicons appeared in the different positions depending on different migration rates. The FAM channel was chosen for collecting fluorescent signals. After the optimization of PCR conditions, including the concentration and ratio of primer pairs, annealing temperature, extension time, and number of PCR cycles, a multiplex PCR coupled with capillary electrophoresis was established to detect tcdA, tcdB, cdtA, cdtB, and tpi genes, as well as an 18 bp deletion in tcdC gene. All the qualitative results from the mPCR-CE are interpreted in Table 3.

To determine the analytical specificity of the mPCR-CE assay, a panel of diarrhea-related pathogens was tested. No peaks corresponded to the target products found in Clostridium perfringens, Clostridium botulinum, Vibrio cholerae, or other diarrhea-related pathogens (Table 1). The specific peak in a 229 bp of tpi gene was observed in all C. difficile strains. The assay specifically detected at least one toxin gene, including tcdA, tcdB, cdtA, and cdtB genes in toxigenic C. difficile strains with no cross-reaction with nontoxigenic C. difficile and other strains. In addition, the peak positions of four toxin genes were in accordance with their sizes of PCR products. The assay also detected an 18 bp size variation in tcdC gene between ribotype 027 and nonribotype 027 (Fig. 1). The analytical sensitivity of the mPCR-CE assay was determined as above mentioned. The corresponding peaks of four genes, including tcdA, tcdB, cdtA, and cdtB, and a deletion in tcdC gene were observed for purified DNA with a limit of a detection of 10 CFU per reaction as performed on 10-fold diluted C. difficile spiked in sterile water. The limit of detection was9.0 × 104 CFU per gram of stool specimens for C. difficile spiked in pooled negative stool specimens.

Fig. 1.

Fig. 1

Open in a new tab

Representative mPCR-CE results in clinical specimens. Blue peaks, red triangles, X axis, and Y axis represent positive PCR products, standard size markers, length of PCR amplicon, and fluorescence intensity, respectively. (A) A schematic diagram of distribution of six target C. difficile genes according to their sizes. 1: Presence of an 18 bp deletion in tcdC gene. 2: Absence of an 18 bp deletion in tcdC gene. 3: tpi gene. 4: tcdA gene. 5: cdtA gene. 6: tcdB gene. 7: cdtB gene. (B) tpi gene was positive, indicating that no C. difficile existed in this clinical stool specimen. (C) This clinical stool specimen was positive for toxigenic C. difficile with tcdA, tcdB, and tpi genes without an 18 bp deletion in tcdC gene.

A total of 354 stool specimens and 45 C. difficile isolates were tested to determine the clinical validation of the mPCR-CE assay. The results were determined by the combined reference standard. The mPCR-CE assay identified toxigenic C. difficile in 36 (80.0%) isolates giving the sensitivity and specificity of 94.6% and 87.5%. The mPCR-CE assay identified toxigenic C. difficile in 45 (12.7%) stool specimens with the sensitivity, specificity, PPV, and NPV of 97.4%, 97.5%, 82.2%, and 99.7%, respectively. The sensitivity of the mPCR-CE assay (96.0%) for toxigenic C. difficile detection was higher than that of the RTCA assay (82.7%, OR = 5.03, 95% CI = 1.37–18.47, P = 0.017) but lower than that of the BD MAX (100%, Fisher exact P = 0.245). By contrast, the specificity (97.2%; OR = 1.12, 95% CI = 0.68–1.82, P = 0.820) of the mPCR-CE was higher than those of the BD MAX Cdiff (Table 4).

Table 4.

Sensitivity, specificity, and predictive values for toxigenic C. difficile by mPCR-CEa, BD MAX, and RTCA assays

Type Assay Number of stool specimens with indicated result Sensitivity (%) Specificity (%) PPV (%) NPV (%)
S+ T+ S+ T− S− T+ S− T−
Stool mPCR-CE 37 l 8 308 97.4 97.5 82.2 99.7
BD MAX Cdiff 38 0 10 306 100.0 96.8 79.2 100.0
RTCA 31 7 2 314 81.6 99.4 93.9 97.8
Strain mPCR-CE 35 2 1 7 94.6 87.5 N.A. N.A.
BD MAX Cdiff 37 0 1 7 100.0 87.5 N.A. N.A.
RTCA 31 6 0 8 83.8 100.0 N.A. N.A.
Total mPCR-CE 72 3 9 315 96.0 97.2 N.A. N.A.
BD MAX Cdiff 75 0 11 313 100.0 96.6 N.A. N.A.
RTCA 62 13 2 322 82.7 99.4 N.A. N.A.
Open in a new tab
a

Only these results were analyzed according to four toxin genes (tcdA, tcdB, cdtA, and cdtB).

S, standard; T, test. N.A., not applicable.

A total of 18 PCR ribotypes were found in the 45 strains, as shown in Fig. 2. No ribotype 027 was detected by either mPCR-CE or PCR ribotyping in stool specimens. Furthermore, no cdtA+cdtB– and cdtA–cdtB+ strains were found. PCR ribotypes 017 (n = 8, 17.8%), 001 (n = 6, 13.3%), and 012 (n = 7, 15.6%) were predominant in this region, whereas the other PCR ribotypes included 020, 085, 039, 049, and so on. We compared the results of the mPCR-CE with that of PCR ribotyping for ribotype 027 in 45 strains. Among these strains, 44 (97.8%) were confirmed as nonribotype 027 strain by the mPCR-CE, which was in accordance with the results of PCR ribotyping.

Fig. 2.

Fig. 2

Open in a new tab

Distribution of PCR ribotypes.

Values representing hands-on time, test turnaround time, and cost per test for the three assays are compared in Table 5. The mPCR-CE had shorter hands-on time (25 min) than that of the RTCA (55 min) but longer than that of the BD MAX Cdiff (8 min). However, the test turnaround of the mPCR-CE was similar to that of the BD MAX Cdiff. Notably, the cost of the mPCR-CE was extremely cheaper than those of the two assays.

Table 5.

Comparison by the three assays for toxigenic C. difficile detectiona

Assay Hands-on time (min) Test turnaround time (min) Cost per test (RMB)b
mPCR-CE 25 132.5 35.5
BD MAX Cdiff 8 130 150
RTCA 55c 1381.1 82.5
Open in a new tab
a

Hands-on time and test turnaround time were calculated on the basis of a full run of 16 stool specimens.

b

Cost per test was not an exact cost, because the reagent prices fluctuated continually.

c

This time was calculated after the cell grew in a stable phase.

Discussion

CDI has become a serious public health-related issue worldwide as the leading cause of antibiotic-associated diarrhea, resulting in a heavy burden to global healthcare systems [43]. The emergence of PCR ribotype 027 caused a tremendous change in the global molecular epidemiology of C. difficile and the clinical outcomes of CDI [44]. Numerous studies indicated that CDI cases have been increasing in China [36,45–48]. Moreover, clinical cases have been related with ribotype 027 in China [30,49]. Hence, carrying out toxigenic C. difficile testing in clinical laboratories and centers for disease control and prevention in China is necessary. In this study, we reported for the first time the use of mPCR-CE assay for the qualitative detection of six C. difficile-specific genes. The following information was reported as follows: the presence or absence of toxigenic or nontoxigenic C. difficile and whether or not C. difficile strain is detected indicate PCR ribotype 027.

Molecular methods and kits based on various technologies, including real-time PCR, multiplex PCR, loop-mediated isothermal amplification, and DNA microarray, have been existing [37, 50–52]. Among these assays, the GeneXpert Epi and the Verigene Cdiff assays were commercial kits available to detect toxigenic C. difficile and simultaneous differentiation between ribotype 027 and non ribotype 027 based on deletions in tcdC gene, with promising performance [43,53]. In our study, nontoxigenic isolates were distinguished from toxigenic ones using the mPCR-CE assay. This advantage was meaningful to get the comprehensive information of patients with suspected CDI and avoid the use of antibiotics that easily reduce CDI in patients with nontoxigenic C. difficile. This assay presented good analytical sensitivities with 10 CFU per reaction for purified DNA and 9.0 × 104 CFU per gram of pooled C. difficile-negative stool specimens, which was 100-fold more sensitive than the PCR assay described previously [54] and similar to the sensitivity of the real-time PCR assays previously reported [37,52]. Furthermore, clinical specimens could be directly detected after rapid and simple DNA extraction by the mPCR-CE assay, which showed a sensitivity of 96.0% and a specificity of 97.2% for strains and stool specimens. The performance of this assay was similar to that of the BD MAX Cdiff assay, a FDA clearance kit, but better than that of the RTCA.

The BD MAX Cdiff assay has been evaluated in previous studies, which has shown more promising performance compared with those of other commercial kits [28,55,56]. However, the BD MAX Cdiff and the CFDA cleared GeneXpert C. difficile. Epi kits are very expensive, which hinders their extensive use in clinical laboratories in China. The cost of the mPCR-CE assay evaluated based on the price of all related reagents in this period was approximately four folds less than that of the BD MAX Cdiff with research-use only, which was a reference price of the kit that we purchased (Table 5). In our assay, a rapid stool DNA extraction assay was employed to shorten the hands-on time and turnaround time compared with that of the QIAamp DNA stool kit. Thus, the mPCR-CE had shorter hands-on time than that of the RTCA but similar to that of the BD MAX Cdiff (data not shown). Combining DNA extraction with PCR reaction is possible for automatic result analysis, including GeneXpert and BD MAX platforms. Based on our study, mPCR-CE might be a preferred assay with a promising prospect for clinical diagnosis and molecular epidemiology.

The genetic characteristics of PCR ribotype 027 have been well characterized with binary toxin, 18 bp, and nucleotide 117 position deletions in tcdC, which were markers tested by different methods [4,43,57]. Persson et al. described an exception in which one isolate was PCR ribotype dk120 having binary toxin genes with 18 bp deletion and without Δ117. This finding made the 18 bp deletion 98% and the Δ117 deletion 100% specific for ribotype 027 [57]. In this study, we also found a C. difficile isolate harboring tcdA, tcdB, binary toxin genes, and 18 bp deletion in tcdC gene in which PCR ribotype was AI-56, not 027 (No. GenBank: KF962642.1). The 18 bp deletion and nucleotide 117 position substitution in tcdC gene were confirmed by direct sequencing (data not shown). However, the Δ117 deletion has been reported in nonPCR ribotype 027 strains. A total of 97.8% of strains were confirmed as nonribotype 027 strains, which were in accordance with the results of PCR ribotyping and suggesting that 18 bp deletion and Δ117 deletion in tcdC gene might be preliminary screening biomarkers but not as absolute markers for the identification of ribotype 027. Hyper-virulent C. difficile still needs to be identified by multilocus sequence typing and PCR ribotyping.

Based on the current reports on molecular epidemiology, the molecular characteristics of C. difficile strains were extremely different from different regions. Ribotype 017 with truncated tcdA may be a potential epidemic strain in China [9,29,46]. The mPCR-CE assay did not detect the deletion in tcdA to identify ribotype 017. Moreover, a variety of drug-resistant genes was related to C. difficile antibiotics resistance, including ermB (MLSB antibiotics resistance gene), tetM (tetracycline resistance gene), and GyrA or GyrB [58–60]. Therefore, we should add more targets to this assay to get more information in one reaction. In addition, limitation occurred on internal controls in this assay. Previous studies showed that the 16S rRNA gene was usually chosen as an internal control in a variety of molecular methods [52,61]. In this study, we amplified genomic DNAs extracted from stool specimens by the 16S rRNA gene primers [62] and analyzed PCR products as internal controls through capillary electrophoresis. Determining the validity of the internal control became difficult because of multiple peaks with different sizes. The cause of this finding might be a mixture of genomic DNAs from various bacteria in stool specimens and PCR products that contained different amplicons from different species by 16S rRNA universal primers [62,63]. Thus, we should further screen the suitable targets as internal controls in this assay.

Among the 45 strains, three ribotypes (017, 001, and 012) were dominant, whereas others belonged to 15 ribotypes. No significant differences occurred among the three departments (data not shown). These results were similar to the previous reports in Hangzhou and Beijing. Moreover, these patients were described as having community-onset and healthcare facility-associated diseases according to the guidelines of the Society for Healthcare Epidemiology of America and the Infectious Disease Society of America [64]. Thus, we inferred that CDI cases might be sporadic in this regional communities. Even though ribotype 027 was not found in these regions, we should pay more attention to this genotype due to its hyper-virulence property [64]. Continued surveillance is extremely important to monitor the characteristics of C. difficile epidemiology in the communities in China by using the mPCR-CE and/or other assays.

In conclusion, we successfully developed mPCR-CE for simultaneous detection of six C. difficile-specific genes to discriminate between toxigenic and nontoxigenic C. difficile species and to differentiate between 027 and non-027 isolates. No ribotype 027 was detected in this region. PCR ribotyping is considered as one of the gold standards to identify 027 and other hyper-virulent strains. Even though ribotypes 017, 001, and 012 are predominant in this region, ribotype 027 is an important genotype being monitored routinely in clinic. In comparison with other available assays, mPCR-CE assay provides another tool to simultaneously detect and differentiate toxigenic C. difficile in stool specimens. mPCR-CE assay should also be employed to monitor CDI and C. difficile colonization in hospitals and communities in China.

Acknowledgements

This work was supported by the Programs for Major Science and Technology Medicine and Healthcare in Zhejiang (No. WKJ-ZJ-1507), the Key Research and Development Program of Zhejiang (Nos. 2015G03048 and 2017C03028), the National Natural Science Foundation of China (No. 81471998), the Project of Medical Health and Technology in Zhejiang (No. 2016DTB005), and the National Cancer Institute at the National Institutes of Health Support Grant (No. P30 CA008748).

Footnotes

Hanjiang Lai, Chen Huang, Jian Cai, Julian Ye, Jun She, Yi Zheng, Liqian Wang, Yelin Wei, Weijia Fang, Xianjun Wang, Yi-Wei Tang, Yun Luo, and Dazhi Jin declare that they have no conflict of interest. This study as a part of the Programs for Major Science and Technology Medicine and Healthcare in Zhejiang (No. WKJ-ZJ-1507) has been approved by the Institutional Review Boards of ZJCDC. This study was presented in part at the 114th American Society for Microbiology Annual Meeting, Boston, MA, 17 to 20 May 2014.

References

  • 1.Leffler DA, Lamont JT. Clostridium difficile Infection. N Engl J Med 2015; 373(3): 287–288 [DOI] [PubMed] [Google Scholar]
  • 2.Kelly CP, LaMont JT. Clostridium difficile—more difficult than ever. N Engl J Med 2008; 359(18): 1932–1940 [DOI] [PubMed] [Google Scholar]
  • 3.Indra A, Schmid D, Huhulescu S, Hell M, Gattringer R, Hasenberger P, Fiedler A, Wewalka G, Allerberger F. Characterization of clinical Clostridium difficile isolates by PCR ribotyping and detection of toxin genes in Austria, 2006 – 2007. J Med Microbiol 2008; 57(6): 702–708 [DOI] [PubMed] [Google Scholar]
  • 4.McDonald LC, Killgore GE, Thompson A, Owens RC Jr, Kazakova SV, Sambol SP, Johnson S, Gerding DN. An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med 2005; 353(23): 2433–2441 [DOI] [PubMed] [Google Scholar]
  • 5.Collins DA, Hawkey PM, Riley TV. Epidemiology of Clostridium difficile infection in Asia. Antimicrob Resist Infect Control 2013; 2(1): 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Asensio A, Monge D. Epidemiology of Clostridium difficile infection in Spain. Enferm Infecc Microbiol Clin 2012; 30(6): 333–337 ( in Spanish) [DOI] [PubMed] [Google Scholar]
  • 7.Bourgault AM, Lamothe F, Loo VG, Poirier L. In vitro susceptibility of Clostridium difficile clinical isolates from a multi-institutional outbreak in Southern Québec, Canada. Antimicrob Agents Chemother 2006; 50(10): 3473–3475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Borgmann S, Kist M, Jakobiak T, Reil M, Scholz E, von Eichel-Streiber C, Gruber H, Brazier JS, Schulte B. Increased number of Clostridium difficile infections and prevalence of Clostridium difficile PCR ribotype 001 in southern Germany. Euro Surveill 2008; 13(49): 19057. [PubMed] [Google Scholar]
  • 9.Jin D, Luo Y, Huang C, Cai J, Ye J, Zheng Y, Wang L, Zhao P, Liu A, Fang W, Wang X, Xia S, Jiang J, Tang YW. Molecular epidemiology of Clostridium difficile infection in hospitalized patients in Eastern China. J Clin Microbiol 2017;55(3):801–810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Snydman DR, McDermott LA, Jacobus NV, Thorpe C, Stone S, Jenkins SG, Goldstein EJ, Patel R, Forbes BA, Mirrett S, Johnson S, Gerding DN. U.S.-based national sentinel surveillance study for the epidemiology of Clostridium difficile-associated diarrheal isolates and their susceptibility to fidaxomicin. Antimicrob Agents Che-mother 2015; 59(10): 6437–6443 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Debast SB, Bauer MP, Kuijper EJ; European Society of Clinical Microbiology and Infectious Diseases. European Society of Clinical Microbiology and Infectious Diseases: update of the treatment guidance document for Clostridium difficile infection. Clin Micro-biol Infect 2014; 20(Suppl 2): 1–26 [DOI] [PubMed] [Google Scholar]
  • 12.Loo VG, Poirier L, Miller MA, Oughton M, Libman MD, Michaud S, Bourgault AM, Nguyen T, Frenette C, Kelly M, Vibien A, Brassard P, Fenn S, Dewar K, Hudson TJ, Horn R, René P, Monczak Y, Dascal A. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. N Engl J Med 2005; 353(23): 2442–2449 [DOI] [PubMed] [Google Scholar]
  • 13.Merrigan M, Venugopal A, Mallozzi M, Roxas B, Viswanathan VK, Johnson S, Gerding DN, Vedantam G. Human hypervirulent Clostridium difficile strains exhibit increased sporulation as well as robust toxin production. J Bacteriol 2010; 192(19): 4904–4911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Perelle S, Gibert M, Bourlioux P, Corthier G, Popoff MR. Production of a complete binary toxin (actin-specific ADP-ribosyltransferase) by Clostridium difficile CD196. Infect Immun 1997; 65(4): 1402–1407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Samie A, Obi CL, Franasiak J, Archbald-Pannone L, Bessong PO, Alcantara-Warren C, Guerrant RL. PCR detection of Clostridium difficile triose phosphate isomerase (tpi), toxin A (tcdA), toxin B (tcdB), binary toxin (cdtA, cdtB), and tcdC genes in Vhembe District, South Africa. Am J Trop Med Hyg 2008; 78(4): 577–585 [PubMed] [Google Scholar]
  • 16.Lemee L, Dhalluin A, Testelin S, Mattrat MA, Maillard K, Lemeland JF, Pons JL. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J Clin Microbiol 2004; 42(12): 5710–5714 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Curry SR, Marsh JW, Muto CA, O’Leary MM, Pasculle AW, Harrison LH. tcdC genotypes associated with severe TcdC truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 2007; 45(1): 215–221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Brecher SM, Novak-Weekley SM, Nagy E. Laboratory diagnosis of Clostridium difficile infections: there is light at the end of the colon. Clin Infect Dis 2013; 57(8): 1175–1181 [DOI] [PubMed] [Google Scholar]
  • 19.Ryder AB, Huang Y, Li H, Zheng M, Wang X, Stratton CW, Xu X, Tang YW. Assessment of Clostridium difficile infections by quantitative detection of tcdB toxin by use of a real-time cell analysis system. J Clin Microbiol 2010; 48(11): 4129–4134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Quinn CD, Sefers SE, Babiker W, He Y, Alcabasa R, Stratton CW, Carroll KC, Tang YW. Diff Quik Chek complete enzyme immunoassay provides a reliable first-line method for detection of Clostridium difficile in stool specimens. J Clin Microbiol 2010; 48(2): 603–605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sloan LM, Duresko BJ, Gustafson DR, Rosenblatt JE. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis of Clostridium difficile infection. J Clin Microbiol 2008; 46(6): 1996–2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Persson S, Torpdahl M, Olsen KE. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcdA) and toxin B (tcdB) and the binary toxin (cdtA/cdtB) genes applied to a Danish strain collection. Clin Microbiol Infect 2008; 14(11): 1057–1064 [DOI] [PubMed] [Google Scholar]
  • 23.O’Horo JC, Jones A, Sternke M, Harper C, Safdar N. Molecular techniques for diagnosis of Clostridium difficile infection: systematic review and meta-analysis. Mayo Clin Proc 2012; 87(7): 643–651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chapin KC, Dickenson RA, Wu F, Andrea SB. Comparison of five assays for detection of Clostridium difficile toxin. J Mol Diagn 2011; 13(4): 395–400 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Huang B, Li H, Jin D, Stratton CW, Tang YW. Real-time cellular analysis for quantitative detection of functional Clostridium difficile toxin in stool. Expert Rev Mol Diagn 2014; 14(3): 281–291 [DOI] [PubMed] [Google Scholar]
  • 26.Chow WH, McCloskey C, Tong Y, Hu L, You Q, Kelly CP, Kong H, Tang YW, Tang W. Application of isothermal helicase-dependent amplification with a disposable detection device in a simple sensitive stool test for toxigenic Clostridium difficile. J Mol Diagn 2008; 10(5): 452–458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Polage CR, Gyorke CE, Kennedy MA, Leslie JL, Chin DL, Wang S, Nguyen HH, Huang B, Tang YW, Lee LW, Kim K, Taylor S, Romano PS, Panacek EA, Goodell PB, Solnick JV, Cohen SH. Overdiagnosis of Clostridium difficile infection in the molecular test era. JAMA Intern Med 2015; 175(11): 1792–1801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Shin BM, Yoo SM, Shin WC. Evaluation of Xpert C. difficile, BD MAX Cdiff, IMDx C. difficile for Abbott m2000, and Illumigene C. difficile assays for direct detection of toxigenic Clostridium difficile in stool specimens. Ann Lab Med 2016; 36(2): 131–137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Du P, Cao B, Wang J, Li W, Jia H, Zhang W, Lu J, Li Z, Yu H, Chen C, Cheng Y. Sequence variation in tcdA and tcdB of Clostridium difficile: ST37 with truncated tcdA is a potential epidemic strain in China. J Clin Microbiol 2014; 52(9): 3264–3270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cheng JW, Xiao M, Kudinha T, Xu ZP, Hou X, Sun LY, Zhang L, Fan X, Kong F, Xu YC. The first two Clostridium difficile ribotype 027/ST1 isolates identified in Beijing, China—an emerging problem or a neglected threat? Sci Rep 2016; 6(1): 18834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wang P, Zhou Y, Wang Z, Xie S, Zhang T, Lin M, Li R, Tan J, Chen Y, Jiang B. Identification of Clostridium difficile ribotype 027 for the first time in Mainland China. Infect Control Hosp Epidemiol 2014; 35(1): 95–98 [DOI] [PubMed] [Google Scholar]
  • 32.Oh MH, Paek SH, Shin GW, Kim HY, Jung GY, Oh S. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR. J Food Prot 2009; 72(6): 1262–1266 [DOI] [PubMed] [Google Scholar]
  • 33.Hung CC, Chen CP, Lin SP, Chien SC, Lee CN, Cheng WF, Hsieh WS, Liu MS, Su YN, Lin WL. Quantitative assay of deletion or duplication genotype by capillary electrophoresis system: application in Prader – Willi syndrome and Duchenne muscular dystrophy. Clin Chem 2006; 52(12): 2203–2210 [DOI] [PubMed] [Google Scholar]
  • 34.Guo L, Qiu B, Chi Y, Chen G. Using multiple PCR and CE with chemiluminescence detection for simultaneous qualitative and quantitative analysis of genetically modified organism. Electrophoresis 2008; 29(18): 3801–3809 [DOI] [PubMed] [Google Scholar]
  • 35.Brooks G, Carroll K, Butel J, Morse S. Jawetz, Melnick & Adelberg’s Medical Microbiology. Columbus, OH: McGraw-Hill, 2007 [Google Scholar]
  • 36.Fang WJ, Jing DZ, Luo Y, Fu CY, Zhao P, Qian J, Tian BR, Chen XG, Zheng YL, Zheng Y, Deng J, Zou WH, Feng XR, Liu FL, Mou XZ, Zheng SS. Clostridium difficile carriage in hospitalized cancer patients: a prospective investigation in Eastern China. BMC Infect Dis 2014; 14(1): 523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bélanger SD, Boissinot M, Clairoux N, Picard FJ, Bergeron MG. Rapid detection of Clostridium difficile in feces by real-time PCR. J Clin Microbiol 2003; 41(2): 730–734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sanchez-Vega B, Vega F, Medeiros LJ, Lee MS, Luthra R. Quantification of bcl-2/JH fusion sequences and a control gene by multiplex real-time PCR coupled with automated amplicon sizing by capillary electrophoresis. J Mol Diagn 2002, 4(4): 223–229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Spigaglia P, Mastrantonio P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 2002; 40(9): 3470–3475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Huang B, Jin D, Zhang J, Sun JY, Wang X, Stiles J, Xu X, Kamboj M, Babady NE, Tang YW. Real-time cellular analysis coupled with a specimen enrichment accurately detects and quantifies Clostridium difficile toxins in stool. J Clin Microbiol 2014; 52(4): 1105–1111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Indra A, Blaschitz M, Kernbichler S, Reischl U, Wewalka G, Allerberger F. Mechanisms behind variation in the Clostridium difficile 16S-23S rRNA intergenic spacer region. J Med Microbiol 2010; 59(11): 1317–1323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Indra A, Huhulescu S, Schneeweis M, Hasenberger P, Kernbichler S, Fiedler A, Wewalka G, Allerberger F, Kuijper EJ. Characterization of Clostridium difficile isolates using capillary gel electrophoresis-based PCR ribotyping. J Med Microbiol 2008; 57(11): 1377–1382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Carroll KC, Buchan BW, Tan S, Stamper PD, Riebe KM, Pancholi P, Kelly C, Rao A, Fader R, Cavagnolo R, Watson W, Goering RV, Trevino EA, Weissfeld AS, Ledeboer NA. Multicenter evaluation of the Verigene Clostridium difficile nucleic acid assay. J Clin Microbiol 2013; 51(12): 4120–4125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Knight DR, Elliott B, Chang BJ, Perkins TT, Riley TV. Diversity and evolution in the genome of Clostridium difficile. Clin Microbiol Rev 2015; 28(3): 721–741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yan Q, Zhang J, Chen C, Zhou H, Du P, Cui Z, Cen R, Liu L, Li W, Cao B, Lu J, Cheng Y. Multilocus sequence typing (MLST) analysis of 104 Clostridium difficile strains isolated from China. Epidemiol Infect 2013; 141(1): 195–199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen YB, Gu SL, Wei ZQ, Shen P, Kong HS, Yang Q, Li LJ. Molecular epidemiology of Clostridium difficile in a tertiary hospital of China. J Med Microbiol 2014; 63(Pt 4): 562–569 [DOI] [PubMed] [Google Scholar]
  • 47.Huang H, Wu S, Chen R, Xu S, Fang H, Weintraub A, Nord CE. Risk factors of Clostridium difficile infections among patients in a university hospital in Shanghai, China. Anaerobe 2014; 30: 65–69 [DOI] [PubMed] [Google Scholar]
  • 48.Lihua Z, Danfeng D, Cen J, Xuefeng W, Yibing P. Clinical characterization and risk factors of Clostridium difficile infection in elderly patients in a Chinese hospital. J Infect Dev Ctries 2015; 9(4): 381–387 [DOI] [PubMed] [Google Scholar]
  • 49.Wang P, Zhou Y, Wang Z, Xie S, Zhang T, Lin M, Li R, Tan J, Chen Y, Jiang B. Identification of Clostridium difficile ribotype 027 for the first time in Mainland China. Infect Control Hosp Epidemiol 2014; 35(1): 95–98 [DOI] [PubMed] [Google Scholar]
  • 50.Deak E, Miller SA, Humphries RM. Comparison of Illumigene, Simplexa, and AmpliVue Clostridium difficile molecular assays for diagnosis of C. difficile infection. J Clin Microbiol 2014; 52(3): 960–963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Spina A, Kerr KG, Cormican M, Barbut F, Eigentler A, Zerva L, Tassios P, Popescu GA, Rafila A, Eerola E, Batista J, Maass M, Aschbacher R, Olsen KE, Allerberger F. Spectrum of enteropathogens detected by the FilmArray GI Panel in a multicentre study of community-acquired gastroenteritis. Clin Microbiol Infect 2015; 21 (8): 719–728 [DOI] [PubMed] [Google Scholar]
  • 52.Pallis A, Jazayeri J, Ward P, Dimovski K, Svobodova S. Rapid detection of Clostridium difficile toxins from stool samples using real-time multiplex PCR. J Med Microbiol 2013; 62(Pt 9): 1350–1356 [DOI] [PubMed] [Google Scholar]
  • 53.Jensen MB, Olsen KE, Nielsen XC, Hoegh AM, Dessau RB, Atlung T, Engberg J. Diagnosis of Clostridium difficile: real-time PCR detection of toxin genes in faecal samples is more sensitive compared to toxigenic culture. Eur J Clin Microbiol Infect Dis 2015; 34(4): 727–736 [DOI] [PubMed] [Google Scholar]
  • 54.Guilbault C, Labbé AC, Poirier L, Busque L, Béliveau C, Laverdière M. Development and evaluation of a PCR method for detection of the Clostridium difficile toxin B gene in stool specimens. J Clin Microbiol 2002; 40(6): 2288–2290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Gilbreath JJ, Verma P, Abbott AN, Butler-Wu SM. Comparison of the Verigene Clostridium difficile, Simplexa C. difficile Universal Direct, BD MAX Cdiff, and Xpert C. difficile assays for the detection of toxigenic C. difficile. Diagn Microbiol Infect Dis 2014; 80(1): 13–18 [DOI] [PubMed] [Google Scholar]
  • 56.Hirvonen JJ, Kaukoranta SS. Comparison of BD Max Cdiff and GenomEra C. difficile molecular assays for detection of toxigenic Clostridium difficile from stools in conventional sample containers and in FecalSwabs. Eur J Clin Microbiol Infect Dis 2015; 34(5): 1005–1009 [DOI] [PubMed] [Google Scholar]
  • 57.Persson S, Jensen JN, Olsen KE. Multiplex PCR method for detection of Clostridium difficile tcdA, tcdB, cdtA, and cdtB and internal in-frame deletion of tcdC. J Clin Microbiol 2011; 49(12): 4299–4300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Spigaglia P Recent advances in the understanding of antibiotic resistance in Clostridium difficile infection. Ther Adv Infect Dis 2016; 3(1): 23–42 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Spigaglia P, Barbanti F, Mastrantonio P. Tetracycline resistance gene tet(W) in the pathogenic bacterium Clostridium difficile. Antimicrob Agents Chemother 2008; 52(2): 770–773 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Spigaglia P, Barbanti F, Mastrantonio P, Brazier JS, Barbut F, Delmée M, Kuijper E, Poxton IR; European Study Group on Clostridium difficile (ESGCD). Fluoroquinolone resistance in Clostridium difficile isolates from a prospective study of C. difficile infections in Europe. J Med Microbiol 2008; 57(Pt 6): 784–789 [DOI] [PubMed] [Google Scholar]
  • 61.Jalal H, Stephen H, Curran MD, Burton J, Bradley M, Carne C. Development and validation of a rotor-gene real-time PCR assay for detection, identification, and quantification of Chlamydia trachomatis in a single reaction. J Clin Microbiol 2006; 44(1): 206–213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Jin DZ, Wen SY, Chen SH, Lin F, Wang SQ. Detection and identification of intestinal pathogens in clinical specimens using DNA microarrays. Mol Cell Probes 2006; 20(6): 337–347 [DOI] [PubMed] [Google Scholar]
  • 63.Tringe SG, Hugenholtz P. A renaissance for the pioneering 16S rRNA gene. Curr Opin Microbiol 2008; 11(5): 442–446 [DOI] [PubMed] [Google Scholar]
  • 64.Cohen SH, Gerding DN, Johnson S, Kelly CP, Loo VG, McDonald LC, Pepin J, Wilcox MH; Society for Healthcare Epidemiology of America; Infectious Diseases Society of America. Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the society for healthcare epidemiology of America (SHEA) and the infectious diseases society of America (IDSA). Infect Control Hosp Epidemiol 2010;31(5):431–455 [DOI] [PubMed] [Google Scholar]

RESOURCES