Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2019 Aug 6;8(5):754–766. doi: 10.1039/c9tx00101h

High-throughput transcriptome sequencing reveals extremely high doses of ionizing radiation-response genes in Caenorhabditis elegans

Youqin Xu a,b,, Lina Chen c,, Mengyi Liu a, Yanfang Lu a, Yanwei Yue d, Yue Liu a, Honghao Chen a, Fuliang Xie a,e, Chao Zhang a,b,
PMCID: PMC6762013  PMID: 31588352

graphic file with name c9tx00101h-ga.jpgThis study sought novel ionizing radiation-response (IR-response) genes in Caenorhabditis elegans (C. elegans).

Abstract

This study sought novel ionizing radiation-response (IR-response) genes in Caenorhabditis elegans (C. elegans). C. elegans was divided into three groups and exposed to different high doses of IR: 0 gray (Gy), 200 Gy, and 400 Gy. Total RNA was extracted from each group and sequenced. When the transcriptomes were compared among these groups, many genes were shown to be differentially expressed, and these genes were significantly enriched in IR-related biological processes and pathways, including gene ontology (GO) terms related to cellular behaviours, cellular growth and purine metabolism and kyoto encyclopedia of genes and genomes (KEGG) pathways related to ATP binding, GTPase regulator activity, and RNA degradation. Quantitative reverse-transcription PCR (qRT-PCR) confirmed that these genes displayed differential expression across the treatments. Further gene network analysis showed a cluster of novel gene families, such as the guanylate cyclase (GCY), Sm-like protein (LSM), diacylglycerol kinase (DGK), skp1-related protein (SKR), and glutathione S-transferase (GST) gene families which were upregulated. Thus, these genes likely play important roles in IR response. Meanwhile, some important genes that are well known to be involved in key signalling pathways, such as phosphoinositide-specific phospholipase C-3 (PLC-3), phosphatidylinositol 3-kinase age-1 (AGE-1), Raf homolog serine/threonine-protein kinase (LIN-45) and protein cbp-1 (CBP-1), also showed differential expression during IR response, suggesting that IR response might perturb these key signalling pathways. Our study revealed a series of novel IR-response genes in Caenorhabditis elegans that might act as regulators of IR response and represent promising markers of IR exposure.

Introduction

Radiation is the emission or transmission of wave energy or particles, which includes electromagnetic radiation, particle radiation, acoustic radiation and gravitational radiation.1 With the rapid development of energy resource applications, radiation has become widely used in national defence, medicine, industry, agriculture, and archaeology. Currently, radiotherapy is one of the main treatments for cancer. Ionizing radiation (IR) injures tumour tissue and can induce cell death.2 However, during the process of radiotherapy, IR also injures healthy tissues, a side-effect that significantly influences cancer patients’ postoperative recovery and living situations.3,4

Radiation exposure causes two types of injury: acute injury (instant effect) and chronic injury (delayed response). It can cause a series of abnormal responses or damages, the intensity of which depends on the exposure dose, duration and exposure rate. For instance, acute radiation syndrome appears as multiple organ injury, including the bone marrow, gastrointestinal tract, lungs, cardiovascular system and brain.5 High-dose radiation is associated with increased DNA lesion complexity, which can lead to genotoxic stress responses including DNA damage sensing and altered repair mechanisms, as well as immunological alterations.6 Large amounts of reactive oxygen species (ROS) can be induced due to redox-sensitive signalling pathway activation, resulting in a strong and irreversible cytotoxic effect that leads to cell death and unusual cell division followed by organ damage, dysfunction, or even cancer. Aside from DNA damage, IR also causes a spectrum of other lesions in cellular macromolecules (e.g., lipid peroxidation) due to the ROS created by the ionization of water and iron-related Fenton reactions within the cell. Although these non-DNA lesions are probably not life-threatening to the cell, they can stimulate various signal transduction pathways protein kinase C (PKC), stress-activated protein kinase jnk (JNK), ceramide, and mitogen-activated kinase-like protein (MAPK) activation after certain doses of IR. Thus, IR causes a spectrum of DNA and non-DNA lesions, which represent potential signals that activate sensory proteins. These sensory proteins then indicate that damage has occurred in the cell, as well as to regulate processes that both halt cell cycle progression and stimulate the repair of DNA lesions.

Given its easy genetic manipulation, simplicity and reliable culture, C. elegans has become a classical model that is widely used in studies of various biological behaviours. Thus, it is convenient to use C. elegans as a model organism for radiation research. Many genes/miRNAs have been identified as differentially expressed in response to radiation by traditional molecular biological techniques, such as real-time PCR and enzyme-linked immunosorbent assays. For example, several IR-response genes, including ssDNA endodeoxyribonuclease RAD1 (RAD-1) and ssDNA endodeoxyribonuclease RAD2 (RAD-2), have been shown to play key roles in DNA damage response and cell survival signalling.7,8 RAD-1 encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9–1–1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9–1–1 complex is recruited by RAD17 checkpoint clamp loader component (RAD-17) to affected sites, where it may attract specialized DNA polymerases and other DNA repair effectors. Transcript variants of this gene arising from alternative splicing have been described.9 RAD-2, also called mitogen-activated protein kinase SMK1 (SMK-1), is an essential regulator of Forkhead box protein O (DAF-16)-mediated longevity, modulating DAF-16 transcriptional specificity without affecting other processes regulated by insulin/insulin-like growth factor 1 (IGF-1) signalling.10 However, previous studies have mainly focused on individual genes, and the molecular regulatory networks among them remain unclear. Recent analyses in C. elegans have identified a conserved checkpoint pathway that transduces the DNA damage signal caused by IR to the cell cycle and the apoptotic machinery. This pathway comprises the 9–1–1 complex human HUS1 checkpoint clamp component related (HUS-1)/cell cycle checkpoint protein RAD1 homolog mrt-2 (MRT-2)/cell cycle checkpoint protein hpr-9 (HPR-9) and a novel checkpoint protein, telomere length regulation protein (CLK-2), acting in parallel. The transcription factor cep-1 (CEP-1)/p53 tumour suppressor protein acting in parallel. The transcription factor cep-1 (CEP-1)/p53 tumour suppressor protein is required for IR-induced apoptosis (but not for cell cycle arrest). Activation of CEP-1/p53 leads to transcriptional upregulation of the B cell leukaemia/lymphoma 2 homology domain only proteins (BH3-only) target genes, programmed cell death activator (RGL-1) and hypothetical protein (CED-13), which in turn activate the C. elegans apoptotic machinery.

Recent high-throughput transcriptome sequencing has been widely used to study the whole transcriptome in one sequencing reaction, which can provide insight into the dynamic expression of the differentially regulated gene repertoire and subsequently contribute to illuminating their mechanisms of action and responses to radiation. Since the landmark discovery in C. elegans of the first miRNAs,11,12 numerous non-coding RNAs of different sizes have been characterized in various organisms and shown to be involved in diverse biological processes.13 The functions of small RNAs (<200 nt), particularly miRNAs and other RNAs ranging in size between 15 and 40 nt, have been intensively investigated. A series of miRNAs have been reported to target key genes in the DNA damage response and are themselves regulated both transcriptionally and post-transcriptionally.14,15 However, large-scale high-throughput transcriptome analyses have shown that a substantial fraction of the transcriptome consists of longer ncRNAs (>200 nt). Some of these long transcripts have been defined as functional RNAs.16

In this study, we performed RNA transcriptome sequencing analysis on C. elegans that were exposed to different high doses of IR.

Materials and methods

Culture and amplification of C. elegans

C. elegans were provided by South China Agricultural University, Guangzhou, Guangdong, China. NGM medium containing 0.3% NaCl, 0.25% peptone, 1.7% agar and 1 M KH2PO4–K2HPO4 solution buffer was used to culture C. elegans according to the standard protocol.8

Exposure of C. elegans to IR

Approximately 1000 age-synchronized young adult hermaphrodites (24 h post the L4 larval stage) were irradiated with 0 Gy, 200 Gy and 400 Gy of X-rays using a 600C/D linear accelerator (Varian, USA). Total RNA was extracted immediately using TRIzol (Invitrogen) according to the manufacturer's protocol.

RNA transcriptome sequencing analysis

The RNA transcriptome sequencing analysis was performed by RiboBio Biotechnology Corporation (Shanghai, China) using HiSeq technology. To assess molecular signalling pathway changes after IR treatment in C. elegans, the data were divided into three comparisons, containing 0 Gy versus 200 Gy (comparison A), 0 Gy versus 400 Gy (comparison B), 200 Gy versus 400 Gy (comparison C), the RNA-seq and alignment results shown in ESI Table 1. Data analysed by canonical KEGG pathways, GO, and differential gene expression; these analyses were performed by Cloud Exploring Biotechnology (Guangzhou, China).

DESeq

DESeq is a R language pack, which is used to identify differentially expressed genes in the RNA sequencing data. The calculation method is based on negative binomial distribution, which relies on the mean and variance of gene expression as a parameter to analyze the differentially expressed genes. To control type-I error, the proportion of P values below a threshold α has to be ≤α, that is, the ECDF curve (blue line) should not get above the diagonal (gray line). Using the variance-mean dependence w(q) estimated by DESeq, a VST is given by Inline graphic.

Data analysis method

Firstly we filtered the data to joint series and to deal with low quality reads, then to evaluate quality of sequencing so that achieving quality data with Illumina HiSeq 2500 (Caenorhabditis elegans). FANse2 software was used to match each mRNA count, edgeR was applied to compared differently expressed genes between two groups. Heatmap was carried out by MeV and R language. Compared the reference genome and the clean data to get the BAM files. Further analysis and calculation of gene expression differentially expressed genes between samples and the genes differentially expressed gene ontology analysis, KEGG pathway enrichment analysis.

Static methods

Using Tophat2 software to compare the sequencing data and reference genome, coverage area and cover depth of sequencing data. To make comprehensive evaluation. Set the default parameters for “read – mismatches = 2 (allowing two mismatches)”, “read – gap – length = 2 (allowing two gap)”.

GO and KEGG analysis

Differential gene lists from different comparisons were examined using Gene Ontology term enrichment by GOrilla (http://cbl-gorilla.cs.technion.ac.il/) with the default parameters. Fisher's exact test was also applied to these differentially expressed gene lists to detect gene sets that significantly overlapped with the KEGG pathway gene sets.

Quantitative reverse-transcription PCR (qRT-PCR)

Target genes that significantly changed during treatment were used for qRT-PCR experiments as described previously.7 Total RNA was used to synthesize cDNA with the PrimeScript™ 1st strand cDNA synthesis kit (TaKaRa Bio, Japan). Primers for each gene are listed in Table 1. The single-stranded cDNA was amplified by comparative qRT-PCR using SYBR Premix Ex Taq (TaKaRa Bio, Japan) on a Roche LightCycler 480. The PCR cycles were as follows: 95 °C for 30 seconds; 40 cycles of 95 °C for 5 seconds; 40 cycles of 60 °C for 20 seconds and finally 65 °C for 15 seconds. Relative gene expression levels were calculated using the 2–ΔΔCt method. The ΔCt value of each sample was calculated using cell division cycle 42 (CDC42) as an endogenous control gene. A Student's t-test was performed to statistically compare the gene expression of qRT-PCR.

Table 1. Primers for each gene used for qRT-PCR.

Accession Symbol Size (bp) Forward_seq (5′ to 3′) Reverse_seq (5′ to 3′)
NM_063197.7 cdc-42 124 CGACAATTACGCCGTCACAG AAACACGTCGGTCTGTGGAT
NM_066115.5 let-711 116 AACGGACAAGGCTCTGATGG GAGTGATTGCGCCACTTCCT
Gene ID: 174462 let-23 148 TCGTCACTGCTCAGATGGTC TTGTTCGCAGCCTTCCAAGT
NM_058482.3 lsm-6 107 GTCGACTACCGTGGCATTCT GCATCGCCGTACTTGTTCTG
NM_069633.4 lsm-7 122 AGGAGGACGTGAAGCAAGTG TTGTCTCATCACCGACGACC
Gene ID: 178303 lsm-3 107 GCTACAGTCGAAGAGCCACT TCGAAAGCTCTGAGACGACC
Gene ID: 172051 gcy-28 154 GCAACGGGTACGAAAACCAG TTCAGGCCGTTCATGTGGAT
NM_062067.2 gcy-15 130 CCTTGTGTAGCAGGGGTTGT AACTCACAGGTTCTGCCACC
NM_078354.5 gcy-11 112 TCAGTTCCTCCACGAAGGCT CTGCTCCATTCCGTAGTTGC
NM_062594.2 gcy-12 145 CTATCAACGGGTCACTGGCA GCAGCCTCTCCATTGACATCT
NM_061923.1 gcy-21 161 GGCTCAGATCCAAGAGAAGACT GCGGTGGAATAGTCCTCATACA
NM_077496.3 gcy-9 92 TGGATTGGCCCTTCGAGATG GCCGATTCGTCATTCTTGACC
NM_066605.5 gst-1 92 GATCTTCGGCCAGGTTCCAT GCCCATTAAGACGAGCGAGA
NM_001267338.1 gst-5 146 GCCGGACAACAATACGAGGA AAGAAACGAGCAATCGCGTG
NM_062481.7 gst-6 152 AGCTTTGAACAATGGCCAGC GCCTCGGTGTCATTTTGTCC
NM_062501.1 gst-30 136 CAAGGAGATGCCGATGCTCT ACAGATCAACCCAGGTGACAG
NM_077251.4 gst-36 134 CGCTTTGGAATGGAGCAGTG CGGTGGAACTGATGTCCGAG
NM_001029213.2 dgk-1 137 GGAGGACCGTTGGTTGGATT GGGGAAAAGCAAGCAGCATC
NM_069076.2 dgk-4 150 ACCTTGGCTTCAACCTCCTG GTAGGTGTGGATGGTGCTGT
NM_070642.4 skr-9 154 ACGGATGTAAGATTGTTGCCATGA TCCTTGTCGGTGATTGCCT
NM_063804.4 plc-3 119 TCCGAGGAAGCAGATGGTTG TTTGAGAGCTCAGCGGCAAT
NM_070644.5 skr-12 129 TCAAGGGTCTCATGTACTTTGGG TCTGTGCAGTTTCCTCAGCA
NM_064061.4 age-1 141 ATCGACAAAGCCATCGTCCT AAGCATGTCCTGGCGAAGAT
NM_001306915.1 lin-45 107 ATGCTCATCGTTTGCACCAC CTGGGCCTTCGACTTGTGAT
NM_001129239.2 cbp-1 106 CTGGGCTACACAATGGCTCA GACGCTTCGGCTTTGGAATC

Results

RNA sequencing

The total mRNA of each C. elegans sample was completely sequenced using the HiSeq 2500. In total, over 850 million single-end reads were obtained. The mapping rate was approximately 97% (ESI Table 1 and Fig. 1) on average. These results suggested that the sequences and alignments were of good quality (Fig. 1). Sequencing data was submitted to GEO database as GSE 122996, the website is ‘; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE122996’.

Fig. 1. Volcano plots of fold changes and P-values of C. elegans RNA-seq data after treatment with 0 Gy, 200 Gy, and 400 Gy of X-rays. A: 0 Gy vs. 200 Gy; B: 0 Gy vs. 400 Gy; C: 200 Gy vs. 400 Gy.

Fig. 1

Differential gene expression in RNA-seq

Using DESeq-based statistical inference, a total of 3513 genes were found to be differentially expressed in pair-wise comparisons of the three groups, including 424 upregulated and 1037 downregulated genes in the comparison of the 0 Gy group with the 200 Gy group (comparison A); 958 upregulated and 444 downregulated genes in the comparison of the 0 Gy group with the 400 Gy group (comparison B); and 1502 upregulated and 849 downregulated genes in the comparison of the 200 Gy group with the 400 Gy group (comparison C, Table 2). Of these differentially expressed genes, 420 genes were found to be co-upregulated in comparison B and comparison C, whereas 13 genes were co-upregulated between comparison A and comparison B. To our surprise, no co-upregulated genes were found between comparison A and comparison C. Meanwhile, co-downregulated genes were evidently fewer than co-upregulated genes among these comparison combinations. Eighty-eight genes were identified as co-downregulated between comparison B and comparison C, where 82 genes were co-downregulated between comparison A and comparison B. Similarly, there were only 2 co-downregulated genes between comparison A and comparison C (ESI Table 2). There were 109 co-expressed genes among the three comparisons (ESI Table 2). A total of 100 genes were induced by increasing radiation dose, while 9 genes were significantly suppressed.

Table 2. Genes expressed differentially at different radiation doses.

Comparison Differentially expressed genes (n) Upregulated genes (n) Downregulated genes (n)
0 vs. 200 Gy 1461 424 1037
0 vs. 400 Gy 1402 958 444
200 Gy vs. 400 Gy 2351 1502 849
Co-expressed genes 109 54 55

GO-based and KEGG pathway-based enrichments

We performed GO (gene ontology) analysis and KEGG (Kyoto encyclopedia of genes and genomes) pathway enrichment analysis for the differentially expressed genes found with RNA sequencing in the three comparisons. The GO analysis clustered the differentially co-expressed genes into three categories, including biological process, cellular component, and molecular function. Exposure to IR perturbed the expression of genes that significantly overlapped gene sets involving cellular growth, cellular structure, and energy metabolism (Fig. 2). Interestingly, the common changes in molecular function among the three comparisons were concentrated in the fields of ATP binding and GTPase regulator activity. Additionally, the KEGG pathway analysis showed that the IR response in C. elegans significantly activated RNA transport, mRNA surveillance pathway, RNA degradation, RNA polymerase, basal transcription factors, DNA replication, spliceosome, protein export, calcium signalling pathway, cGMP-PKG signalling pathway, cAMP signalling pathway, cytokine–cytokine receptor interaction, chemokine signalling pathway, NF-kappa B signalling pathway, HIF-1 signalling pathway, and FoxO signalling pathway, among others. Moreover, the common differentially expressed genes among the comparisons were enriched in ten important biological processes, as shown in Fig. 3. Although the groups were treated with different X-ray dosages, some of the altered pathways overlapped. As shown in Fig. 4A, when the animals were treated with 200 Gy, the major changes in the pathways focused on metabolism of xenobiotics by cytochrome P450, drug metabolism and glycerophospholipid metabolism. However, in the group treated with 400 Gy, we found that the spliceosome, phosphatidylinositol signalling system, purine metabolism and RNA degradation pathways were changed. Other classical pathways, such as the epidermal growth factor receptor (ErbB) and MAPK signalling pathways, also have key roles in modulating cellular molecular functions (Fig. 4B). Furthermore, in comparison C, several classical pathways, including the TGF-beta and Wnt signalling pathways, were changed according to the analysis results (Fig. 4C). As the exposure doses increased, the induced genes participated in a larger number of important biological processes, as shown in Table 3.

Fig. 2. GO analysis showed dramatic changes in all three comparisons: X-ray 0 Gy vs. X-ray 200 Gy (A), X-ray 0 Gy vs. X-ray 400 Gy (B), X-ray 200 Gy vs. X-ray 400 Gy (C). Red represents biological process in the GO analysis. Black represents cellular component in the GO analysis. Blue represents molecular function in the GO analysis.

Fig. 2

Fig. 3. GO analysis in the biological process category of the co-expressed differential genes among the three comparisons: X-ray 0 Gy vs. X-ray 200 Gy (A), X-ray 0 Gy vs. X-ray 400 Gy (B), X-ray 200 Gy vs. X-ray 400 Gy (C).

Fig. 3

Fig. 4. KEGG pathway analysis showed different molecular pathway changes in the three comparisons. The log10 of the P-value of each comparison is also shown.

Fig. 4

Table 3. A list of gene families significantly changed in the three comparisons.

Comparison Genes Log2 (fold change) (X-ray 200 vs. X-ray 0) P-Value Related KEGG pathways
Comparison A GST-1 1.747 0.001 Metabolism of xenobiotics by cytochrome P450, drug metabolism
GST-5 2.387 <0.001
GST-6 1.567 <0.001
GST-30 1.894 <0.001
GST-36 0.940 0.05
DGK-1 –2.284 <0.001 Glycerophospholipid metabolism
DGK-4 –1.922 0.001
 
Comparison B GCY-9 0.949 0.015 Purine metabolism
GCY-28 1.038 0.005 RNA degradation
LSM-3 –2.263 0.009 RNA degradation
LSM-6 –2.550 0.003
LSM-7 –2.425 0.005
 
Comparison C SKR-9 –1.967 0.003 TGF-beta signalling pathway
SKR-12 –1.402 0.013
GCY-9 3.344 0.009 Wnt signalling pathway, purine metabolism
GCY-15 4.831 0.001
GCY-21 4.365 0.003
GCY-28 2.684 0.002

A cluster of genes in C. elegans performed key roles in modulating the GO and KEGG pathways according to the IR response

As expected, exposure to different doses of IR dramatically changed the expression levels of various genes in C. elegans. Genes with fold change value >2 and corrected P-value (FDR) <0.05 were enrolled for further study. Interestingly, when analysing the expression levels of the common genes among the three comparisons, we found a cluster of gene families, including guanylate cyclase (GCY), Sm-like protein (LSM), diacylglycerol kinase (DGK), skp1-related protein (SKR), and glutathione S-transferase (GST) gene families, that were active in the GO and KEGG pathways. Specifically, several members of the GST family, including GST 1, 5, 6, 30 and 36, were upregulated in comparison A when exposed to the 200 Gy X-ray dose; this gene family mainly modulates the metabolism of both xenobiotics, by cytochrome P450, and drugs. However, the expression levels of DGK family members, including DGK 1 and 4, which may take part in modulating glycerophospholipid metabolism, showed the opposite trend (ESI Table 2). When exposed to 400 Gy of X-rays, C. elegans showed an increased accumulation of the GCY (GCY 9, 28) and LSM (LSM 3, 6, 7) gene families, which control several biological pathways, including purine metabolism and RNA degradation (Table 3). Interestingly, in comparison C, the expression level of the SKR gene family, including SKR 9 and 12, was downregulated; these genes regulate the TGF-beta signalling pathway and the Wnt signalling pathway. Furthermore, the expression of the GCY family members GCY 9, 15, 21 and 28, which are involved in purine metabolism, gradually increased with increasing X-ray dosage (Table 3).

Further genomic analysis showed that many genes, including PLC-3, AGE-1, LIN-45, and CBP-1, act as key genes in regulating several signalling pathways related to IR response (Table 4). For example, phosphoinositide-specific phospholipase C-3 (PLC-3) and phosphatidylinositol 3-kinase age-1 (AGE-1), which were detected in comparison B, govern the phosphatidylinositol signalling system and the ErbB signalling pathway. The Raf homolog serine/threonine-protein kinase (LIN-45) was found to be involved in regulating the phosphatidylinositol signalling system, the ErbB signalling pathway and the MAPK signalling pathway. Notably, the protein cbp-1 (CBP-1), detected in comparison C, significantly increased with increasing X-ray dosage; this protein may affect the TGF-beta and Wnt signalling pathways. The results of qRT-PCR were consistent with the RNA-seq dataset (data shown in Fig. 5, *P < 0.05, **P < 0.01).

Table 4. A cluster of genes correlated to more than 2 key biological pathways.

Genes Log2 (fold change) Related KEGG pathways
PLC-3 0.289 (comparison B) Phosphatidylinositol signalling system
AGE-1 0.252 (comparison B) ErbB signalling pathway
LIN-45 0.599 (comparison B) Phosphatidylinositol signalling system, ErbB signalling pathway
MAPK signalling pathway
CBP-1 3.857 (comparison C) TGF-beta signalling pathway
Wnt signalling pathway

Fig. 5. The relative expression of multiple genes in C. elegans affected by ionizing radiation. A–X indicate gcy-9, gcy-11, gcy-12, gcy-15, gcy-21, gcy-28, lsm-3, lsm-6, lsm-7, let-23, let-711, gst-1, gst-5, gst-6, gst-30, gst-36, dgk-1, dgk-4, skr-9, skr-12, plc-3, age-1, cbp-1, and lin-45, respectively.

Fig. 5

Discussion

DNA repair, which involves signalling checkpoints that detect the DNA damage and apoptosis induced by IR, has been characterized as involving classical activation pathways.8,17 In our study, we employed extremely high doses of IR to show more multi-gene interactions induced by IR. Notably, the vast majority of these genes were not related to the classical pathways mentioned above. We carried out several novel GO and KEGG pathway analyses to explore IR exposure response in C. elegans. We found that a novel cluster of gene families, including the GCY, LSM, DGK, SKR and GST families, appeared to be upregulated, indicating a need for attention to their functions during the IR response. Furthermore, several novel genes, including PLC-3, AGE-1, LIN-45 and CBP-1, were identified as key genes involved in the signalling pathways related to IR response. Cell death and apoptosis are well known to occur in C. elegans when exposed to IR.8 By tracing the progress of cell death and apoptosis, a change in the energy metabolism system could be found.18 Simply put, when exposed to IR, the mitochondria and the dynamic organelles, which supply energy required to drive key cellular processes, are damaged and affect the energy metabolism that produces ATP. In addition, mitochondrial damage activates apoptotic programmes,19,20 and oxidative stress induced by IR can damage the cellular structure, thus accelerating cell death.21 Therefore, the GO analysis data of our study will be helpful for further investigation of the IR response.

When analysing the KEGG pathways enriched in the IR-response genes in C. elegans, we found that the metabolic system was significantly activated at both the genomic and protein levels, including xenobiotic metabolism by cytochrome P450, drug metabolism, purine metabolism, and the RNA metabolic processes of spliceosome and degradation. Interestingly, it has been recognized that the IR response at the cellular level could affect the metabolic changes mentioned above.22 Additionally, classical molecular signalling pathways, such as ErbB and MAPK signalling pathways, were activated in response to the higher dose of IR. These two pathways are widely acknowledged to regulate cell growth and proliferation, and their activation might be regarded as a protective response of cells suffering IR exposure.

The GCY family is a large gene family containing more than 20 members, which have been identified as playing key roles in the production of the second messenger cGMP and the ATP binding process.23,24 Previous studies confirmed that cGMP could be induced immediately after exposure to IR,25,26 which was considered a protective response of cells to external stimuli. In recent studies, we found that two important members of the GCY family, receptor-type guanylate cyclase GCY-12 and GCY-28, gradually increased with increasing X-ray dosage, which may eventually result in the production of cGMP. Genetic analyses have indicated that GCY-12 acts upstream of cGMP-dependent protein kinase (EGL-4) in body size control but does not affect the other functions of EGL-4, which provide cGMP directly to the EGL-4 cGMP-dependent kinase for specific tasks including body size regulation.27 Furthermore, GCY-28 has been implicated as a key regulator of interneuron activity modulation, and a mutation in GCY-28 would cause a sensory integration disorder in C. elegans. GCY-28 is expressed and functions in the interneurons, where it may regulate sensory integration by binding an unknown ligand. Domain-swap experiments also suggest that the guanylyl cyclase of GCY-28 can be activated by endogenous peptides.28 Therefore, the increased level of GCY-28 after IR exposure could change the behavioural choices of C. elegans, as indicated by the results in the biological process category of the GO analysis. GCY-28 has the potential to direct both attraction and repulsion. Attraction, the typical AWC(ON) behaviour, requires GCY-28 as a receptor-like guanylate cyclase that acts in adults and localizes to AWC(ON) axons. GCY-22 involved in the production of the second messenger cGMP (by similarity). Regulates chemotaxis responses toward Li1–, Mg2+, Cl1–, Br1– and I1– salt ions and methionine in ASE right (ASER) sensory neuron. May regulate ASER neuronal activity such as axon sprouting and calcium responses to changes in salt concentrations.

The LSM family has been found to be widely expressed in eukaryotes with a highly homologous sequence. These genes have been described as forming homo- or heterocomplexes that are implicated in a broad range of RNA-related functions, such as RNA degradation and RNA splicing.2931 Eukaryotic LSM proteins are distributed in two distinct LSM complexes: nuclear LSM 2–8 and cytoplasmic LSM 1–7.29 The nuclear complex binds to U6 snRNA in the U6 snRNP and is involved in splicing, whereas the cytoplasmic complex has been described as an activator of the decapping step in the 5′–3′ mRNA decay pathway in P bodies.32,33 The key role of the LSM family in RNA degradation is closely correlated with the IR response in C. elegans. Previous studies have demonstrated that IR can cause breakage of mRNA strands and result in disordered cellular processes.34,35 Our RNA-seq data showed increased expression of LSM 3, 6, and 7 after exposure to IR. Interestingly, the expression levels of LSM 3, 6, and 7 decreased with increasing X-ray irradiation, which indicated that high-dose X-ray irradiation may inhibit LSM transcription.

The GST family has been proven to play an important role in detoxification by using glutathione to catalyse the conjugation of many hydrophobic and electrophilic compounds.36 At present, eight distinct classes of soluble cytoplasmic mammalian GSTs have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. The present study identified several different GST classes among the genes upregulated in C. elegans exposed to 200 Gy of X-rays, most of which have been characterized in xenobiotic and drug metabolism. Consistent with these results, Urlaub et al. also found that IR could cause significant changes in several GSTs at the proteomic level.37 On the other hand, the expression levels of DGKs, including DGK1 and 4, were found to be decreased after 200 Gy IR exposure. The DGK family metabolizes 1,2-diacylglycerol (DAG) to produce phosphatidic acid (PA), which plays a key role in hepatic glycerophospholipid metabolism.38 Thus, these findings indicate that IR could cause liver injury, a result that could be further evaluated in the future.

Genomic analysis also revealed that expression of the SKR family decreased with increasing doses of IR. The SKR family is an indispensable effector of cellular biological processes in C. elegans, which includes cell proliferation, morphogenesis of the posterior body, and central aspects of female meiotic development.39,40 Consistently, the IR response caused cell apoptosis and inhibited cell proliferation. Therefore, our study showed that SKRs may be therapeutic targets for IR treatment. SKR is essential component of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. Regulates cell proliferation during embryonic and larval development. Involved in synapse elimination in early synapse development. May negatively regulate the apoptotic activity of cep-1 in response to genotoxic stress. Plays a role in sex determination the majority of animals are either embryonic or larval lethal. Rare surviving animals develop into uncoordinated sterile adults with hyperplasia of tissues including the uterus and the spermatheca of the somatic gonad. RNAi-mediated knockdown results in a reduction in brood size of the injected parent and embryonic lethality of offspring between gastrulation and the two-cell phase of embryogenesis. RNAi-mediated knockdown within 16 hours of RNAi administration results in defects in embryonic divisions including spindle mispositioning, abnormal polar bodies and ectopic furrows, and hyperplasia of the somatic gonad and hypodermis in larvae. All embryos laid 16 hours post RNAi treatment arrest and contain almost twice the number of cells as wild-type embryos. Zygotic RNAi-mediated knockdown results in 90% sterility.

Furthermore, in addition to the genes previously discussed, a cluster of genes, including PLC-3, AGE-1, LIN-45, and CBP-1, were prominent in the IR-related biological process category. From comparison B, we identified PLC-3 and AGE-1 as key genes in modulating the phosphatidylinositol signalling system and ErbB signalling pathway. Previous studies have shown that PLC-3 plays a role in regulating basal and ovulatory sheath cell contractions by controlling Ca2+ oscillations via IP3-mediated activation of the IP3 receptor itr-1, which serves as an important part of the ErbB signalling pathway.39 RNAi-mediated knockdown of PLC-3 in C. elegans led to sterility due to impaired spermatheca dilatation, causing a defect in ovulation and a severe decrease in sheath cell basal and peak ovulatory contractions.40 Age-1 is a pivotal cytokine that regulates longevity and diapause and is involved in the development of neuroendocrine signalling in the dauer pathway.41,42 The upregulation of PLC-3 and AGE-1 when exposed to 400 Gy irradiation indicated that the IR response in C. elegans could cause a dramatic change in cell survival.

The protein Lin-45 was involved in regulating the ErbB and MAPK signalling pathways in comparison B. Lin-45 was identified as a downstream target of the Ras protein let-60 and is required for larval viability, fertility and the induction of vulval cell fates.43 Subsequent studies of Lin-45 action have demonstrated that it positively regulates lifespan upstream of the dual-specificity mitogen-activated protein kinase kinase (MEK-2) and mitogen-activated protein kinase (MPK-1).44,45 In summary, the upregulation of Lin-45 may act as a protective effector in the IR response.

CBP-1, which was discovered in comparison C, showed a gradually increasing trend with increasing X-ray dosage. CBP-1 is an acetyltransferase that can prevent DNA damage-induced apoptosis by inhibiting cep-1-dependent transcriptional activation of the programmed cell death activator egl-1.46 Other studies have also shown that CBP-1 is a downstream gene in the Ras signalling pathway, which negatively regulates vulval cell fate specification by function in LIN-1, an Ets transcription factor family member that is one of the targets of MAPK.47 Our data showed a correlation among CBP-1, the ErbB signalling pathway and the MAPK signalling pathway, suggesting that CBP-1 might act as a protective effector in the IR response.

Notably, extreme doses of IR did not lead to the death of C. elegans in our study. We speculate that the DNA damage response, a functional network combining DNA repair, cellular senescence, cell cycle regulation and apoptosis, may act to protect organisms against continuous endogenous and environmental stresses. Nucleotide excision repair (NER) is one of the main mechanisms involved in the response to radiation-induced DNA damage. The importance of this repair mechanism is illustrated clinically by three severe NER-defective syndromes: xeroderma pigmentosum (XP), Cockayne syndrome (CS), and trichothiodystrophy (TTD). Sufferers of these three syndromes exhibit hypersensitivity to sunlight and a predisposition to skin cancer, indicating that the molecular response to radiation is critical for protecting organisms.48,49

Conclusion

Taken together, our findings showed that genes from a series of biological processes, such as behaviour, regulation of growth, regulation of locomotion, positive regulation of growth, calcium ion transport and di- and tri-valent inorganic cation transport, are differentially expressed when C. elegans is exposed to IR, which is a new finding for the field of IR response. Furthermore, our research revealed that the biological processes induced by IR response were mainly regulated by the GCY, LSM, DGK, SKR and GST gene families and several novel genes, including PLC-3, AGE-1, LIN-45, and CBP-1, that are involved in key signalling pathways of IR response and deserve additional research. Our study provides new insight into the biological basis of the IR response via RNA-seq and could contribute to a better understanding of the mechanism of the IR response.

Conflicts of interest

There are no conflicts to declare.

Supplementary Material

Acknowledgments

The study was supported by the National Natural Science Foundation of China, grants #81502761 and #81872557; the Natural Science Foundation of Guangdong Province, #2016A030313558, Guangdong Science and Technology Department, #2015A010107005 and the Scientific Research Fund of the Hunan Provincial Education Department, #17C1483.

Footnotes

†Electronic supplementary information (ESI) available. See DOI: 10.1039/c9tx00101h

References

  1. Mackillop W. J., Zhou S., Groome P., Dixon P., Cummings B. J., Hayter C., Paszat L. Int. J. Radiat. Oncol., Biol., Phys. 1999;44:355–362. doi: 10.1016/s0360-3016(99)00010-3. [DOI] [PubMed] [Google Scholar]
  2. Berkey F. J., Am. Fam. Physician, 2010, 824 , 381 –388 , , 394 . [PubMed] [Google Scholar]
  3. Swerdlow A. J., Higgins C. D., Smith P., Cunningham D., Hancock B. W., Horwich A., Hoskin P. J., Lister A., Radford J. A., Rohatiner A. Z., Linch D. C. J. Natl. Cancer Inst. 2007;99:206–214. doi: 10.1093/jnci/djk029. [DOI] [PubMed] [Google Scholar]
  4. Wethal T., Lund M. B., Edvardsen T., Fossa S. D., Pripp A. H., Holte H., Kjekshus J., Fossa A. Br. J. Cancer. 2009;101:575–581. doi: 10.1038/sj.bjc.6605191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Wyrobek A. J., Manohar C. F., Krishnan V. V., Nelson D. O., Furtado M. R., Bhattacharya M. S., Marchetti F., Coleman M. A. Mutat. Res. 2011;722:119–130. doi: 10.1016/j.mrgentox.2011.03.002. [DOI] [PubMed] [Google Scholar]
  6. Beer L., Seemann R., Ristl R., Ellinger A., Kasiri M. M., Mitterbauer A., Zimmermann M., Gabriel C., Gyongyosi M., Klepetko W., Mildner M., Ankersmit H. J. BMC Genomics. 2014;15:814. doi: 10.1186/1471-2164-15-814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kimura T., Takahashi K., Suzuki Y., Konishi Y., Ota Y., Mori C., Ikenaga T., Takanami T., Saito R., Ichiishi E., Awaji S., Watanabe K., Higashitani A. Bioelectromagnetics. 2008;29:605–614. doi: 10.1002/bem.20425. [DOI] [PubMed] [Google Scholar]
  8. Greiss S., Schumacher B., Grandien K., Rothblatt J., Gartner A. BMC Genomics. 2008;9:334. doi: 10.1186/1471-2164-9-334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Stergiou L., Doukoumetzidis K., Sendoel A., Hengartner M. O. Cell Death Differ. 2007;14:1129–1138. doi: 10.1038/sj.cdd.4402115. [DOI] [PubMed] [Google Scholar]
  10. Criswell T., Leskov K., Miyamoto S., Luo G., Boothman D. A. Oncogene. 2003;22:5813–5827. doi: 10.1038/sj.onc.1206680. [DOI] [PubMed] [Google Scholar]
  11. Reinhart B. J., Slack F. J., Basson M., Pasquinelli A. E., Bettinger J. C. Nature. 2000;403:901–906. doi: 10.1038/35002607. [DOI] [PubMed] [Google Scholar]
  12. Vella M. C. and Slack F. J., C. elegans microRNAs. WormBook: the online review of C elegans biology, 2005, pp. 1–9. [PMC free article]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Costa F. F. Gene. 2005;357:83–94. doi: 10.1016/j.gene.2005.06.019. [DOI] [PubMed] [Google Scholar]
  14. Lee H.-C., Chang S.-S., Choudhary S., Aalto A. P., Maiti M. Nature. 2009;459:274–277. doi: 10.1038/nature08041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Wan G., Mathur R., Hu X., Zhang X., Lu X. Trends Biochem. Sci. 2011;36:478–484. doi: 10.1016/j.tibs.2011.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Wilusz J. E., Sunwoo H., Spector D. L. Genes Dev. 2009;23:1494–1504. doi: 10.1101/gad.1800909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Muzio M., Chinnaiyan A. M., Kischkel F. C., O'Rourke K., Shevchenko A., Ni J., Scaffidi C., Bretz J. D., Zhang M., Gentz R., Mann M., Krammer P. H., Peter M. E., Dixit V. M. Cell. 1996;85:817–827. doi: 10.1016/s0092-8674(00)81266-0. [DOI] [PubMed] [Google Scholar]
  18. Nicholson D. W., Ali A., Thornberry N. A., Vaillancourt J. P., Ding C. K., Gallant M., Gareau Y., Griffin P. R., Labelle M., Lazebnik Y. A., Et A. Nature. 1995;376:37–43. doi: 10.1038/376037a0. [DOI] [PubMed] [Google Scholar]
  19. Zou H., Henzel W. J., Liu X., Lutschg A., Wang X. Cell. 1997;90:405–413. doi: 10.1016/s0092-8674(00)80501-2. [DOI] [PubMed] [Google Scholar]
  20. Tyurina Y. Y., Poloyac S. M., Tyurin V. A., Kapralov A. A., Jiang J., Anthonymuthu T. S., Kapralova V. I., Vikulina A. S., Jung M. Y., Epperly M. W., Mohammadyani D., Klein-Seetharaman J., Jackson T. C., Kochanek P. M., Pitt B. R., Greenberger J. S., Vladimirov Y. A., Bayir H., Kagan V. E. Nat. Chem. 2014;6:542–552. doi: 10.1038/nchem.1924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Azzam E. I., Jay-Gerin J. P., Pain D. Cancer Lett. 2012;327:48–60. doi: 10.1016/j.canlet.2011.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Islam M. T. Neurol. Res. 2017;39:73–82. doi: 10.1080/01616412.2016.1251711. [DOI] [PubMed] [Google Scholar]
  23. Eltahawy N. A., Elsonbaty S. M., Abunour S., Zahran W. E. Environ. Sci. Pollut. Res. Int. 2017;24:15860. doi: 10.1007/s11356-017-9286-9. [DOI] [PubMed] [Google Scholar]
  24. Eltahawy N. A., Elsonbaty S. M., Abunour S., Zahran W. E. Environ. Sci. Pollut. Res. Int. 2017;24:6657–6666. doi: 10.1007/s11356-017-8392-z. [DOI] [PubMed] [Google Scholar]
  25. Przybyszewski W. M., Widel M., Szurko A., Maniakowski Z. Postepy Hig. Med. Dosw. 2008;62:468–477. [PubMed] [Google Scholar]
  26. Baude E. J., Arora V. K., Yu S., Garbers D. L., Wedel B. J. J. Biol. Chem. 1997;272:16035–16039. doi: 10.1074/jbc.272.25.16035. [DOI] [PubMed] [Google Scholar]
  27. Fujiwara M., Hino T., Miyamoto R., Inada H., Mori I., Koga M., Miyahara K., Ohshima Y., Ishihara T. Genetics. 2015;201:1497–1510. doi: 10.1534/genetics.115.177543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jiao C., Wang P., Yang R., Tian L., Gu Z. J. Agric. Food Chem. 2016;64:8282–8288. doi: 10.1021/acs.jafc.6b02633. [DOI] [PubMed] [Google Scholar]
  29. Leach J. K., Black S. M., Schmidt-Ullrich R. K., Mikkelsen R. B. J. Biol. Chem. 2002;277:15400–15406. doi: 10.1074/jbc.M110309200. [DOI] [PubMed] [Google Scholar]
  30. Shinkai Y., Yamamoto Y., Fujiwara M., Tabata T., Murayama T., Hirotsu T., Ikeda D. D., Tsunozaki M., Iino Y., Bargmann C. I., Katsura I., Ishihara T. J. Neurosci. 2011;31:3007–3015. doi: 10.1523/JNEUROSCI.4691-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ingelfinger D., Arndt-Jovin D. J., Luhrmann R., Achsel T. RNA. 2002;8:1489–1501. [PMC free article] [PubMed] [Google Scholar]
  32. Tharun S. Int. Rev. Cell Mol. Biol. 2009;272:149–189. doi: 10.1016/S1937-6448(08)01604-3. [DOI] [PubMed] [Google Scholar]
  33. Lehner B., Sanderson C. M. Genome Res. 2004;14:1315–1323. doi: 10.1101/gr.2122004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tharun S., He W., Mayes A. E., Lennertz P., Beggs J. D., Parker R. Nature. 2000;404:515–518. doi: 10.1038/35006676. [DOI] [PubMed] [Google Scholar]
  35. Tomasevic N., Peculis B. A. Mol. Cell. Biol. 2002;22:4101–4112. doi: 10.1128/MCB.22.12.4101-4112.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Bentley J., Brazier J. A., Fisher J., Cosstick R. Org. Biomol. Chem. 2007;5:3698–3702. doi: 10.1039/b713292a. [DOI] [PubMed] [Google Scholar]
  37. Urlaub H., Hartmuth K., Luhrmann R. Methods. 2002;26:170–181. doi: 10.1016/S1046-2023(02)00020-8. [DOI] [PubMed] [Google Scholar]
  38. Singhal S. S., Ahmad H., Sharma R., Gupta S., Haque A. K., Awasthi Y. C. Arch. Biochem. Biophys. 1991;285:64–73. doi: 10.1016/0003-9861(91)90329-h. [DOI] [PubMed] [Google Scholar]
  39. Lin R. X., Zhao H. B., Li C. R., Sun Y. N., Qian X. H., Wang S. Q. J. Proteome Res. 2009;8:390–399. doi: 10.1021/pr800699w. [DOI] [PubMed] [Google Scholar]
  40. Nayak S., Santiago F. E., Jin H., Lin D., Schedl T., Kipreos E. T. Curr. Biol. 2002;12:277–287. doi: 10.1016/s0960-9822(02)00682-6. [DOI] [PubMed] [Google Scholar]
  41. Yin X., Gower N. J., Baylis H. A., Strange K. Mol. Biol. Cell. 2004;15:3938–3949. doi: 10.1091/mbc.E04-03-0198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Vazquez-Manrique R. P., Nagy A. I., Legg J. C., Bales O. A., Ly S., Baylis H. A. PLoS Genet. 2008;4:e1000043. doi: 10.1371/journal.pgen.1000043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Morris J. Z., Tissenbaum H. A., Ruvkun G. Nature. 1996;382:536–539. doi: 10.1038/382536a0. [DOI] [PubMed] [Google Scholar]
  44. Nicholas H. R., Hodgkin J. Curr. Biol. 2004;14:1256–1261. doi: 10.1016/j.cub.2004.07.022. [DOI] [PubMed] [Google Scholar]
  45. Okuyama T., Inoue H., Ookuma S., Satoh T., Kano K., Honjoh S., Hisamoto N., Matsumoto K., Nishida E. J. Biol. Chem. 2010;285:30274–30281. doi: 10.1074/jbc.M110.146274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Yang M., Sun J., Sun X., Shen Q., Gao Z., Yang C. PLoS Genet. 2009;5:e1000514. doi: 10.1371/journal.pgen.1000514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Eastburn D. J., Han M. Mol. Cell. Biol. 2005;25:9427–9434. doi: 10.1128/MCB.25.21.9427-9434.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Scharer O. D. Angew. Chem., Int. Ed. 2003;42:2946–2974. doi: 10.1002/anie.200200523. [DOI] [PubMed] [Google Scholar]
  49. Leibeling D., Laspe P., Emmert S. J. Mol. Histol. 2006;37:225–238. doi: 10.1007/s10735-006-9041-x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES