Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2019 Sep 17;85(19):e00800-19. doi: 10.1128/AEM.00800-19

Putative Adhesion Factors in Vaginal Lactobacillus gasseri DSM 14869: Functional Characterization

Zhu Zeng a,c, Fanglei Zuo b,c, Harold Marcotte c,✉
Editor: Emma R Masterd
PMCID: PMC6752014  PMID: 31420338

Lactobacilli are known to contribute to the maintenance of a healthy vaginal microbiota and some are selected as probiotics for the prevention or treatment of urogenital diseases, such as bacterial vaginosis. However, the molecular mechanisms for these health-promoting effects are not fully understood. Here, we functionally identified three cell surface factors of a Lactobacillus gasseri strain potentially involved in its adhesion to vaginal epithelial cells, including exopolysaccharides (EPSs) and two sortase-dependent proteins (N506_1778 and N506_1709). We could demonstrate the tissue-specific adhesion of EPSs to vaginal cells and that N506_1709 might be a novel adhesin specifically mediating bacterial binding to stratified squamous epithelial cells. The results provide important new information on the molecular mechanisms of vaginal Lactobacillus spp. adhesion.

KEYWORDS: EPS, Lactobacillus gasseri, adhesion, probiotic, sortase-dependent proteins

ABSTRACT

Lactobacilli play an important role in the maintenance of a healthy vaginal microbiota, and some select species are widely used as probiotics. Vaginal isolates of Lactobacillus gasseri DSM 14869 and Lactobacillus rhamnosus DSM 14870 were previously selected to develop the probiotic EcoVag capsules and showed therapeutic effects in women with bacterial vaginosis (BV). However, the molecular mechanisms involved in their probiotic activity are largely unknown. In this study, we identified three cell surface molecules in L. gasseri DSM 14869 that promote adhesion to vaginal epithelial cells (VEC) by constructing dedicated knockout mutants, including exopolysaccharides (EPSs), a protein containing MucBP-like domains (N506_1778), and a putative novel adhesin (N506_1709) with rib/alpha-like domain repeats. EPS knockout mutants revealed 20-fold and 14-fold increases in adhesion to Caco-2 and HeLa cells, respectively, compared with wild type, while the adhesion to VEC was reduced 30% by the mutation, suggesting that EPSs might mediate tissue tropism for vaginal cells. A significant decrease in adhesion to Caco-2 cells, HeLa cells, and VEC was observed in the N506_1778 knockout mutant. The N506_1709 mutant showed no significant difference for the adhesion to Caco-2 and HeLa cells compared with wild type (WT); in contrast, the adhesion to VEC revealed a significant decrease (42%), suggesting that N506_1709 might mediate specific binding to stratified squamous epithelial cells, and this putative novel adhesin was annotated as Lactobacillus vaginal epithelium adhesin (LVEA). Thus, we have discovered an important role for EPSs and a novel adhesin, LVEA, in the adhesive capacity of a vaginal probiotic Lactobacillus strain.

IMPORTANCE Lactobacilli are known to contribute to the maintenance of a healthy vaginal microbiota and some are selected as probiotics for the prevention or treatment of urogenital diseases, such as bacterial vaginosis. However, the molecular mechanisms for these health-promoting effects are not fully understood. Here, we functionally identified three cell surface factors of a Lactobacillus gasseri strain potentially involved in its adhesion to vaginal epithelial cells, including exopolysaccharides (EPSs) and two sortase-dependent proteins (N506_1778 and N506_1709). We could demonstrate the tissue-specific adhesion of EPSs to vaginal cells and that N506_1709 might be a novel adhesin specifically mediating bacterial binding to stratified squamous epithelial cells. The results provide important new information on the molecular mechanisms of vaginal Lactobacillus spp. adhesion.

INTRODUCTION

The vaginal microbiota of a healthy woman is usually dominated by lactobacilli, and the most frequently occurring species are Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus vaginalis, and Lactobacillus iners (1–3). These lactobacilli adhere to vaginal epithelial cells and are involved in maintaining the normal vaginal microbiota and preventing the growth of pathogenic microorganisms (4). An imbalance of the normal microbiota, and particularly a loss of lactobacilli, predisposes women to urogenital infections, such as bacterial vaginosis (BV) (5). Supplying selected lactobacilli might be a rational therapeutic strategy in restoring a healthy microbiota and preventing infections (6, 7). To meet this challenge, commercial EcoVag vaginal capsules which consist of two strains (L. gasseri DSM 14869 and L. rhamnosus DSM 14870, 108 CFU for each strain) isolated from vaginal epithelial cells of healthy women have previously been developed (8). Supplementation of standard antibiotic treatment with vaginal EcoVag capsules provides a long-lasting cure against BV (9–11). In spite of the wealth of clinical data showing the health benefits of L. gasseri DSM 14869 and L. rhamnosus DSM 14870 in humans, there is still a lack of understanding of the cell surface factors or molecular mechanisms underlying their probiotic activities.

Studies suggest that the health-promoting effects of probiotics could be related to their capacity to adhere to epithelial cells and/or mucus, as it can promote colonization, pathogen exclusion, and interactions with the host (12, 13). Bacterial adherence to the host epithelial surface is often mediated by the cell surface components, including sortase-dependent proteins (SDPs) and other cell surface molecules, such as exopolysaccharides (EPSs), lipoteichoic acid and S-layer proteins (12), and extracellular appendages, such as pili, fimbriae, and flagella (14).

EPSs contribute significantly to lactobacilli-host interactions, especially with the intestinal mucosa and epithelial cells, thus contributing to the strain-specific probiotic characteristics (12). Bacterial polysaccharides vary in sugar composition, position of branches, and modifications, contributing to the wide diversity of surface structures (15). EPSs have been reported to be involved in aggregation, biofilm formation, adhesive properties, and immunomodulation by probiotic strains (16–19).

SDPs are an important group of cell surface proteins in Gram-positive bacteria, which are best characterized in lactobacilli and suggested to play a key role in bacterial adhesion (20). These SDPs share a structure, including a YSIRK signal peptide that promotes secretion (21), a C-terminal LPXTG anchoring motif, followed by a transmembrane helix, and a positively charged tail (12, 22). After the surface protein precursor is transferred to the plasma membrane, it will be cleaved and covalently anchored to the cell wall by sortase A (23). Different SDPs have been identified in lactobacilli, including the mucus-binding pilin SpaC in L. rhamnosus GG (24), Lactobacillus epithelium adhesion (LEA) in L. crispatus ST1 (25), mucus binding protein A (CmbA) in Lactobacillus reuteri ATCC PTA6475 (22), and mannose-specific adhesin MsI in L. plantarum CMPG5300 (26). However, until now, very few SDPs have been identified in human vaginal lactobacilli.

L. gasseri DSM 14869 and L. rhamnosus DSM 14870 were previously shown to persist in the vagina of 80% of the women at least 2 weeks after stopping capsule administration and in 20% of the women 3 months later (11). They also showed high adhesion ability to Caco-2 and vaginal epithelial cells in vitro compared with L. rhamnosus GG and other vaginal strains (8). The complete genome sequence analysis was further performed in order to better understand the molecular basis for their probiotic activities (8). For the genome of L. rhamnosus DSM 14870, the most notable features were the absence of genes involved in the production of long galactose-rich EPSs and the presence of the spaCBA-srtC pilus gene locus which was found to be expressed in a vaginal strain. Unique to the L. gasseri DSM 14869 genome was the presence of a putative EPS cluster and a gene encoding a putative new adhesin containing three rib/alpha-like repeats (8). The genomes of L. rhamnosus DSM 14870 and L. rhamnosus GG share many common putative adhesin-encoding genes, some of which have already been characterized, including the genes encoding SpaCBA, MBF, MabA, and SpaFED (8, 24, 27–30). On the other hand, very little is known about the mechanisms of adhesion of L. gasseri despite the importance of this species in the vaginal ecosystem.

In this study, we aimed to characterize the L. gasseri DSM 14869 surface molecules that mediate adhesion to the human vaginal mucosa, including the EPSs, a protein (N506_1778) with mucus-binding-like domains, and a putative novel protein (N506_1709) with rib/alpha-like repeat domains. Our results suggest that the genes encoding EPSs, N506_1778, and N506_1709 contribute to the ability of L. gasseri DSM 14869 to adhere to vaginal epithelial cells in vitro.

RESULTS

Identification of a putative EPS gene cluster in L. gasseri DSM 14869.

The genome of L. gasseri DSM 14869 (8) harbors a putative EPS cluster composed of 16 genes (N506_0396 to N506_0411) (Fig. 1A) and shares a high degree of similarity to L. gasseri ATCC 33323 (31). These genes are predicted to be involved in EPS biosynthesis (Fig. 1A), including those encoding glycosyltransferases and proteins involved in polymerization, export, and chain length determination (16). Based on a BLASTP analysis, the N506_0400 gene encodes a putative priming glycosyltransferase protein, sharing 91% amino acid homology with priming glycosyltransferase epsE in Lactobacillus johnsonii FI9785 (32). Priming glycosyltransferase has been demonstrated to be a necessary control point of EPS biosynthesis (32), and we, thus, hypothesized that the deletion of the putative priming glycosyltransferase gene (N506_0400) could affect L. gasseri DSM 14869 EPS production.

FIG 1.

FIG 1

Schematic representation of the EPS gene cluster (A) and protein domains of N506_1778 (B) and N506_1709 (C) in L. gasseri DSM 14869. (A) The EPS gene cluster (N506_0396 to N506_0411), which is located at nucleotide numbers 379,930 to 394,580 in the genome sequence (GenBank accession number CP006803), is shown. The enzyme and gene names were annotated by BLASTP analysis using the strains L. gasseri ATCC 33323 and L. gasseri CECT 5714 (8). (B) The N506_1778 protein includes a YSIRK signal sequence in the N terminus and a Gram-positive LPXTG (LPQTG) motif in the C terminus. The repetitive region consists of two MucBP-like domains. (C) The N506_1709 protein includes an N-terminal YSIRK signal sequence and a C-terminal LPQTG motif. The repeat region harbors three different rib/alpha-like repeats, including one that is only partial. The N terminus (ca. 1 to 900 aa) shows high sequence identity (99%) with a hypothetical protein (LJCM1025_14810) from L. gasseri LJCM1025 but has no similarities with other proteins in the data bank, while the C terminus (ca. 900 to 1456 aa) shows low percentage identity (34 to 48%) with the C terminus of proteins from L. johnsonii (GenBank accession numbers WP_095670316, OYS15157, WP_061400034, OYS08635, OYS05727, OUL52955, and AHA97914). Genes and protein structure are not represented at scale.

Deletion of the N506_0400 gene influences the total level of EPSs.

Transmission electron microscopy (TEM) pictures clearly showed that the N506_0400 gene deletion mutant strain (ΔEPS) produces significantly (P < 0.001) less EPS layer around the cell surface than the wild type (WT) strain (Fig. 2). The reintroduction of the functional N506_0400 gene into the mutant strain completely restored the thickness of EPS layer to the WT levels.

FIG 2.

FIG 2

(A) Transmission electron microscopy pictures of L. gasseri DSM 14869 wild-type (WT), EPS mutant (ΔEPS), and complemented strains. A dense EPS layer was observed in WT, while the EPS production on the surface was significantly reduced for the EPS mutant strain. The EPS complement strain restored the EPS level to WT. Scale bar = 200 nm. (B) Comparison of the thickness of EPS layer of WT, ΔEPS, and EPS complement strains. The relative thickness is shown as a percentage relative to WT (set at 100%). Thickness was evaluated in 10 cells for each strain, and the mean ± SD of thickness per cell was determined. **, P < 0.01; ***, P < 0.001.

Deletion of the N506_0400 gene results in increased autoaggregation and biofilm formation.

When the N506_0400 mutant strain L. gasseri DSM 14869-ΔN506_0400 (ΔEPS) was grown in liquid medium, no significant difference in the growth rate was observed compared to WT L. gasseri DSM 14869. However, the mutant showed cell sediment and a very clear upper solution as a result of autoaggregation, while the WT strain and the complemented strain showed a relatively homogenous suspension (Fig. 3A). The mutant strain L. gasseri DSM 14869-ΔN506_0400 displayed a significant (P < 0.001) increase of autoaggregation ability to 216% of that of the WT. The autoaggregation in the complemented strain was significantly lower than that in the mutant strain but was only 136% of the WT level, indicating that the phenotype was not completely restored by complementation (Fig. 3A).

FIG 3.

FIG 3

(A) Phenotypic and quantitative analysis of autoaggregation of L. gasseri DSM 14869 (WT) and its mutant derivatives. The autoaggregation capacities are shown as a percentage relative to wild-type strain (set at 100%). Data represent means ± SD of three independent experiments; *, P < 0.05, ***, P < 0.001. (B) Quantification of biofilm formation of WT and its mutant derivatives. The biofilms formed on polystyrene plates were assessed after 72 h of incubation in MRS medium using crystal violet staining. Data represent means ± SD of three independent experiments; ***, P < 0.001.

In addition, biofilm formation by the mutant strain ΔEPS was increased by 15-fold (P < 0.001) compared with that by the WT, as evaluated by the microtiter biofilm assay, while the complemented strain showed a sharp decrease in the biofilm formation but only to 8-fold that of the WT, indicating that the biofilm phenotype was only partially restored (Fig. 3B).

Impact of EPSs on adhesion of L. gasseri DSM 14869 to different epithelial cells.

Previous studies have shown that EPSs from intestinal lactobacilli are involved in adhesion to intestinal epithelial cells (16, 18, 19). In this study, we investigated the role of EPSs in the adhesive capacity of the vaginal strain L. gasseri DSM 14869. As observed in Fig. 4A, the EPS mutant L. gasseri DSM 14869-ΔN506_0400 showed a significant 20-fold increase (P < 0.001) in adhesion to the colon carcinoma cell line Caco-2 compared with the WT strain. In addition, the EPS mutant also had a significant roughly 14-fold increase (P < 0.001) in adhesion to cervical cancer cell line HeLa (Fig. 4B). The mutant strain complemented with the pNZe-N506_0400 gene showed restoration of the adhesive capacity to Caco-2 and HeLa cells nearly to WT level (Fig. 4A and B). We further investigated whether the EPS is also involved in the adhesion to vaginal epithelial cells. Interestingly, the EPS mutant strain showed a slight reduction (∼30%; P < 0.01) in adhesion to the vaginal epithelial cells (Fig. 4C), while the complemented strain (14869-ΔN506_0400/pNZe-N506_0400) showed partial restoration of the adhesion (Fig. 4C).

FIG 4.

FIG 4

Comparison of the adhesion ability of L. gasseri DSM 14869 wild-type, EPS mutant, and complemented strain. The adhesion rates are shown as a percentage relative to wild-type (set at 100%). Each panel shows the adhesion ability toward (A) Caco-2 cells, (B) HeLa cells, and (C) vaginal epithelial cells. Data represent means ± SD of three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Sequence analysis of putative adhesion proteins in L. gasseri DSM 14869.

Surface proteins are very important molecules involved in bacterial adhesion to mucus and epithelial cells. In the genome of L. gasseri DSM 14869, 22 predicated open reading frames (ORFs) with putative adhesion-related domains have previously been identified (8). However, only two ORFs (N506_1778 and N506_1709) encode both a YSIRK-type signal peptide (PF04650) and a LPXTG anchor motif (PF00746), which would result in a protein secreted and covalently anchored to the cell wall (Fig. 1B and C). Therefore, these two proteins were classified as SDPs and are both potentially involved in the adhesion of L. gasseri DSM 14869 to epithelial cells.

The N506_1778 gene in L. gasseri DSM 14869 is 5.055-kb long and encodes a protein of 1,684 amino acid residues with a predicted molecular weight of 186.7 kDa. The N terminus is a YSIRK-type signal peptide, and the C terminus contains a LPQTG (LPXTG-like cell wall anchor) motif which belongs to the Gram-positive LPXTG anchoring superfamily. The N506_1778 protein also contains 2 nonidentical repeats (amino acids 986 to 1,092 and 1,384 to 1,490), showing 66% amino acid identity (Fig. 1B). The two repeats show low homology with the mucin binding protein (MucBP) (PF06458) domain, with a 35% to 39% amino acid (aa) identity with the Mub-RV repeat of the mucus-binding protein (MUB) from L. reuteri ATCC 53608 (33), a 31% to 37% aa identity with Mub1 repeat of MUB from L. reuteri 1063 (34), and a 36% to 42% aa identity with MucBP domain (fragment 187 to 294 aa) of protein LBA1460 from L. acidophilus NCFM. Many MUB homologues and MucBP domain-containing proteins have been identified in lactobacilli naturally located in intestinal niches and have been suggested to play an important role in the adherence of probiotic strains to the intestinal mucin (22, 30, 33) and epithelial cells (22, 35). In this study, we found that N506_1778 and its homologues were also present in lactobacilli naturally located in vaginal niches. We subsequently compared the homologues of protein N506_1778 in all 10 known L. gasseri genomes (7 strains from the human vaginal tract) (Table 1). Interestingly, N506_1778 homologues were found to be contained by all the known L. gasseri genomes, with a 79% to 98% aa identity (Table 1). The high similarities with other homologous proteins in L. gasseri species suggest that N506_1778 may play essential roles for this species to adapt to different host niches. Thus, double-crossover recombination was used to knock out the gene N506_1778, and the mutant was evaluated for its adherent capacity to two human epithelial cell lines and to vaginal epithelial cells.

TABLE 1.

Homology of N506_1778 with other genes in L. gasseri

Strain Origin Homologous gene (GenBank accession no.) Amino acid identity (%)
L. gasseri ATCC33323 Human intestine LGAS_1655 (ABJ60948) 1,387/1,420 (98)
L. gasseri CECT 5714 Human milk A131_RS08225 (WP_003646778) 1,387/1,420 (98)
L gasseri K7 Infant feces LK7_008785 (KDA98452) 1,362/1,696 (80)
L. gasseri 224-1 Human vaginal tract HMPREF9209_2224 (EFB61564) 1,482/1,535 (97)
L. gasseri 2016 Human vaginal tract M497_RS0110705 (WP_003646778) 1,387/1,420 (98)
L. gasseri 202-4 Human vaginal tract HMPREF0890_1363 (EEQ26348) 796/1,010 (79)
L. gasseri JV-V03 Human vaginal tract HMPREF0514_11912 (EFJ68913) 1,359/1,706 (80)
L. gasseri MV-22 Human vaginal tract LBGG_01576 (EFQ45690) 1,387/1,420 (98)
L. gasseri SJ-9E-US Human vaginal tract HMPREF0516_01590 (KFL94804) 1,387/1,420 (98)
L. gasseri SV-16A-US Human vaginal tract HMPREF5175_01779 (KFL96562) 1,482/1,535 (97)

The N506_1709 gene in L. gasseri DSM 14869 consists of a 4.371-kb sequence encoding a large surface protein of 1,456 amino acids, with a predicted molecular weight of 158.9 kDa. This protein includes a YSIRK signal peptide, an N-terminal region (amino acids 42 to 1,233), an internal repeat region (amino acids 892 to 1,372) harboring three repeats (the first one is partial) which shows similarity to rib/alpha-like repeats domain (PF08428) in Pfam analysis, and an LPQTG anchoring motif in the C terminus (Fig. 1C). After BLASTP analysis, we found that N506_1709 has high sequence identity (99%) with a hypothetical protein (LJCM1025_14810) from L. gasseri LJCM1025 but less than 10% identity with other proteins in the data bank. The last 600 aa, containing the rib/alpha-like repeat region, shows 34% to 48% aa identity with surface proteins from L. johnsonii (Fig. 1C). The rib/alpha-like repeat domain was also found in several cell surface proteins of lactobacilli, and it was suggested that proteins with this domain may promote bacterial adhesion to stratified squamous epithelial cells (25, 36). Since the protein sequence features of N506_1709 suggest that it might be a new putative adhesion protein promoting the binding of L. gasseri DSM14869 to vaginal epithelial cells, the encoding gene was also deleted by double-crossover recombination.

N506_1778-mediated binding of L. gasseri DSM 14869 to Caco-2, HeLa, and human vaginal epithelial cells.

The growth rate of the N506_1778 mutant strain was not altered under the growth conditions used in the study. The effects of the N506_1778 mutation were determined by evaluating the ability of the mutant to adhere to Caco-2, HeLa, and vaginal epithelial cells in vitro. As shown in Fig. 5A to C, the mutation of N506_1778 resulted in a significant reduction in adhesion to Caco-2 (42%; P < 0.01), HeLa (32%; P < 0.001), and human vaginal cells (32%; P < 0.01) compared with the wild-type strain. The complementation with pNZe-N506_1778 restored the wild-type level adhesion capacity to vaginal cells (Fig. 5C).

FIG 5.

FIG 5

Comparison of the adhesion ability of L. gasseri DSM 14869 wild-type, mutant Δ1778, and Δ1709 strains. The adhesion rates are shown as a percentage relative to wild-type (set at 100%). Each panel shows the adhesion ability toward (A) Caco-2 cells, (B) HeLa cells, and (C) vaginal epithelial cells. Data represent means ± SD of three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

N506_1709-mediated binding of L. gasseri DSM 14869 to human vaginal epithelial cells but not to Caco-2 and HeLa cells.

In order to determine the contribution of N506_1709 to bacterial adhesion, a N506_1709 knockout mutant was constructed. The mutant strain showed the same growth rate with wild type. The mutant was first evaluated for its adhesion to columnar epithelial cell lines Caco-2 and HeLa. As shown in Fig. 5A and B, the N506_1709 mutant strain L. gasseri DSM 14869-ΔN506_1709 did not show a significant difference for adhesion to Caco-2 and HeLa cells compared with the wild-type strain. Since N506_1709 includes a rib/alpha-like repeat domain, which has been suggested to be involved in binding to stratified squamous epithelial cells (25), we subsequently investigated if N506_1709 plays a role in adhesion to human vaginal cells, a type of stratified squamous epithelial cells. As displayed in Fig. 5C, the N506_1709 mutant showed a significant ca. 42% reduction (P < 0.001) in adhesive ability to human vaginal cells compared with wild type. To confirm the relation of the genotype-phenotype for the N506_1709 gene, the mutant strain was subsequently complemented by reintroducing the N506_1709 gene. The complemented strain L. gasseri DSM 14869-ΔN506_1709/pNZ8048-N506_1709 showed partial restoration of the adhesive levels (Fig. 5C).

Overexpression of N506_1709 in Lactococcus lactis NZ9000 increases adhesion to vaginal epithelial cells.

To further confirm the adhesion to vaginal epithelial cells by N506_1709, the protein N506_1709 was overexpressed in L. lactis NZ9000 using the pNZ8048 vector and its nisin-inducible expression system. L. lactis NZ9000 transformed with the empty plasmid pNZ8048 was used as a control. Realtime quantitative PCR (qRT-PCR) analysis revealed N506_1709 mRNA expression in recombinant L. lactis NZ9000 upon induction with 10 ng ml−1 nisin, similar to that of L. gasseri WT level (Fig. 6A). In addition, the adhesion ability to vaginal cells for the recombinant strain NZ9000/pNZ8048-1709Re showed a 2.8-fold increase compared with NZ9000/pNZ8048 carrying the empty vector control (P < 0.001) (Fig. 6B).

FIG 6.

FIG 6

(A) The mRNA expression of N506_1709 in recombinant strain L. lactis NZ9000/pNZ8048-1709Re. The L. gasseri DSM 14869 WT served as a control. N506_1709 mRNA expression in recombinant L. lactis upon induction with nisin was similar to the L. gasseri WT level. (B) Adhesion ability of overexpressed strain NZ9000/pNZ8048-1709Re to vaginal epithelial cells. The adhesion rates are shown as a percentage relative to NZ9000/pNZ8048 (set at 100%). Data represent means ± SD of three independent experiments; ***, P < 0.001.

DISCUSSION

L. gasseri is one of the major species isolated in the vaginal microbiota (1, 2), and several health benefits have been reported for L. gasseri strains (8, 37). However, the molecular mechanisms underlying the health-promoting effects, such as the adhesion factors that allow optimal adhesion of lactobacilli to this niche, are, in general, not yet well understood. In this study, we genetically identified and functionally analyzed three genes that may be involved in adhesion of the probiotic strain L. gasseri DSM 14869 to vaginal epithelial cells.

First, the function of the identified EPS gene cluster in L. gasseri DSM 14869 was evaluated by mutation of the N506_0400 gene, which encodes the putative priming glycosyltransferase. According to the literature, the gene encoding priming glycosyltransferase is highly conserved (38) and priming glycosyltransferase plays an essential role in the first step of EPS biosynthesis by transferring the first sugar to the UndP-lipid carrier (16). Mutation of the genes encoding the priming glycosyltransferase of L. johnsonii, L. rhamnosus, or Lactobacillus paracasei abolished or reduced heteropolysaccharide production (16, 19, 32). In this study, the reduced expression of surface-associated polysaccharide and increased autoaggregation and biofilm formation ability for the N506_0400 mutant strain also indicate a crucial role for the priming galactosyltransferase N506_0400 in the biosynthesis of EPSs of L. gasseri DSM 14869. However, the EPS production was not completely abolished in the N506_0400 mutant strain, suggesting that some other genes in the eps locus with a bifunctional role or other glycosyltransferase encoding genes independent from the eps locus might compensate for the absence of priming glycosyltransferase (39). Other studies have also reported that mutation of the priming glycosyltransferase reduces but does not abolish the EPS production (16, 19, 32, 40).

Interestingly, the EPS mutant showed an increased adherence to Caco-2 and HeLa cells but showed a decreased adherence to the vaginal epithelial cells. This suggests that the EPS molecules of L. gasseri DSM 14869 are required for its high adherence ability to the vaginal epithelial cells but not to Caco-2 or HeLa cells. The role of EPS in adhesion is still a matter of debate and it seems to show strain-specific property. For example, a deletion in the priming glycosyltransferase gene of L. rhamnosus GG was reported to strongly reduce galactose-rich polysaccharide content and increase glucose-rich polysaccharides, resulting in an increased adhesion to Caco-2 cells (16). Another study reported that mutation of the priming glycosyltransferase gene of L. paracasei abolished the production of the P2 fraction of EPS but retained the P1 fraction. This resulted in much lower adhesion to Caco-2 cells, suggesting that the molecular structure of the P2 matrix was most likely positively involved in the adhesion to Caco-2 (19). In addition, the role of EPSs on adhesion is possibly influenced by the cell surface characteristics of the strain, such as by shielding off cell surface adhesins. Several studies have shown that the EPSs can shield the adhesins and reduce the adherence capacity (18, 28, 41). Besides, specific components of EPS might bind exclusively to receptors on VECs but not on Caco-2 or HeLa cells. The L. gasseri DSM 14869 strain was isolated from female vaginal epithelial cells and might have obtained this trait to allow optimal adaptation to the vaginal niche. Our study reports that the EPSs of vaginal lactobacilli might provide tissue tropism adhesion. Further studies are required to identify the structure of EPS of the L. gasseri strain and the specific receptors on vaginal epithelial cells in order to better understand the strain-specific EPS properties at the molecular level. This will help us to better understand its specific contribution in probiotic-host interactions and its role in adaptation to this vaginal niche.

Increased adhesion to the intestinal mucosal layer by some lactobacilli has been suggested to be mediated by cell surface proteins with a mucus-binding capacity (22, 24, 30, 42). The N506_1778 protein, harboring 2 repeats with homology to the MucBP domain, was the only predicated cell wall-anchored protein that includes the MucBP-like domain in L. gasseri DSM 14869. Our results showed that the N506_1778 protein could promote adherence of L. gasseri DSM 14869 to Caco-2, HeLa, and human vaginal epithelial cells. N506_1778 homologues were found in all the known L. gasseri strains isolated from different niches (Table 1), suggesting that N506_1778 is an important cell surface protein for L. gasseri species to adapt to different host niches. Our study reports that a protein with a MucBP-like domain is also involved in adhesion to vaginal epithelial cells.

N506_1709 is another important cell surface protein mediating adhesion of L. gasseri DSM 14869 to vaginal mucosal cells. It is a newly described sortase-dependent adhesin that shows specific binding to stratified squamous epithelial cells. Interestingly, N506_1709 differs from the previously characterized Lactobacillus adhesins, such as Lsp, Mub, and mucus-binding factor (MBF) (30, 43, 44), as it contains no MuBP domains but instead harbors three repeated region with homology to rib/α-like repeats. Rib and alpha proteins were initially identified in Streptococcus spp. and were suggested to be involved in pathogen adhesion and biofilm formation (36, 45, 46). Later, proteins showing homology with rib/α-like repeats were also reported in vaginal lactobacilli, such as protein Rlp in L. fermentum and LEA in L. crispatus (25, 47). These proteins with rib/α-like repeat domains in lactobacilli were suggested to mediate binding to the stratified squamous epithelial lining of the host (25, 47). In this study, the N506_1709 mutant showed a significantly reduced adhesive capacity to vaginal epithelial cells stratified squamous epithelial cells, but not to colon carcinoma cells and cervical carcinoma cells (columnar epithelial cells). This suggests that the N506_1709 protein provides tissue tropism to L. gasseri DSM 14869, likely determined by the presence of different receptors on the cell membrane of vaginal epithelial cells. The overexpression of N506_1709 in L. lactis significantly improved L. lactis adhesion to vaginal epithelial cells, further confirming the adhesive capacity of N506_1709 to vaginal epithelial cells. Taken together, N506_1709 is an important surface protein mediating the adherence of L. gasseri to human vaginal epithelium, which could promote the bacterial colonization in the host and may be of ecological importance. In order to evaluate if any other adhesion factors are also involved in the adherence of this strain to the vaginal epithelium, construction of a double mutant inactivating both N506_1778 and N506_1709 will be made in the future. In this study, only human primary vaginal epithelial cells were used since primary cells are isolated directly from tissues, have normal cell morphology, and maintain many of the important markers and functions seen in vivo (48). Meanwhile, the primary vaginal epithelial cells are relatively easy to obtain and there are several papers in the literature that use primary vaginal cells for adhesion experiments (49, 50). However, investigating the adhesion in a vaginal cell line in the future would help validate our findings and support the main conclusion.

Biofilm formation is considered to be one of the important surface properties of probiotics involved in their beneficial effects on the host (51, 52). The EPS mutant of L. gasseri DSM 14869 showed a dramatic increase of biofilm formation capacity, which was speculated to be due to the change of the EPS structure and also exposure of more cell surface adhesins after removing the EPS (16, 28). We also tested the biofilm-forming capacity of the N506_1709 and N506_1778 knockout mutant strains. Both of them had a slightly decreased biofilm formation compared with the wild-type strain (by about 30%, data not shown), which is consistent with the reported literature showing that the biofilm formation in the vaginal L. plantarum CMPG 5300 strain could be due to sortase-dependent proteins (SDPs) since a sortase A (srtA) mutant of this strain has lost its biofilm-formation capacity (53). Simultaneous inactivation of EPSs and adhesins could probably better reveal the role N506_1709 or N506_1778 in biofilm formation.

In conclusion, the current report identifies and functionally analyzes three cell surface molecules, including EPS, N506_1778, and N506_1709, as important adhesion factors of L. gasseri DSM 14869 involved in vaginal adhesion. This report demonstrates the role of EPSs in adherence of a vaginal Lactobacillus strain and that a protein with MucBP-like domains could also be involved in vaginal epithelium adhesion. In addition, N506_1709 might be a novel adhesin specifically mediating bacterial binding to stratified squamous epithelial cells and was annotated as Lactobacillus vaginal epithelium adhesin (LVEA). The results provide important new information on the molecular mechanisms of Lactobacillus adhesion and tissue tropism to mucosal surfaces of various hosts and could help us to screen for better probiotic candidates in the future. Further studies are still needed to address the specific receptors for EPSs and LVEA on vaginal epithelial cells as well as the functional domains of LVEA.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 2. The Escherichia coli VE7108 (54) strain was incubated in Luria broth supplemented with 25 μg ml−1 of kanamycin at 37°C with shaking. Lactobacillus strains were statically grown in MRS broth at 37°C under anaerobic conditions. When required, the following antibiotics were added: 10 μg ml−1 chloramphenicol (Cm) and 300 μg ml−1 erythromycin (Em) for E. coli, and 10 μg ml−1 Cm and 5 μg ml−1 Em for Lactobacillus transformants.

TABLE 2.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s)a Source or reference
Strain
    E. coli VE7108 Containing the repA plasmid gene (not thermosensitive); Kmr 54
    L. gasseri DSM 14869 Parent strain BifodanA/S, Denmark
    14869-ΔN506_0400 14869 lacking the gene N506_0400 This study
    14869-ΔN506_1778 14869 lacking the gene N506_1788 This study
    14869-ΔN506_1709 14869 lacking the gene N506_1709 This study
    14869-ΔN506_0400/pNZe-N506_0400 14869-ΔN506_0400 harboring plasmid pNZe-N506_0400 This study
    14869-ΔN506_1778/pNZe-N506_1778 14869-ΔN506_1778 harboring pNZe-N506_1778 This study
    14869-ΔN506_1709/pNZ8048-N506_1709 14869-ΔN506_1709 harboring pNZ8048-N506_1709 This study
    Lactococcus lactis NZ9000 MG1363 pepN::nisRK 64
    L. lactis NZ9000/pNZ8048 L. lactis NZ9000 harboring empty vector pNZ8048 This study
    L. lactis NZ9000/pNZ8048-N506_1709Re L. lactis NZ9000 harboring pNZ8048-N506_1709Re This study
Plasmid
    pINTZrec Replicable plasmid-mediating homologous recombination; Cmr 57
    pINTZrec-N506_0400 pINTZrec derivative containing homologous regions up- and downstream of N506_0400; Cmr This study
    pINTZrec-N506_1778 pINTZrec derivative containing homologous regions up- and downstream of N506_1778; Cmr This study
    pINTZrec-N506_1709 pINTZrec derivative containing homologous regions up- and downstream of N506_1709; Cmr This study
    pNZ8048 E. coli-lactic acid bacterium shuttle cloning vector; Cmr 65
    pNZe-Rec pNZ8048 derivative; Emr Laboratory stock
    pNZe-N506_0400 pNZe-Rec derivative containing N506_0400; Emr This study
    pNZe-N506_1778 pNZe-N506_0400 derivative containing N506_1778; Emr This study
    pNZ8048-N506_1709 pNZ8048 derivative containing N506_1709 and its promoter; Cmr This study
    pNZ8048- N506_1709Re pNZ8048 derivative containing N506_1709; Cmr This study
a

Kmr, kanamycin resistance; Cmr, chloramphenicol resistance; Emr, erythromycin resistance.

DNA manipulations.

Standard DNA protocols were used for DNA manipulations in E. coli (55). Plasmid DNA of E. coli was extracted using a miniprep spin kit (Qiagen, Hilden, Germany). L. gasseri DNA was isolated using a QIAamp DNA stool minikit (Qiagen). Primers (Table 3) were synthesized by Eurofins Genomics (Ebersberg, Germany). Phusion high-fidelity DNA polymerase (Finnzymes/Thermo Fisher Scientific, Espoo, Finland) was used for amplification of L. gasseri genomic DNA, and GoTaq DNA polymerase (Promega, Fitchburg, WI, USA) was used for colony PCR. The PCR products were purified by a QIAquick gel extraction kit (Qiagen). The restriction endonucleases were supplied by Thermo Scientific, and T4 DNA ligase was from Invitrogen (Carlsbad, CA). All of the procedures were conducted according to the manufacturer’s instructions. Plasmids were transformed into L. gasseri DSM 14869 by electroporation as described previously (56).

TABLE 3.

List of primers used in this study

Primer name by application Sequence (5′-3′)a Restriction site
For gene knock out
    400upstream-F ACACAGAGCTCAGCTGGTGAAATGGATGGC SacI
    400upstream-R TTAACTTTTCTCCTTAAAATAACCAAAATCTTTTCTT
    400downstream-F TTGGTTATTTTAAGGAGAAAAGTTAAAAGTATG
    400downstream-R ACCAAGCTAGCTGTATCACTTTTGGTATTGA NheI
    Seq1-F ATTGGGTTCTAACAGAATGCGT
    INTZ-R TTCTCCCCCTAATAATTCTGCAG
    INTZ-F GGTTTTTATATTACAGCTCCAAG
    Seq1-R AATCCTGAATCACTTTCGGTTT
    1778upstream-F CAACGGAGCTCCGAAACTAATGGCATCAAT SacI
    1778upstream-R GTTTTTGGTGCAGAGAAATTTATATATAAAATAACGATTTTGT
    1778downstream-F TTGTATAGGAGAAACAAGGTTTCTTGATAATAAATAACATTAATAGC
    1778downstream-R CTTTAAGGATCCAAAAGAAGAAGCTAGAAAGGCTT BamHI
    Seq2-F CACATAATACCAGCAGTCAACGAA
    Seq2-R GTGCTCCAAGTAGTATCATAGCGAT
    1709upstream-F TTCCTGGAGCTCAAACTTTATTTTGTTCTGCCAA SacI
    1709upstream-R ATGTTATTTATTATCAAGAAACCTTGTTTCTCCTATACAATGT
    1709downstream-F TTGTATAGGAGAAACAAGGTTTCTTGATAATAAATAACATTAATAGC
    1709downstream-R CTTTAAGGATCCAAAAGAAGAAGCTAGAAAGGCTT BamHI
    Seq3-F GGCTAAAAACAGACTCCATCAATC
    Seq3-R AGCCCGTTCTTTCTTATAACTTTAA
For complementation
    EPS-Promoter-F AATTAGGTACCACACTGTAAAAATAAATAAGATCCT KpnI
    EPS-Promoter-R TTAACCTCTTGTGCCATCATTTTATTCCTCTTTTATTTTT
    N506_0400-F AAAAATAAAAGAGGAATAAAATGATGGCACAAGAGGTTAA
    N506_0400-R CTTTTAAGCTTAATACGCACTATTTGGATGAAT HindIII
    N506_1778-F TACATCGGTACCAAAATATGCGGTATGTATTTATCG KpnI
    N506_1778-R GGTGCAGGATCCTTAATTCTTTTTCTTTCGTTTAAGTT BamHI
    N506_1709-F1 AAGACAGATCTCGTAATTAAATTGATCAAGTACATTAT BglII
    N506_1709-R1 ACAAAGGTACCACCAGATTCCAT KpnI
    N506_1709-F2 CTGGTGGTACCTTTGTTTCAAAAGT KpnI
    N506_1709-R2 ATTATGAGCTCTTATCTAATTCGGTGTTTTCTTCTACTT SacI
For overexpression of N506_1709 in L. lactis
    N506_1709Re-F GAGAAACCATGGATGCTATCTAAAAATAATTTTCATG NcoI
    N506_1709 Re-R TTAATGAGCTCTTACGCTTCCGGTTCTCTAATTCGGTGTTTTCTTCTACTT SacI
For qRT-PCR
    L. gasseri 16S-F ACCCTTGTCATTAGTTGCCATCA
    L. gasseri 16S-R GCTTCTCGTTGTACCGTCCATT
    1709-F ATTGGAACGATTTGAAGAGCG
    1709-R GAATCAGTAGTGTGGGAACCGAC
    L. lactis 16S-F TCGTGTCGTGAGATGTTGGGT
    L. lactis 16S-R GTCATAAGGGGCATGATGATTTG
a

The restriction site is underlined in the primer sequence.

Construction of EPS (N506_0400), N506_1778, and N506_1709 knockout mutants by double homologous recombination.

In this study, the replicable plasmid pINTZrec (57) (see Fig. S1A in the supplemental material) was used to mediate homologous recombination. In this plasmid, the antibiotic resistance gene (Cmr) and the replicon are separated by two directly oriented 90-bp six recombination sites. The expression of the β-recombinase, catalyzing site-specific recombination between two six sites, is controlled by the sakacin-inducible promoter PorfX. Upon addition of the sakacin and the induced expression of the β-recombinase, the vector will recombine and lose function because of excision of the replicon.

For deletion of the N506_0400 gene from the genome of L. gasseri DSM 14869, about 1.0-kb up- and downstream fragments flanking the 5′ and 3′ ends of the N506_0400 gene were amplified by PCR using the primers 400upstream-F/R and 400downstream-F/R, respectively (Table 3). The generated amplicons were joined by overlap extension strategy using the primer pair 400upstream-F/downstream-R (Table 3). The resulting PCR products were digested with SacI and NheI and ligated into a similarly digested pINTZrec plasmid and transformed into electrocompetent E. coli VE7108 to obtain the final plasmid construct pINTZrec-N506_0400. Then pINTZrec-N506_0400 was electrotransformed into competent L. gasseri DSM 14869 cells which were prepared as described by De Keersmaecker et al. (56). For recombination-activated gene expression, the β-recombinase gene expression was induced with sakacin P. Sakacin P was obtained as a >95% pure synthesized peptide (Genscript, USA). Briefly, the transformed L. gasseri strain was inoculated into MRS medium, and when growth reached an optical density at 600 nm (OD600) of ∼0.5, 100 ng ml−1 sakacin was added for overnight induction. Serial dilutions of induced culture were plated onto MRS agar plates (with 10 μg ml−1 Cm and 100 ng ml−1 sakacin) and anaerobically grown for 48 h. To obtain the replicable plasmid already excised and single crossover integration, individual colonies with the Cm gene and without the repA gene were selected and further confirmed by PCR using seq1-F/INTZ-R and INTZ-F/seq1-R primers (Table 3). The single crossover strain was grown in 3 ml MRS medium without antibiotics, and two subcultures per day were grown for 2 days. Subsequently, bacterial cultures were diluted and plated onto MRS plates without antibiotics for 48 h to obtain single-colony isolates, and then these colonies were replica plated on MRS plates containing 10 μg ml−1 Cm. The non-antibiotic-resistant colonies were checked by using specific primers seq1-F/seq1-R to obtain the N506_0400 gene deletion strain L. gasseri DSM 14869-ΔN506_0400.

For the deletion of N506_1778 and N506_1709 genes from the genome of L. gasseri DSM 14869, the same method for EPS knockout was used. Briefly, about 1.0-kb up- and downstream fragments flanking the 5′ and 3′ ends of the N506_1778 gene and N506_1709 gene were amplified by PCR using the primer pairs 1778upstream-F/R–1778downstream-F/R and 1709upstream-F/R-1709downstream-F/R, respectively. The generated amplicons were joined by overlap extension strategy using the primer pairs 1778upstream-F/downstream-R and 1709 upstream-F/downstream-R (Table 3). The resulting PCR products were digested with SacI and BamHI, ligated into a similarly digested pINTZrec plasmid, and transformed into E. coli VE7108 to obtain the plasmid constructs pINTZrec-N506_1778 and pINTZrec-N506_1709. Plasmids pINTZrec-N506_1778 and pINTZrec-N506_1709 were electrotransformed into DSM 14869, and the transformed strains were induced by sakacin. Single-crossover-integrated colonies were screened by PCR using seq2-F/INTZ-R and INTZ-F/seq2-R primers for N506_1778 and seq3-F/INTZ-R and INTZ-F/seq3-R primers for N506_1709. Finally, double-crossover-integrated strains were checked by using specific primers seq2-F and seq2-R to obtain a N506_1778 gene deletion strain named L. gasseri DSM 14869-ΔN506_1778 or by using specific primers seq3-F and seq3-R to obtain a N506_1709 gene deletion strain named L. gasseri DSM 14869-ΔN506_1709.

Complementation: plasmid construction and transformation.

The plasmid pNZe-Rec was used as the starting material to achieve the plasmid required for the complementation of the gene N506_0400 in strain L. gasseri DSM 14869-ΔN506_0400. The gene N506_0400 does not have its own promoter; it shares the promoter of the EPS operon. Thus, the promoter of the EPS gene cluster was amplified using primers EPS-promoter-F/R (Table 3), and the N506_0400 gene was amplified with primers N506_0400-F/R. The promoter and N506_0400 gene were joined by overlap extension using the primer pair EPS-promoter-F/N506_0400-R and then digested with KpnI and HindIII and ligated into similarly digested pNZe-Rec, resulting in pNZe-N506_0400. Plasmid pNZe-N506_0400 was electroporated into L. gasseri DSM 14869-ΔN506_0400 to yield an Em-sensitive strain, L. gasseri DSM 14869-ΔN506_0400/pNZe-N506_0400.

Plasmid pNZe-N506_0400 was used to complement the gene N506_1778 in strain L. gasseri DSM 14869-ΔN506_1778. The gene N506_1778 and its promoter were amplified by PCRs using the specific primers N506_1778-F/R. The PCR product was digested with KpnI and BamHI and ligated into pNZe-N506_0400 which was digested with KpnI and BglII (BamHI and BglII are isocaudarners), resulting in pNZe-N506_1778. Plasmid pNZe-N506_1778 was electroporated in L. gasseri DSM 14869-ΔN506_1778 to yield an Em-sensitive strain, L. gasseri DSM 14869-ΔN506_1778/pNZe-N506_1778.

Plasmid pNZ8048 was used to complement the gene N506_1709 in strain L. gasseri DSM 14869-ΔN506_1709. The N506_1709 gene was ligated into pNZ8048 in two steps. First, the first part of gene N506_1709 (∼2kb) and its promoter were amplified using primers N506_1709-F1/R1. The PCR product was digested with BglII and KpnI and ligated into similarly digested pNZ8048, generating plasmid pNZ8048-N506_1709-1. Then, the second part of gene N506_1709 (∼2.3 kb) was amplified using primers N506_1709-F2/R2, digested with KpnI and SacI, and ligated into similarly digested pNZ8048-N506_1709-1, resulting in pNZ8048-N506_1709. Plasmid pNZ8048-N506_1709 was electroporated into L. gasseri DSM 14869-ΔN506_1709 to yield a Cm-sensitive strain, L. gasseri DSM 14869-ΔN506_1709/pNZ8048-N506_1709.

Construction of overexpression constructs of N506_1709 in Lactococcus lactis NZ9000.

For heterologous expression of N506_1709 in L. lactis, a nisin-inducible vector pNZ8048 was used. The N506_1709 gene from L. gasseri DSM14869 was amplified using primers N506_1709 Re-F/R (Table 3) and subsequently cloned into the pNZ8048 vector, resulting in plasmid pNZ8048-N506_1709Re. Competent L. lactis NZ9000 cells were electrotransformed with plasmid pNZ8048-N506_1709Re, resulting in the strain L. lactis NZ9000/pNZ8048-N506_1709Re.

RNA extraction and real-time quantitative PCR (qRT-PCR).

Total RNA was extracted from 109 bacteria grown in the logarithmic phase using the RNeasy minikit (Qiagen). Reverse transcription was performed using QuantiTect reverse transcription kit (Qiagen), containing 1 μg of total RNA as the template. qRT-PCR was carried out by using a SYBR green assay kit (Qiagen). Specific primers (Table 3) for N506_1709 and the reference gene 16S rRNA were designed by Primer Premier 5 software. Gene expression was normalized by using the ΔΔCT method (58).

Analysis of autoaggregation.

Autoaggregation analysis was performed as previously reported with some modifications (59). Briefly, bacteria were grown overnight (∼16 h) in MRS. The cultures were centrifuged and washed twice with phosphate-buffered saline (PBS) (pH 7.2) and suspended in PBS to an OD600 of 1.5. After cultures were incubated for 5 h at room temperature, the OD600 of the upper suspension was measured. The autoaggregation percentage was calculated by the expression as follows: autoaggregation (%) = [1 − (OD600 5 h/OD600 0 h)] × 100, where OD600 5 h represents the absorbance at the 5-h time point and OD600 0 h represents the absorbance at 0 h.

Biofilm formation assay.

Biofilm formation was performed as described previously (28, 60) with some modifications. Briefly, the biofilms were grown in MRS medium in 96-well polystyrene microplates at 37°C for 72 h. Then, the wells were washed three times with PBS and stained for 30 min with 0.1% crystal violet. Excess stain was rinsed with water and wells were air-dried (1 h). The dye bound to the adherent cells was extracted with 200 μl 30% glacial acetic acid. The OD570 of 135 μl of each well was measured. The experiments were repeated three times, each with eight replicates. Additionally, a sterile MRS medium was used as negative control.

Transmission electron microscopy.

Cells of L. gasseri DSM 14869, EPS mutant, and complemented strains were grown overnight in MRS, and the presence of the EPS layer on the surface of L. gasseri strains was analyzed by TEM as previously described (61). The relative thickness was expressed as a percentage relative to WT (set at 100%). Thickness was evaluated in 10 cells for each group, and the mean ± SD of thickness per cell was determined.

Assay of adhesion to Caco-2 and HeLa cells.

Caco-2 and HeLa cells were routinely grown in Dulbecco’s modified Eagle’s (DMEM) medium supplemented with 10% fetal bovine serum (FBS), 100 IU ml−1 penicillin G, and 100 μg ml−1 streptomycin. Adhesion assays were performed as previously described with some modifications (22, 32, 62, 63). Briefly, cells were seeded in 24-well plates at a concentration of 105 cells per well and cultured for 72 h until confluence. L. gasseri DSM 14869 was grown for 18 h, washed two times with PBS, and resuspended in antibiotic-free DMEM with a concentration of 107 CFU ml−1. An 0.8-ml volume of bacterial culture was added to the tissue culture wells and incubated for 2 h. The wells were washed 3 times with PBS to remove unadhered bacteria. Following washing, 0.2 ml trypsin-EDTA (Invitrogen) was added to the wells to detach the cells and then 0.6-ml antibiotic-free DMEM medium was added to stop the digestion of trypsin. Serial dilutions were prepared and plated onto MRS agar plates to count the number of adhered bacteria. The adhesion ratio was calculated as percentage of bacteria adhering to Caco-2 or HeLa cells in relation to the total number of bacteria added in the wells. All adhesion experiments were performed in triplicate and repeated three times.

Assay of adhesion to vaginal epithelial cells.

The protocol was approved by the Stockholm ethics committee (Regionala etikprövningsnämnden i Stockholm) (permit number 2018/1090/31). Informed consent was obtained from participants before the start of the study. VECs were collected from 4 healthy volunteer donors by gently scraping the vaginal mucosal surface with a sterile cotton swab and suspended in 10 ml DMEM medium. The cells were washed three times with 10 ml DMEM and centrifuged at 800 × g for 5 min to remove indigenous bacteria. The cells were adjusted to 105 cells ml−1 in DMEM by using a hemocytometer. L. gasseri DSM 14869 harvested from an 18-h culture were washed twice with PBS (pH 7.4) and resuspended in DMEM medium to get a final concentration of 5 × 107 CFU ml−1. In the overexpression adhesion assays, the L. lactis strains were inoculated to OD600 of ∼0.5 and induced with 10 ng ml−1 nisin (50 IU ml−1; Sigma) for 1.5 h. Then the induced cultures were harvested as described above.

Equal volumes (400 μl) of vaginal epithelial cells and Lactobacillus spp. or L. lactis were mixed and incubated at 37°C for 2 h. After incubation, the cells were then washed five times with PBS to remove nonadherent bacteria. Following the last centrifugation, the cell pellet was transferred to microscope slides, dried, fixed with methanol, and stained with 0.1% crystal violet. Three replicates were made for each sample, 100 randomly chosen cells from each replicate were examined using a light microscope under oil immersion, and the results were expressed as number of bacteria per cell. VECs not incubated with lactobacilli or L. lactis were included as negative control.

Statistical analyses.

Data are presented as mean ± SD. Significant differences (P < 0.05) between means were identified by one-way analysis of variance (ANOVA) followed by Duncan’s test procedures using SPSS 20. All experiments were performed in triplicate and repeated three times.

Supplementary Material

Supplemental file 1
AEM.00800-19-s0001.pdf (145.9KB, pdf)

ACKNOWLEDGMENTS

We thank Kjell Hultenby from the electron microscopy unit (Emil), Karolinska University Hospital Huddinge, Sweden, for the electron microscopy pictures. E. coli VE7108 strain was a gift from D. Mora (University of Milan, Milan, Italy).

Z.Z. thanks the China Scholarship Council for support (number 201606350096). This work was supported by the Swedish Research Council (Vetenskapsrådet) (U-Forsk grant 348-2013-6609), and the Stiftelsen Läkare mot AIDS Forskningsfond (Fob2016-0008 to F.Z.).

The authors declare the following competing financial interest: a provisional patent application covering some parts of the information contained in this article has been filed. H.M. is a member of the scientific advisory board of Bifodan A/S in Denmark that developed the EcoVag capsules. However, the company was not involved in the funding, study design, data interpretation, or content of the article.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.00800-19.

REFERENCES

  • 1.Pendharkar S, Magopane T, Larsson PG, de Bruyn G, Gray GE, Hammarstrom L, Marcotte H. 2013. Identification and characterisation of vaginal lactobacilli from South African women. BMC Infect Dis 13:43. doi: 10.1186/1471-2334-13-43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ravel J, Gajer P, Abdo Z, Schneider GM, Koenig SS, McCulle SL, Karlebach S, Gorle R, Russell J, Tacket CO, Brotman RM, Davis CC, Ault K, Peralta L, Forney LJ. 2011. Vaginal microbiome of reproductive-age women. Proc Natl Acad Sci U S A 108:4680–4687. doi: 10.1073/pnas.1002611107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Vasquez A, Jakobsson T, Ahrne S, Forsum U, Molin G. 2002. Vaginal Lactobacillus flora of healthy Swedish women. J Clin Microbiol 40:2746–2749. doi: 10.1128/jcm.40.8.2746-2749.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Rönnqvist PDJ, Forsgren-Brusk UB, Grahn-Håkansson EE. 2006. Lactobacilli in the female genital tract in relation to other genital microbes and vaginal pH. Acta Obstet Gynecol Scand 85:726–735. doi: 10.1080/00016340600578357. [DOI] [PubMed] [Google Scholar]
  • 5.Danielsson D, Teigen PK, Moi H. 2011. The genital econiche: focus on microbiota and bacterial vaginosis. Ann N Y Acad Sci 1230:48–58. doi: 10.1111/j.1749-6632.2011.06041.x. [DOI] [PubMed] [Google Scholar]
  • 6.Bolton M, van der Straten A, Cohen CR. 2008. Probiotics: potential to prevent HIV and sexually transmitted infections in women. Sex Transm Dis 35:214–225. doi: 10.1097/OLQ.0b013e31815b017a. [DOI] [PubMed] [Google Scholar]
  • 7.Reid G, Dols J, Miller W. 2009. Targeting the vaginal microbiota with probiotics as a means to counteract infections. Curr Opin Clin Nutr Metab Care 12:583–587. doi: 10.1097/MCO.0b013e328331b611. [DOI] [PubMed] [Google Scholar]
  • 8.Marcotte H, Andersen KK, Lin Y, Zuo FL, Zeng Z, Larsson PG, Brandsborg E, Brønstad G, Hammarström L. 2017. Characterization and complete genome sequences of L. rhamnosus DSM 14870 and L. gasseri DSM 14869 contained in the EcoVag probiotic vaginal capsules. Microbiol Res 205:88–98. doi: 10.1016/j.micres.2017.08.003. [DOI] [PubMed] [Google Scholar]
  • 9.Larsson PG, Stray-Pedersen B, Ryttig KR, Larsen S. 2008. Human lactobacilli as supplementation of clindamycin to patients with bacterial vaginosis reduce the recurrence rate; a 6-month, double-blind, randomized, placebo-controlled study. BMC Womens Health 8:3. doi: 10.1186/1472-6874-8-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Larsson PG, Brandsborg E, Forsum U, Pendharkar S, Andersen KK, Nasic S, Hammarstrom L, Marcotte H. 2011. Extended antimicrobial treatment of bacterial vaginosis combined with human lactobacilli to find the best treatment and minimize the risk of relapses. BMC Infect Dis 11:223. doi: 10.1186/1471-2334-11-223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Pendharkar S, Brandsborg E, Hammarstrom L, Marcotte H, Larsson PG. 2015. Vaginal colonization by probiotic lactobacilli and clinical outcome in women conventionally treated for bacterial vaginosis and yeast infection. BMC Infect Dis 15:255. doi: 10.1186/s12879-015-0971-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lebeer S, Vanderleyden J, De Keersmaecker S. 2008. Genes and molecules of lactobacilli supporting probiotic action. Microbiol Mol Biol Rev 72:728–764. doi: 10.1128/MMBR.00017-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lebeer S, Vanderleyden J, De Keersmaecker S. 2010. Host interactions of probiotic bacterial surface molecules: comparison with commensals and pathogens. Nat Rev Microbiol 8:171–184. doi: 10.1038/nrmicro2297. [DOI] [PubMed] [Google Scholar]
  • 14.Juge N. 2012. Microbial adhesins to gastrointestinal mucus. Trends Microbiol 20:30–39. doi: 10.1016/j.tim.2011.10.001. [DOI] [PubMed] [Google Scholar]
  • 15.Ruas-Madiedo P, Hugenholtz J, Zoon P. 2002. An overview of the functionality of exopolysaccharides produced by lactic acid bacteria. Int Dairy J 12:163–171. doi: 10.1016/S0958-6946(01)00160-1. [DOI] [Google Scholar]
  • 16.Lebeer S, Verhoeven TLA, Francius G, Schoofs G, Lambrichts I, Dufrene Y, Vanderleyden J, De Keersmaecker S. 2009. Identification of a gene cluster for the biosynthesis of a long, galactose-rich exopolysaccharide in Lactobacillus rhamnosus GG and functional analysis of the priming glycosyltransferase. Appl Environ Microbiol 75:3554–3563. doi: 10.1128/AEM.02919-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dertli E, Mayer MJ, Narbad A. 2015. Impact of the exopolysaccharide layer on biofilms, adhesion and resistance to stress in Lactobacillus johnsonii FI9785. BMC Microbiol 15:8. doi: 10.1186/s12866-015-0347-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lee I-C, Caggianiello G, van Swam II, Taverne N, Meijerink M, Bron PA, Spano G, Kleerebezem M. 2016. Strain-specific features of extracellular polysaccharides and their impact on Lactobacillus plantarum-host interactions. Appl Environ Microbiol 82:3959–3970. doi: 10.1128/AEM.00306-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Živković M, Miljković MS, Ruas-Madiedo P, Markelić MB, Veljović K, Tolinački M, Soković S, Korać A, Golić N. 2016. EPS-SJ exopolisaccharide produced by the strain Lactobacillus paracasei subsp. paracasei BGSJ2-8 is involved in adhesion to epithelial intestinal cells and decrease on E. coli association to Caco-2 cells. Front Microbiol 7:286. doi: 10.3389/fmicb.2016.00286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Boekhorst J, De Been M, Kleerebezem M, Siezen RJ. 2005. Genome-wide detection and analysis of cell wall-bound proteins with LPxTG-like sorting motifs. J Bacteriol 187:4928–4934. doi: 10.1128/JB.187.14.4928-4934.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bae T, Schneewind O. 2003. The YSIRK-G/S motif of staphylococcal protein A and its role in efficiency of signal peptide processing. J Bacteriol 185:2910–2919. doi: 10.1128/jb.185.9.2910-2919.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jensen H, Roos S, Jonsson H, Rud I, Grimmer S, Van Pijkeren JP, Britton RA, Axelsson L. 2014. Role of Lactobacillus reuteri cell and mucus-binding protein A (CmbA) in adhesion to intestinal epithelial cells and mucus in vitro. Microbiology 160:671–681. doi: 10.1099/mic.0.073551-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Marraffini LA, Dedent AC, Schneewind O. 2006. Sortases and the art of anchoring proteins to the envelopes of gram-positive bacteria. Microbiol Mol Biol Rev 70:192–221. doi: 10.1128/MMBR.70.1.192-221.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kankainen M, Paulin L, Tynkkynen S, von Ossowski I, Reunanen J, Partanen P, Satokari R, Vesterlund S, Hendrickx APA, Lebeer S, De Keersmaecker SCJ, Vanderleyden J, Hamalainen T, Laukkanen S, Salovuori N, Ritari J, Alatalo E, Korpela R, Mattila-Sandholm T, Lassig A, Hatakka K, Kinnunen KT, Karjalainen H, Saxelin M, Laakso K, Surakka A, Palva A, Salusjarvi T, Auvinen P, de Vos WM. 2009. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a human-mucus binding protein. Proc Natl Acad Sci U S A 106:17193–17198. doi: 10.1073/pnas.0908876106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Edelman SM, Lehti TA, Kainulainen V, Antikainen J, Kylvä Jä R, Baumann M, Westerlund-Wikström B, Korhonen TK. 2012. Identification of a high-molecular-mass Lactobacillus epithelium adhesin (LEA) of Lactobacillus crispatus ST1 that binds to stratified squamous epithelium. Microbiology 158:1713–1722. doi: 10.1099/mic.0.057216-0. [DOI] [PubMed] [Google Scholar]
  • 26.Malik S, Petrova MI, Imholz NCE, Verhoeven TLA, Noppen S, Van Damme EJM, Liekens S, Balzarini J, Schols D, Vanderleyden J, Lebeer S. 2016. High mannose-specific lectin Msl mediates key interactions of the vaginal Lactobacillus plantarum isolate CMPG5300. Sci Rep 6:37339. doi: 10.1038/srep37339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Douillard FP, Ribbera A, Kant R, Pietila TE, Jarvinen HM, Messing M, Randazzo CL, Paulin L, Laine P, Ritari J, Caggia C, Lahteinen T, Brouns SJ, Satokari R, von Ossowski I, Reunanen J, Palva A, de Vos WM. 2013. Comparative genomic and functional analysis of 100 Lactobacillus rhamnosus strains and their comparison with strain GG. PLoS Genet 9:e1003683. doi: 10.1371/journal.pgen.1003683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lebeer S, Claes I, Tytgat HL, Verhoeven TL, Marien E, von Ossowski I, Reunanen J, Palva A, Vos WM, Keersmaecker SC, Vanderleyden J. 2012. Functional analysis of Lactobacillus rhamnosus GG pili in relation to adhesion and immunomodulatory interactions with intestinal epithelial cells. Appl Environ Microbiol 78:185–193. doi: 10.1128/AEM.06192-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Velez MP, Petrova MI, Lebeer S, Verhoeven TL, Claes I, Lambrichts I, Tynkkynen S, Vanderleyden J, De Keersmaecker SC. 2010. Characterization of MabA, a modulator of Lactobacillus rhamnosus GG adhesion and biofilm formation. FEMS Immunol Med Microbiol 59:386–398. doi: 10.1111/j.1574-695X.2010.00680.x. [DOI] [PubMed] [Google Scholar]
  • 30.von Ossowski I, Satokari R, Reunanen J, Lebeer S, De Keersmaecker SC, Vanderleyden J, de Vos WM, Palva A. 2011. Functional characterization of a mucus-specific LPXTG surface adhesin from probiotic Lactobacillus rhamnosus GG. Appl Environ Microbiol 77:4465–4472. doi: 10.1128/AEM.02497-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Azcarate-Peril MA, Altermann E, Goh YJ, Tallon R, Sanozky-Dawes RB, Pfeiler EA, O'Flaherty S, Buck BL, Dobson A, Duong T, Miller MJ, Barrangou R, Klaenhammer TR. 2008. Analysis of the genome sequence of Lactobacillus gasseri ATCC 33323 reveals the molecular basis of an autochthonous intestinal organism. Appl Environ Microbiol 74:4610–4625. doi: 10.1128/AEM.00054-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Horn N, Wegmann U, Dertli E, Mulholland F, Collins SRA, Waldron KW, Bongaerts RJ, Mayer MJ, Narbad A. 2013. Spontaneous mutation reveals influence of exopolysaccharide on Lactobacillus johnsonii surface characteristics. PLoS One 8:e59957. doi: 10.1371/journal.pone.0059957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Etzold S, Kober OI, Mackenzie DA, Tailford LE, Gunning AP, Walshaw J, Hemmings AM, Juge N. 2014. Structural basis for adaptation of lactobacilli to gastrointestinal mucus. Environ Microbiol 16:888–903. doi: 10.1111/1462-2920.12377. [DOI] [PubMed] [Google Scholar]
  • 34.MacKenzie DA, Tailford LE, Hemmings AM, Juge N. 2009. Crystal structure of a mucus-binding protein repeat reveals an unexpected functional immunoglobulin binding activity. J Biol Chem 284:32444–32453. doi: 10.1074/jbc.M109.040907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Call EK, Klaenhammer TR. 2013. Relevance and application of sortase and sortase-dependent proteins in lactic acid bacteria. Front Microbiol 4:73. doi: 10.3389/fmicb.2013.00073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Stâlhammar-Carlemalm M, Areschoug T, Larsson C, Lindahl G. 1999. The R28 protein of Streptococcus pyogenes is related to several group B streptococcal surface proteins confers protective immunity and promotes binding to human epithelial cells. Mol Microbiol 33:208–219. doi: 10.1046/j.1365-2958.1999.01470.x. [DOI] [PubMed] [Google Scholar]
  • 37.Parolin C, Marangoni A, Laghi L, Foschi C, Ñahui Palomino RA, Calonghi N, Cevenini R, Vitali B. 2015. Isolation of vaginal lactobacilli and characterization of anti-Candida activity. PLoS One 10:e0131220. doi: 10.1371/journal.pone.0131220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jolly L, Stingele F. 2001. Molecular organization and functionality of exopolysaccharide gene clusters in lactic acid bacteria. Int Dairy J 11:733–745. doi: 10.1016/S0958-6946(01)00117-0. [DOI] [Google Scholar]
  • 39.Dertli E, Colquhoun IJ, Gunning AP, Bongaerts RJ, Le Gall G, Bonev BB, Mayer MJ, Narbad A. 2013. Structure and biosynthesis of two exopolysaccharides produced by Lactobacillus johnsonii FI9785. J Biol Chem 288:31938–31951. doi: 10.1074/jbc.M113.507418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Song X, Xiong ZQ, Kong LH, Wang GQ, Ai LZ. 2018. Relationship between putative eps genes and production of exopolysaccharide in Lactobacillus casei LC2W. Front Microbiol 9:1882. doi: 10.3389/fmicb.2018.01882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Polak-Berecka M, Waśko A, Paduch R, Skrzypek T, Sroka-Bartnicka A. 2014. The effect of cell surface components on adhesion ability of Lactobacillus rhamnosus. Antonie Van Leeuwenhoek 106:751–762. doi: 10.1007/s10482-014-0245-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rojas M, Ascencio F, Conway PL. 2002. Purification and characterization of a surface protein from Lactobacillus fermentum 104R that binds to porcine small intestinal mucus and gastric mucin. Appl Environ Microbiol 68:2330–2336. doi: 10.1128/aem.68.5.2330-2336.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Walter J, Chagnaud P, Tannock GW, Loach DM, Dal Bello F, Jenkinson HF, Hammes WP, Hertel C. 2005. A high-molecular-mass surface protein (Lsp) and methionine sulfoxide reductase B (MsrB) contribute to the ecological performance of Lactobacillus reuteri in the murine gut. Appl Environ Microbiol 71:979–986. doi: 10.1128/AEM.71.2.979-986.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Buck BL, Altermann E, Svingerud T, Klaenhammer TR. 2005. Functional analysis of putative adhesion factors in Lactobacillus acidophilus NCFM. Appl Environ Microbiol 71:8344–8351. doi: 10.1128/AEM.71.12.8344-8351.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Michel JL, Madoff LC, Olson K, Kling DE, Kasper DL, Ausubel FM. 1992. Large, identical, tandem repeating units in the C protein alpha antigen gene, bca, of group B streptococci. Proc Natl Acad Sci U S A 89:10060–10064. doi: 10.1073/pnas.89.21.10060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wästfelt M, Stâlhammar-Carlemalm M, Delisse A-M, Cabezon T, Lindahl G. 1996. Identification of a family of streptococcal surface proteins with extremely repetitive structure. J Biol Chem 271:18892–18897. doi: 10.1074/jbc.271.31.18892. [DOI] [PubMed] [Google Scholar]
  • 47.Turner MS, Hafner LM, Walsh T, Giffard PM. 2003. Peptide surface display and secretion using two LPXTG-containing surface proteins from Lactobacillus fermentum BR11. Appl Environ Microbiol 69:5855–5863. doi: 10.1128/aem.69.10.5855-5863.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Pan C, Kumar C, Bohl S, Klingmueller U, Mann M. 2009. Comparative proteomic phenotyping of cell lines and primary cells to assess preservation of cell type-specific functions. Mol Cell Proteomics 8:443–450. doi: 10.1074/mcp.M800258-MCP200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zárate G, Nader-Macias ME. 2006. Influence of probiotic vaginal lactobacilli on in vitro adhesion of urogenital pathogens to vaginal epithelial cells. Lett Appl Microbiol 43:174–180. doi: 10.1111/j.1472-765X.2006.01934.x. [DOI] [PubMed] [Google Scholar]
  • 50.Lee Y. 2005. Characterization of Weissella kimchii PL9023 as a potential probiotic for women. FEMS Microbiol Lett 250:157–162. doi: 10.1016/j.femsle.2005.07.009. [DOI] [PubMed] [Google Scholar]
  • 51.Younes JA, van der Mei HC, van den Heuvel E, Busscher HJ, Reid G. 2012. Adhesion forces and coaggregation between vaginal staphylococci and lactobacilli. PLoS One 7:e36917. doi: 10.1371/journal.pone.0036917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jones SE, Versalovic J. 2009. Probiotic Lactobacillus reuteri biofilms produce antimicrobial and anti-inflammatory factors. BMC Microbiol 9:35. doi: 10.1186/1471-2180-9-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Malik S, Petrova MI, Claes IJJ, Verhoeven TLA, Busschaert P, Vaneechoutte M, Lievens B, Lambrichts I, Siezen RJ, Balzarini J, Vanderleyden J, Lebeer S. 2013. The high autoaggregative and adhesive phenotype of the vaginal Lactobacillus plantarum strain CMPG5300 is sortase dependent. Appl Environ Microbiol 79:4576–4585. doi: 10.1128/AEM.00926-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mora D, Maguin E, Masiero M, Parini C, Ricci G, Manachini PL, Daffonchio D. 2004. Characterization of urease genes cluster of Streptococcus thermophilus. J Appl Microbiol 96:209–219. doi: 10.1046/j.1365-2672.2003.02148.x. [DOI] [PubMed] [Google Scholar]
  • 55.Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 56.De Keersmaecker SCJ, Braeken K, Verhoeven TLA, VéLez MP, Lebeer S, Vanderleyden J, Hols P. 2006. Flow cytometric testing of green fluorescent protein-tagged Lactobacillus rhamnosus GG for response to defensins. Appl Environ Microbiol 72:4923–4930. doi: 10.1128/AEM.02605-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zuo FL, Zeng Z, Hammarström L, Marcotte H. 2019. Inducible plasmid self-destruction (IPSD) assisted genome engineering in lactobacilli and bifidobacteria. ACS Synth Biol doi: 10.1021/acssynbio.9b00114. [DOI] [PubMed] [Google Scholar]
  • 58.Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  • 59.Leccese Terraf MC, Mendoza LM, Juárez Tomás MS, Silva C, Nader-Macías MEF. 2014. Phenotypic surface properties (aggregation, adhesion and biofilm formation) and presence of related genes in beneficial vaginal lactobacilli. J Appl Microbiol 117:1761–1772. doi: 10.1111/jam.12642. [DOI] [PubMed] [Google Scholar]
  • 60.Lebeer S, Verhoeven TLA, VéLez MP, Vanderleyden J, De Keersmaecker S. 2007. Impact of environmental and genetic factors on biofilm formation by the probiotic strain Lactobacillus rhamnosus GG. Appl Eviron Microbiol 73:6768–6775. doi: 10.1128/AEM.01393-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Alvarez B, Krogh-Andersen K, Tellgren-Roth C, Martinez N, Gunaydin G, Lin Y, Martin MC, Alvarez MA, Hammarstrom L, Marcotte H. 2015. An EPS-deficient mutant of Lactobacillus rhamnosus GG efficiently displays a protective llama antibody fragment against rotavirus on its surface. Appl Environ Microbiol 81:5784–5793. doi: 10.1128/AEM.00945-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Tuo YF, Yu HL, Ai LZ, Wu ZJ, Guo BH, Chen W. 2013. Aggregation and adhesion properties of 22 Lactobacillus strains. J Dairy Sci 96:4252–4257. doi: 10.3168/jds.2013-6547. [DOI] [PubMed] [Google Scholar]
  • 63.Son SH, Jeon HL, Yang SJ, Lee NK, Paik HD. 2017. In vitro characterization of Lactobacillus brevis KU15006, an isolate from kimchi, reveals anti-adhesion activity against foodborne pathogens and antidiabetic properties. Microb Pathog 112:135–141. doi: 10.1016/j.micpath.2017.09.053. [DOI] [PubMed] [Google Scholar]
  • 64.Kuipers OP, de Ruyter PG, Kleerebezem M, de Vos WM. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64:15–21. doi: 10.1016/S0168-1656(98)00100-X. [DOI] [Google Scholar]
  • 65.de Ruyter PG, Kuipers OP, de Vos WM. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl Environ Microbiol 62:3662–3667. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AEM.00800-19-s0001.pdf (145.9KB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES