Abstract
Premise
A novel set of nuclear microsatellite markers was developed and characterized for Campomanesia adamantium (Myrtaceae) and tested for cross‐amplification in the related species C. sessiliflora.
Methods and Results
Forty‐one primer pairs were designed for simple sequence repeat loci, of which 36 successfully amplified and were polymorphic. The number of alleles ranged from two to 14, with an average of 8.14 alleles per locus. Additionally, cross‐amplification was tested in C. sessiliflora; more than 55.5% of the microsatellite loci amplified, confirming the use of these microsatellite markers in a related species.
Conclusions
We developed a set of microsatellite markers that will be useful for future studies of genetic diversity and population structure of C. adamantium and a closely related species, which will aid in future conservation efforts.
Keywords: Campomanesia sessiliflora, cross‐amplification, genetic structure, guavira, microsatellite loci, Myrtaceae, simple sequence repeat (SSR) markers
The Cerrado is the second largest of Brazil's major biomes, after Amazonia, and this biome is characterized by central Brazil's plateau of woodlands, savannas, grasslands, and gallery and dry forests. The climate is seasonal—wet from October to March and dry from April to September—and mild throughout the year, with temperatures ranging from 22°C to 27°C. Average annual rainfall is 1500 mm (Klink and Machado, 2005). The Cerrado biome features a high diversity of native plants with high economic potential for the pharmaceutical and food markets. This biome is a hotspot of biodiversity because endemic species have progressively been threatened by deforestation and agricultural expansion. Research on the genetic and floral biology of these species is extremely important to promote their conservation. Of several native plants of the Cerrado, Campomanesia adamantium (Cambess.) O. Berg (Myrtaceae) should be highlighted because of its environmental significance. This species can resist flooding and has been used for spoiled‐area reforestation projects (Hardt et al., 2006). Also known as guavira or gabiroba, C. adamantium is commonly found in Brazil and Paraguay and is notable for the potential commercial use of its fruits to produce food and beverages. Many researchers have reported important medicinal properties of this plant, including antioxidant (Coutinho et al., 2008), antimicrobial (Pavan et al., 2009), and antitumor properties (Pascoal et al., 2014).
To start a genetic breeding program for any plant species, it is necessary to assess its genetic variability. Genetic diversity in C. adamantium was detected previously using random amplified polymorphic DNA (RAPD) markers (Assis et al., 2013) and by measuring phenotypic characteristics (Resende and Teixeira, 2015). Microsatellite markers have been shown to be efficient tools to assess genetic variation at the individual and population levels because of their hypervariability, wide genomic distribution, co‐dominant inheritance, reproducibility, and multi‐allelic nature (Haq et al., 2014). Recent research has validated the transferability of microsatellite markers from closely related species of C. adamantium, including expressed sequence tag (EST)–derived simple sequence repeat (SSR) markers from Eucalyptus L'Hér. (Myrtaceae) (Miranda et al., 2016; Crispim et al., 2018) and SSR primers from Eucalyptus spp., Eugenia uniflora L., and Melaleuca alternifolia Cheel (Fagundes et al., 2016). Analysis of genetic diversity using transferable molecular markers only reflects polymorphisms in conserved genomic regions among congeneric species or genera from the same family; however, transferable microsatellite markers from other species may be limited in the level of genetic diversity they can reveal in the target species (Queirós et al., 2015). Thus, the use of species‐specific microsatellites could more accurately report the genetic variability in C. adamantium and detect aspects of biodiversity that could be omitted by the use of transferable markers.
Therefore, the goal of this study was to isolate and characterize microsatellite markers for C. adamantium by constructing a microsatellite‐enriched genomic library and to test the cross‐amplification of these markers in C. sessiliflora (O. Berg) Mattos, a species native to Brazil with medicinal and economic value.
METHODS AND RESULTS
Plant material and DNA extraction
Young leaf tissue samples from one accession of C. adamantium (voucher 4666, Herbarium of the Federal University of Grande Dourados [DDMS], Dourados, Mato Grosso do Sul, Brazil) were collected to develop the microsatellite markers, and 45 samples from three natural populations were collected to validate the microsatellite markers for this species (Appendix 1). Ten samples of C. sessiliflora were collected from a single population to test cross‐amplification of the markers in a related species. Detailed information about all samples collected for this study is provided in Appendix 1. DNA was extracted from young leaf tissue using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987).
Development of SSRs and primer design
Genomic DNA of C. adamantium was used to develop a microsatellite‐enriched genomic library using a protocol adapted from Billotte et al. (1999). The isolation procedure consisted of digestion of genomic DNA with the AfaI restriction enzyme (Invitrogen, Carlsbad, California, USA) and ligation of fragments with double‐stranded adapters 5′‐CTCTTGCTTACGCGTGGACTA‐3′ and 5′‐TAGTCCACGCGTAAGCAAGAGCACA‐3′. The enrichment was based on hybridization capture using (CT)8 and (GT)8 biotin‐linked probes and streptavidin‐coated magnetic beads (MagneSphere Magnetic Separation Products; Promega Corporation, Madison, Wisconsin, USA). Microsatellite‐enriched DNA fragments were amplified by PCR, cloned into a pGEM‐T Easy Vector (Promega Corporation), and then inserted into Escherichia coli XL1‐Blue competent cells (Promega Corporation) using an electroporation technique. Positive clones were selected via a culture medium containing ampicillin and β‐galactosidase.
Ninety‐six colonies were selected using blue/white screening, and the sequencing was performed on an automated ABI 3500xL Genetic Analyzer (Applied Biosystems, Foster City, California, USA) with T7 and SP6 primers and the BigDye Terminator version 3.1 Cycle Sequencing Kit (Perkin Elmer–Applied Biosystems). Microsatellite sequences were identified in 41 clones with good quality sequences for primer design using Primer3Plus software (Untergasser et al., 2012), under the following parameters: size of final amplification products 100–350 bp, GC percentage minimum 40% and maximum 60%, primer annealing temperature ranging from 57°C to 65°C, and the maximum difference in annealing temperature between primer pairs of 3°C.
Primer validation and microsatellite marker evaluation
Forty‐one primer pairs were designed and tested for amplification in C. adamantium in three populations (n = 45). In addition, for markers CAMP01, CAMP03, CAMP04, CAMP08, CAMP13, CAMP17, CAMP24, CAMP25, CAMP28, and CAMP36, the genotyping was performed with n ≥ 45, using additional individuals sampled from Crispim et al. (2018). Cross‐species amplification was tested using the 36 most polymorphic markers (Table 1). PCR amplifications were performed in a 25‐μL reaction volume containing 50 ng of DNA, 7.5 μL of ultra‐pure water (Fermentas, Waltham, Massachusetts, USA), 0.15 μM of forward and reverse primer, and 12.5 μL of PCR Master Mix (50 U/mL of Taq polymerase DNA, 400 μM of dNTP, and 3 mM of MgCl2) (Fermentas). PCR cycling conditions consisted of an initial denaturation at 94°C for 5 min; followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 1 min; and a final extension cycle at 72°C for 15 min. Amplified products were verified visually on 2% agarose gels. Polymorphism evaluation and genotyping were performed using electrophoresis on a 7% polyacrylamide gel stained with silver nitrate (Creste et al., 2001). To determine fragment sizes, we used 10‐bp and 50‐bp DNA ladders (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The fragments were estimated to within 5 bp.
Table 1.
Characteristics of 36 microsatellite markers developed for Campomanesia adamantium
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | GenBank accession no. |
|---|---|---|---|---|
| CAMP01 | F: TATCAAGTCACGAAGGTGGG | (TG)16 | 140–200 | MF280931 |
| R: TGGCAAGTATATCCTGCTCA | ||||
| CAMP02 | F: CCAATCATGCGATATCGTGC | (TG)8 | 165–210 | MF280932 |
| R: TGGCAAGTATATCCTGCTCA | ||||
| CAMP03 | F: GTTGGCTCAACAGTTAGCAG | (TG)8 | 150–260 | MF280933 |
| R: TCTAGAACTCGGCATTTCCC | ||||
| CAMP04 | F: CTTAATGCACATCCGCAACA | (GA)10(CA)6 | 200–275 | MF280934 |
| R: GGATGAATTATGTCACGACACA | ||||
| CAMP05 | F: ACAGAATGTCGTACCTGCAA | (AC)9 | 150–180 | MF280935 |
| R: GGAGTCGAACTGGGTATCTC | ||||
| CAMP06 | F: GGTTGAGGAACTAGATCGGG | (TG)17 | 225–275 | MF280936 |
| R: GGTGACTTCCGAAACCTTTG | ||||
| CAMP07 | F: CTCTCTCCTTTCGCATCCTT | (GC)7 | 150–200 | MF280937 |
| R: GCACCTAGTCCCATCAATCA | ||||
| CAMP08 | F: AATAGCTTCCAGACTGCTCC | (TC)24 | 240–275 | MF280938 |
| R: AAAAGAGAATTTGGAGCGCC | ||||
| CAMP09 | F: CATCCCGAGTAGCTACAGAG | (AG)20 | 245–270 | MF280939 |
| R: TCACAAACATTGCAAAGGGC | ||||
| CAMP10 | F: GGAGGGTGACATAAGAGCAA | (TG)34 | 140–195 | MF280940 |
| R: TCCGACTTAACAAGACATACCA | ||||
| CAMP11 | F: CTGTTCTTGCCACTCTGTTG | (TC)17(CA)16 | 200–350 | MF280941 |
| R: ATAATTCCGCCAACAAGCAC | ||||
| CAMP12 | F: CATATCGCCTTTTTAGCCCG | (TG)7 | 265–270 | MF280942 |
| R: AAAGTGCAGAGAAAGTTCGC | ||||
| CAMP13 | F: AGTCGAGTGGGCTCTAGTAT | (TG)8 | 200–290 | MF280943 |
| R: ATGTGCTGCTCAGAAAGAGT | ||||
| CAMP14 | F: TGGTCTTGGTTCCTTTCACA | (GT)17 | 240–300 | MF280944 |
| R: ACTGTGGTAGAGTTTGACCA | ||||
| CAMP15 | F: CCAATCATGCGATATCGTGC | (TG)8 | 190–230 | MF280945 |
| R: TCACGTGGATTGGCAAGTAT | ||||
| CAMP16 | F: GAGATCATAGGGCTCTTCGG | (TG)8 | 180–220 | MF280946 |
| R: CCTCGCTAAAGCTTGCTTTT | ||||
| CAMP17 | F: TCATCTTCGGCTACATAACGT | (AC)9 | 125–160 | MF280947 |
| R: TCCATGCCTTTTCCTCTTTAGA | ||||
| CAMP18 | F: ACTCGAAGAAGCACTAAGGG | (AC)10 | 190–290 | MF280948 |
| R: TGGTGTTCTGAATTTGGAAGTG | ||||
| CAMP19 | F: GAGAAGAGAGGGAGCCTTTG | (GA)28 | 160–200 | MF280949 |
| R: CATGGCAACCCTCTTGAATG | ||||
| CAMP21 | F: GTAGATTGCTGCTAGCTTGC | (TG)9 | 280–315 | MF280951 |
| R: ACCTTCGGTCCCATCAAAAT | ||||
| CAMP22 | F: TGGTTCCTAAGATCTCCCCA | (TG)5 | 100–180 | MF280952 |
| R: TCCCAAACACTTCTGTATGCT | ||||
| CAMP23 | F: CCCTTGAAAACTTGTGGTGG | (GA)27 | 150–240 | MF280953 |
| R: CATCTATGTACGAGGGAGGC | ||||
| CAMP24 | F: CAAGTCCTACATGGCTGGAT | (TG)7 | 200–230 | MF280954 |
| R: AGTGCACGAAAACTGGTCTA | ||||
| CAMP25 | F: TCCATGCCTTTTCCTCTTTAGA | (TG)9 | 140–180 | MF280955 |
| R: TCATCTTCGGCTACATAACGT | ||||
| CAMP26 | F: TCTTCGACGAGGTAACAAGG | (AC)8 | 150–215 | MF280956 |
| R: ATGACACACGTGAATACCGA | ||||
| CAMP27 | F: ATGAAACGGTGGCATCTTTG | (TC)22 | 230–270 | MF280957 |
| R: CGGAAGTTCCATCTCCAAGA | ||||
| CAMP28 | F: CGTGATGAAGAGTGATGGGA | (GA)21 | 210–240 | MF280958 |
| R: TCATTGATAACTGCGGGTGA | ||||
| CAMP30 | F: GAGTCCTAGTGCACAATGGT | (TG)8(GA)20(AG)5 | 270–305 | MF280960 |
| R: TTTTGGGGCTCACTCTATCG | ||||
| CAMP33 | F: AACTCGTCCAAAATCTCCGT | (GT)6 | 145–240 | MF280963 |
| R: GATTTTGCGTGCTCTCTCTC | ||||
| CAMP34 | F: TCCGCCCAGACAGAAAATTA | (AC)8 | 180–250 | MF280964 |
| R: AGTTGTCCGACTCCAACTTT | ||||
| CAMP36 | F: TCCCAAACACTTCTGTATGCT | (CA)5 | 120–170 | MF280966 |
| R: TGGTTCCTAAGATCTCCCCA | ||||
| CAMP37 | F: GCTCGTAAGGATGTTTTCCC | (GA)28 | 150–220 | MF280967 |
| R: GAGCTTCAACTTGACCAACC | ||||
| CAMP38 | F: CGATAACCGGCAATATCACG | (TG)8(GA)12 | 130–200 | MF280968 |
| R: TCCTCTTTTACCCTCCTCCA | ||||
| CAMP39 | F: AAAGTAGCTCATGCCCTCTC | (TC)21 | 250–310 | MF280969 |
| R: CTCTGGAATTCGCACGAATC | ||||
| CAMP40 | F: GCAGCTTAACCACTGGAAAG | (TG)21(GA)8 | 270–300 | MF280970 |
| R: TGAAAGCATAGTCGTGTGGA | ||||
| CAMP41 | F: AGAAAGTGGATGCCGGTTAA | (TG)8(GA)11 | 250–310 | MF280971 |
| R: TGGACTTTCACTCACAAGACT |
To evaluate the differences between the genetic diversity parameters of C. adamantium resulting from the use of transferable microsatellite markers and specific species, we selected 10 markers developed in this study (CAMP01, CAMP03, CAMP04, CAMP08, CAMP13, CAMP17, CAMP24, CAMP25, CAMP28, CAMP36) and compared them with the data of transferable markers (Embra1335, Embra1076, Embra1470, Embra1364, Embra1363, Embra1374, Embra1811) from the research by Crispim et al. (2018) (Appendix 2).
Statistical analyses were performed using GenAlEx version 6.5 software (Peakall and Smouse, 2012) to calculate the number of alleles per locus, the level of expected heterozygosity (H e) and observed heterozygosity (H o), and the polymorphism information content. We used the statistical environment software R (R Core Team, 2018) to estimate the multilocus genotype using the poppr R package (Kamvar et al., 2014). Tests for deviation from Hardy–Weinberg equilibrium (HWE) for proportions at each locus for each population were performed using the diveRsity R package (Keenan et al., 2013). The Bonferroni correction was used to correct multiple applications of the same test. We also estimated inbreeding coefficients (F IS) within each population using the same package. Confidence intervals were obtained with 10,000 bootstrap replicates. The test for null allele presence was performed using MICRO‐CHECKER (van Oosterhout et al., 2004). The influence of null alleles was determined in FREENA (Chapuis and Estoup, 2007) by computing the genetic divergence parameter (F ST) values using an excluding null alleles (ENA) correction. After accounting for null allele frequencies, loci with frequencies of ≥0.2 were considered potentially problematic for the calculations.
Overall, C. adamantium primers successfully amplified 36 SSR loci, in which all markers were polymorphic in the analyzed populations (n = 45); the number of alleles ranged from two to 14, with an average of 8.14 per locus. The H o and H e ranged from 0.00 to 0.91 (average 0.52) and from 0.09 to 0.89 (average 0.78), respectively. When we tested the previously mentioned set of 10 markers (CAMP01, CAMP03, CAMP04, CAMP08, CAMP13, CAMP17, CAMP24, CAMP25, CAMP28, CAMP36) using an increased number of individuals (n ≥ 45), the number of alleles ranged from 11 to 23, with an average of 17.10. The level of H o and H e ranged from 0.24 to 0.72 (average 0.51) and from 0.81 to 0.92 (average 0.87), respectively (Table 2). These results confirm the reliability of the designed set of markers to evaluate genetic diversity in further studies of this species.
Table 2.
Genetic characterization of 36 microsatellite loci in three populations of Campomanesia adamantium.a
| Locus | Dourados (n = 15) | Bonito (n = 15) | Cerro Corá (n = 15) | Total | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | F IS b | HWEc | A | H o | H e | F IS b | HWEc | A | H o | H e | F IS b | HWEc | n d | A | H o | H e | HWEc | |
| CAMP01 | 5 | 0.42# | 0.76 | 0.45 | 0.21 | 7 | 0.47# | 0.77 | 0.39 | 0.03 | 6 | 0.80 | 0.72 | −0.11 | 0.00 | 45 | 12 | 0.57 | 0.82 | 0.00 |
| 260 | 23 | 0.44 | 0.91 | 0.00 | ||||||||||||||||
| CAMP02 | 5 | 0.36# | 0.70 | 0.49 | 0.02 | 8 | 0.47# | 0.82 | 0.43 | 0.00 | 6 | 0.73 | 0.81 | 0.10 | 0.06 | 45 | 11 | 0.50 | 0.88 | 0.00 |
| CAMP03 | 4 | 0.46 | 0.68 | 0.32 | 0.00 | 5 | 0.47 | 0.68 | 0.31 | 0.15 | 7 | 1.00 | 0.78 | −0.29 | 0.22 | 45 | 13 | 0.65 | 0.87 | 0.00 |
| 240 | 17 | 0.63 | 0.89 | 0.00 | ||||||||||||||||
| CAMP04 | 5 | 0.50 | 0.56 | 0.10 | 0.25 | 2 | 0.71 | 0.49 | −0.46 | 0.08 | 4 | 0.67 | 0.69 | 0.04 | 0.57 | 45 | 9 | 0.63 | 0.77 | 0.00 |
| 275 | 20 | 0.72 | 0.87 | 0.00 | ||||||||||||||||
| CAMP05 | 5 | 0.47# | 0.72 | 0.35 | 0.00 | 5 | 0.87 | 0.69 | −0.26 | 0.15 | 4 | 0.67 | 0.64 | −0.05 | 0.03 | 45 | 7 | 0.67 | 0.79 | 0.00 |
| CAMP06 | 3 | 0.00# | 0.51 | 1.00 | 0.00 | 5 | 0.73 | 0.74 | 0.01 | 0.00 | 6 | 0.80 | 0.81 | 0.01 | 0.02 | 45 | 8 | 0.53 | 0.85 | 0.00 |
| CAMP07 | — | — | — | — | — | 3 | 0.64 | 0.55 | −0.16 | 0.54 | — | — | — | — | — | 15 | 5 | 0.22 | 0.73 | 0.00 |
| CAMP08 | 3 | 0.33 | 0.50 | 0.33 | 0.06 | 3 | 0.27 | 0.24 | −0.12 | 0.95 | 5 | 0.93 | 0.69 | −0.36 | 0.02 | 45 | 7 | 0.52 | 0.77 | 0.00 |
| 250 | 20 | 0.31 | 0.88 | 0.00 | ||||||||||||||||
| CAMP09 | 6 | 0.67 | 0.73 | 0.08 | 0.01 | 3 | 0.14# | 0.36 | 0.60 | 0.00 | 6 | 0.73 | 0.63 | −0.16 | 0.00 | 45 | 8 | 0.51 | 0.67 | 0.00 |
| CAMP10 | 4 | 0.91 | 0.67 | −0.37 | 0.16 | 3 | 0.67 | 0.52 | −0.29 | 0.60 | 5 | 0.93 | 0.75 | −0.25 | 0.55 | 45 | 10 | 0.84 | 0.82 | 0.00 |
| CAMP11 | 6 | 0.36# | 0.76 | 0.52 | 0.00 | 5 | 0.36# | 0.73 | 0.51 | 0.00 | 8 | 0.93 | 0.81 | −0.15 | 0.10 | 45 | 14 | 0.58 | 0.89 | 0.00 |
| CAMP12 | 2 | 0.00 | 0.17 | 1.00 | 0.00 | — | — | — | — | — | 2 | 0.00 | 0.12 | 1.00 | 0.00 | 30 | 2 | 0.00 | 0.09 | 0.00 |
| CAMP13 | 8 | 0.73 | 0.73 | 0.01 | 0.10 | 5 | 0.25# | 0.68 | 0.63 | 0.00 | 5 | 0.57 | 0.76 | 0.25 | 0.18 | 45 | 11 | 0.51 | 0.82 | 0.00 |
| 245 | 16 | 0.30 | 0.91 | 0.00 | ||||||||||||||||
| CAMP14 | 2 | 0.00# | 0.40 | 1.00 | 0.00 | — | — | — | — | — | 6 | 0.30# | 0.76 | 0.60 | 0.02 | 30 | 7 | 0.14 | 0.71 | 0.00 |
| CAMP15 | 4 | 0.20# | 0.53 | 0.62 | 0.01 | 4 | 0.58 | 0.73 | 0.20 | 0.00 | 3 | 1.00 | 0.53 | −0.88 | 0.00 | 45 | 7 | 0.65 | 0.71 | 0.00 |
| CAMP16 | 3 | 0.77 | 0.58 | −0.33 | 0.22 | 2 | 0.38 | 0.45 | 0.15 | 0.58 | 4 | 0.43# | 0.69 | 0.38 | 0.00 | 45 | 8 | 0.53 | 0.83 | 0.00 |
| CAMP17 | 4 | 0.73 | 0.65 | −0.13 | 0.01 | 3 | 0.33 | 0.46 | 0.28 | 0.27 | 6 | 0.86 | 0.82 | −0.05 | 0.00 | 45 | 7 | 0.64 | 0.78 | 0.00 |
| 275 | 14 | 0.70 | 0.83 | 0.00 | ||||||||||||||||
| CAMP18 | 4 | 0.43 | 0.64 | 0.33 | 0.35 | 8 | 0.80 | 0.80 | 0.01 | 0.00 | 3 | 0.53 | 0.50 | −0.07 | 0.39 | 45 | 12 | 0.59 | 0.82 | 0.00 |
| CAMP19 | 2 | 0.00 | 0.15 | 1.00 | 0.00 | 2 | 0.20 | 0.42 | 0.52 | 0.09 | 4 | 0.42# | 0.73 | 0.43 | 0.01 | 45 | 5 | 0.21 | 0.72 | 0.00 |
| CAMP21 | 6 | 0.91 | 0.79 | −0.15 | 0.45 | — | — | — | — | — | — | — | — | — | — | 15 | 6 | 0.91 | 0.79 | 0.45 |
| CAMP22 | 3 | 0.69 | 0.62 | −0.11 | 0.07 | — | — | — | — | — | 7 | 0.79 | 0.73 | −0.08 | 0.00 | 30 | 10 | 0.74 | 0.84 | 0.00 |
| CAMP23 | 6 | 0.82 | 0.74 | −0.11 | 0.05 | 5 | 0.18# | 0.64 | 0.72 | 0.00 | 5 | 0.54 | 0.66 | 0.18 | 0.53 | 45 | 11 | 0.51 | 0.85 | 0.00 |
| CAMP24 | 2 | 1.00 | 0.50 | −1.00 | 0.00 | 2 | 1.00 | 0.50 | −1.00 | 0.00 | 2 | 0.53 | 0.39 | −0.36 | 0.16 | 45 | 2 | 0.81 | 0.48 | 0.00 |
| 265 | 18 | 0.49 | 0.81 | 0.00 | ||||||||||||||||
| CAMP25 | 4 | 0.82 | 0.69 | −0.19 | 0.00 | 4 | 0.80 | 0.57 | −0.41 | 0.35 | 2 | 0.36 | 0.50 | 0.27 | 0.37 | 45 | 6 | 0.68 | 0.76 | 0.00 |
| 270 | 12 | 0.65 | 0.81 | 0.00 | ||||||||||||||||
| CAMP26 | 3 | 0.21# | 0.52 | 0.59 | 0.02 | 2 | 0.00# | 0.50 | 1.00 | 0.00 | 3 | 0.60 | 0.54 | −0.11 | 0.64 | 45 | 7 | 0.29 | 0.76 | 0.00 |
| CAMP27 | 4 | 0.50 | 0.57 | 0.13 | 0.61 | 3 | 0.30 | 0.59 | 0.49 | 0.11 | 3 | 0.53 | 0.66 | 0.19 | 0.11 | 45 | 7 | 0.46 | 0.79 | 0.00 |
| CAMP28 | 4 | 0.00# | 0.48 | 1.00 | 0.00 | 3 | 0.13# | 0.55 | 0.76 | 0.00 | 4 | 0.40 | 0.57 | 0.30 | 0.00 | 45 | 7 | 0.20 | 0.79 | 0.00 |
| 190 | 20 | 0.24 | 0.92 | 0.00 | ||||||||||||||||
| CAMP30 | 3 | 0.55 | 0.43 | −0.26 | 0.67 | 2 | 0.09 | 0.43 | 0.79 | 0.01 | 4 | 0.69 | 0.65 | −0.07 | 0.26 | 45 | 6 | 0.46 | 0.63 | 0.11 |
| CAMP33 | 3 | 0.09# | 0.31 | 0.71 | 0.01 | 4 | 0.85 | 0.62 | −0.37 | 0.00 | 3 | 0.62 | 0.47 | −0.31 | 0.46 | 45 | 10 | 0.54 | 0.83 | 0.00 |
| CAMP34 | 4 | 0.47 | 0.38 | −0.22 | 0.97 | 4 | 0.79 | 0.59 | −0.33 | 0.00 | 3 | 0.29# | 0.57 | 0.50 | 0.00 | 45 | 9 | 0.51 | 0.80 | 0.00 |
| CAMP36 | 4 | 0.60 | 0.69 | 0.12 | 0.04 | 2 | 1.00 | 0.50 | −1.00 | 0.00 | 3 | 0.87 | 0.53 | −0.65 | 0.03 | 45 | 5 | 0.85 | 0.69 | 0.00 |
| 195 | 11 | 0.59 | 0.82 | 0.00 | ||||||||||||||||
| CAMP37 | 6 | 0.64 | 0.65 | 0.03 | 0.14 | 5 | 0.14# | 0.68 | 0.79 | 0.00 | 5 | 0.31# | 0.72 | 0.57 | 0.00 | 45 | 11 | 0.34 | 0.85 | 0.00 |
| CAMP38 | 5 | 0.67 | 0.71 | 0.06 | 0.01 | 4 | 0.60 | 0.58 | −0.03 | 0.73 | 4 | 0.42 | 0.47 | 0.10 | 0.49 | 45 | 10 | 0.57 | 0.84 | 0.00 |
| CAMP39 | 5 | 0.92 | 0.78 | −0.18 | 0.00 | 4 | 0.67 | 0.48 | −0.38 | 0.71 | 3 | 0.67 | 0.58 | −0.15 | 0.86 | 42 | 9 | 0.74 | 0.84 | 0.00 |
| CAMP40 | 5 | 0.30# | 0.53 | 0.43 | 0.40 | 3 | 0.29 | 0.50 | 0.43 | 0.18 | — | — | — | — | — | 30 | 5 | 0.29 | 0.62 | 0.00 |
| CAMP41 | 8 | 0.82 | 0.80 | −0.02 | 0.24 | 3 | 0.67 | 0.64 | −0.04 | 0.17 | 3 | 0.40 | 0.46 | 0.14 | 0.80 | 45 | 9 | 0.61 | 0.80 | 0.00 |
| Average | 4.29 | 0.50 | 0.59 | 0.22 | 0.15 | 3.84 | 0.50 | 0.58 | 0.13 | 0.18 | 4.36 | 0.62 | 0.63 | 0.03 | 0.21 | — | 10 | 0.52 | 0.78 | 0.01 |
| SD | 1.53 | 0.30 | 0.17 | 0.47 | 0.23 | 1.65 | 0.28 | 0.13 | 0.51 | 0.27 | 1.58 | 0.24 | 0.15 | 0.37 | 0.26 | — | 4.81 | 0.20 | 0.13 | 0.07 |
A = number of alleles; F IS = inbreeding coefficient; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; n = number of individuals sampled; SD = standard deviation.
Locality and voucher information are available in Appendix 1.
Statistically significant deviation based on the 95% confidence interval (data not shown) from the inbreeding coefficient is shown in bold.
Statistically significant deviation based on Fisher's exact test for Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.0001) is shown in bold.
For markers CAMP01, CAMP04, CAMP08, CAMP13, CAMP17, CAMP24, CAMP25, CAMP28, and CAMP36 genotyping was performed twice: once with n = 45 and once with n ≥ 45.
Significant possibility of the presence of null alleles.
Significant deviations from HWE based on Fisher's exact test (P < 0.05) in C. adamantium were detected for 11 loci in the Dourados population, 15 loci in the Bonito population, and 10 loci in the Cerro Corá population (Table 2). When overall populations were considered, only two markers (CAMP21 and CAMP30) did not significantly deviate from HWE. Several factors (e.g., insufficient sample size, seed dispersal [Hedrick, 2005]) contributed to the observed deviations from HWE. In all sampled regions, C. adamantium was observed as a branched tree, very often found in a group of bushes of plants of the same species with the possibility of kinship among sampled individuals; this also was verified by Nucci and Alves‐Junior (2017). Although some individuals with identical multilocus genotypes were found, the observed deviations from HWE may be due to factors such as population subdivision and the presence of null alleles.
The test for null alleles indicated significant results in some loci in the populations (Table 2). The most frequent loci were CAMP01, CAMP02, CAMP11, CAMP14, CAMP26, CAMP28, and CAMP37, which showed a significant possibility of the presence of null alleles in two of the three tested populations. After null allele correction (ENA), overall F ST changed only slightly (from 0.302 to 0.283).
In C. sessiliflora, 20 microsatellite loci cross‐amplified (Table 3). The number of alleles ranged from two to five, with an average of 2.85. Significant deviations (P < 0.05) from HWE were verified in three loci.
Table 3.
Genetic diversity of 20 microsatellite loci developed in Campomanesia adamantium that successfully cross‐amplified in C. sessiliflora (n=10).a , b
| Locus | A | H o | H e | F IS c | HWEd | Allele size range (bp) |
|---|---|---|---|---|---|---|
| CAMP01 | 4 | 0.40 | 0.66 | 0.39 | 0.21 | 160–190 |
| CAMP02 | 4 | 0.20 | 0.48 | 0.58 | 0.00 | 190–240 |
| CAMP03 | 2 | 0.70 | 0.45 | −0.53 | 0.09 | 190–200 |
| CAMP04 | 3 | 0.80 | 0.58 | −0.37 | 0.00 | 210–300 |
| CAMP05 | 3 | 0.10 | 0.33 | 0.70 | 0.01 | 190–200 |
| CAMP06 | 2 | 0.70 | 0.45 | −0.53 | 0.09 | 300–310 |
| CAMP09 | 2 | 0.20 | 0.18 | −0.11 | 0.73 | 250–260 |
| CAMP10 | 4 | 0.50 | 0.56 | 0.11 | 0.13 | 175–190 |
| CAMP11 | 3 | 0.40 | 0.48 | 0.17 | 0.44 | 180–200 |
| CAMP16 | 2 | 0.90 | 0.49 | −0.81 | 0.01 | 230–235 |
| CAMP17 | 2 | 0.20 | 0.18 | −0.11 | 0.73 | 130–140 |
| CAMP23 | 2 | 0.80 | 0.48 | −0.66 | 0.03 | 150–170 |
| CAMP25 | 2 | 0.80 | 0.48 | −0.66 | 0.03 | 130–150 |
| CAMP26 | 3 | 0.80 | 0.6 | −0.32 | 0.02 | 240–250 |
| CAMP27 | 3 | 0.20 | 0.33 | 0.40 | 0.29 | 210–250 |
| CAMP28 | 5 | 0.80 | 0.74 | −0.08 | 0.04 | 200–240 |
| CAMP33 | 3 | 0.30 | 0.4 | 0.25 | 0.26 | 220–260 |
| CAMP36 | 3 | 0.20 | 0.18 | −0.08 | 0.99 | 140–160 |
| CAMP37 | 3 | 0.30 | 0.58 | 0.48 | 0.07 | 170–210 |
| CAMP39 | 2 | 1.00 | 0.5 | −1.00 | 0.00 | 300–310 |
| Average | 2.85 | 0.52 | 0.46 | −0.11 | 0.21 | |
| SD | 0.88 | 0.29 | 0.15 | 0.49 | 0.29 |
A = number of alleles; F IS = inbreeding coefficient; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; n = number of individuals sampled.
Locality and voucher information are available in Appendix 1.
Cross‐amplification was tested in the 36 polymorphic markers, and results are shown for the 20 markers that successfully cross‐amplified.
Statistically significant deviation based on the 95% confidence interval (data not shown) from the inbreeding coefficient in bold.
Statistically significant deviation based on Fisher's exact test for Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.002) is shown in bold.
CONCLUSIONS
We developed a panel of microsatellite markers that will be helpful for future studies of genetic diversity and population structure of C. adamantium. The microsatellite loci described in this study successfully cross‐amplified in C. sessiliflora, suggesting that these markers could be used to support genetic conservation and breeding programs for C. adamantium and other species in the genus.
AUTHOR CONTRIBUTIONS
B.A.C., A.B., and M.C.V designed the project. T.O.C. collected the samples. B.A.C., A.A.V., T.G.D., J.S.F., and M.M.B performed the experiments. B.A.C., T.G.D., A.B., M.M.B., and M.I.Z. wrote the manuscript.
ACKNOWLEDGMENTS
The authors thank Dr. Anete Pereira de Souza and her qualified team for technical support in the construction of a microsatellite‐enriched genomic library of C. adamantium and primer design. The Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and the Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado do Mato Grosso do Sul (FUNDECT) provided financial support.
APPENDIX 1. Voucher information for species used in the development and evaluation of microsatellite markers for Campomanesia adamantium.
| Taxon | Population | Location | Geographic coordinates | n | Voucher no.b |
|---|---|---|---|---|---|
| Campomanesia adamantium (Cambess.) O. Berga | Dourados | Santa Madalena Farm, Dourados, Mato Grosso do Sul, Brazil | 22°08′16.3″S, 55°08′24.2″W | 15 | 4666 |
| Bonito | Bonito, Mato Grosso do Sul, Brazil | 21°09’ 02.1″S, 56°28′12.8″W | 15 | 5685 | |
| Cerro Corá | Cerro Corá National Park, Amambay Department, Paraguay | 22°39’ 44.2″S, 56°01′52.6″W | 15 | 5686 | |
| Campomanesia sessiliflora (O. Berg) Mattos | Dourados | Santa Madalena Farm, Dourados, Mato Grosso do Sul, Brazil | 22°08’ 25″S, 55°08′17″W | 10 | 5255 |
n = number of individuals sampled.
The markers CAMP01, CAMP03, CAMP04, CAMP08, CAMP13, CAMP17, CAMP24, CAMP25, CAMP28, and CAMP36 were also tested against additional individuals of C. adamantium from Crispim et al. (2018).
All voucher specimens were deposited in the Herbarium of the Federal University of Grande Dourados (DDMS), Dourados, Mato Grosso do Sul, Brazil.
APPENDIX 2. Genetic diversity of microsatellites developed in Campomanesia adamantium compared to cross‐transferable microsatellites developed in Eucalyptus.
| Locus | A | H o | H e | F IS | HWE |
|---|---|---|---|---|---|
| Species‐specific microsatellites (n = 124) | |||||
| CAMP01 | 20 | 0.37 | 0.89 | 0.58 | 0.000* |
| CAMP03 | 15 | 0.70 | 0.88 | 0.21 | 0.000* |
| CAMP04 | 14 | 0.71 | 0.88 | 0.18 | 0.000* |
| CAMP08 | 16 | 0.31 | 0.83 | 0.63 | 0.000* |
| CAMP13 | 15 | 0.25 | 0.89 | 0.72 | 0.000* |
| CAMP17 | 14 | 0.68 | 0.82 | 0.17 | 0.000* |
| CAMP24 | 17 | 0.49 | 0.89 | 0.45 | 0.000* |
| CAMP25 | 12 | 0.64 | 0.80 | 0.21 | 0.000* |
| CAMP28 | 28 | 0.22 | 0.90 | 0.75 | 0.000* |
| CAMP36 | 9 | 0.64 | 0.83 | 0.23 | 0.000* |
| Average | 15 | 0.50 | 0.86 | 0.41 | |
| SD | 0.98 | 0.06 | 0.01 | 0.07 | |
| Cross‐transferable microsatellites (n = 124)a | |||||
| Embra1335 | 4 | 0.53 | 0.43 | −0.24 | 0.000* |
| Embra1076 | 3 | 0.98 | 0.51 | −0.94 | 0.000* |
| Embra1470 | 6 | 0.65 | 0.56 | −0.09 | 0.000* |
| Embra1364 | 20 | 0.77 | 0.93 | 0.15 | 0.000* |
| Embra1363 | 9 | 0.77 | 0.83 | 0.08 | 0.000* |
| Embra1374 | 10 | 0.67 | 0.77 | 0.13 | 0.000* |
| Embra1811 | 8 | 0.23 | 0.45 | 0.49 | 0.000* |
| Average | 8.57 | 0.65 | 0.64 | −0.06 | |
| SD | 2.15 | 0.09 | 0.07 | 0.17 | |
A = number of alleles per locus; F IS = inbreeding coefficient; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium test; n = number of individuals sampled.
Cross‐transferable microsatellite data from Crispim et al. (2018).
Fisher's exact test significant for Hardy–Weinberg equilibrium proportions after Bonferroni correction (P < 0.003).
Crispim, B. A. , Déo T. G., dos Santos Fernandes J., Vasconcelos A. A., Vieira M. C., Carnevali T. O., Bajay M. M., Zucchi M. I., and Barufatti A.. 2019. Development and characterization of microsatellite markers in Campomanesia adamantium, a native plant of the Cerrado ecoregions of South America. Applications in Plant Sciences 7(9): e11287.
DATA AVAILABILITY
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
Literature Cited
- Assis, E. S. , Reis E. F., Pinto J. F. N., Contim L. A. S., and Dias L. A. S.. 2013. Genetic diversity of gabiroba based on random amplified polymorphic DNA markers and morphological characteristics. Genetics and Molecular Research 12: 3500–3509. [DOI] [PubMed] [Google Scholar]
- Billotte, N. , Lagoda P. J. L., Risterucci A. M., and Baurens F. C.. 1999. Microsatellite‐enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288. [Google Scholar]
- Chapuis, M. P. , and Estoup A.. 2007. Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24: 621–631. [DOI] [PubMed] [Google Scholar]
- Coutinho, I. D. , Coelho R. G., Kataoka V. M. F., Honda N. K., Silva J. R. M., Vilegas W., and Cardoso C. A. L.. 2008. Determination of phenolic compounds and evaluation of antioxidant capacity of Campomanesia adamantium leaves. Eclética Química 33: 53–60. [Google Scholar]
- Creste, S. , Neto A. T., and Figueira A.. 2001. Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Molecular Biology Reporter 19: 299–306. [Google Scholar]
- Crispim, B. D. A. , Bajay M. M., Vasconcelos A. A., Deo T. G., Braga R. D. S., Telles M. P. C., Vieira M. D. C., et al. 2018. Relationship between genetic variability and land use and land cover in populations of Campomanesia adamantium (Myrtaceae). Diversity 10: 106. [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Fagundes, B. S. , Silva L. F., Giacomin R. M., Secco D., Díaz‐Cruz J. Á., and Da‐Silva P. R.. 2016. Transferability of microsatellite markers among Myrtaceae species and their use to obtain population genetics data to help the conservation of the Brazilian Atlantic Forest. Tropical Conservation Scientific 9: 408–422. [Google Scholar]
- Haq, S. U. , Jain R., Sharma M., Kachhwaha S., and Kothari S. L.. 2014. Identification and characterization of microsatellites in expressed sequence tags and their cross transferability in different plants. International Journal of Genomics 2014: 863948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hardt, E. , Pereira‐Silva E. F. L., Zakia M. J. B., and Lima W. P.. 2006. Restoration plantings of riparian forests in sand mines of the Corumbataí River Basin: collect in the recovery of biodiversity. Scientia Forestalis 70: 107–123 (in Portuguese). [Google Scholar]
- Hedrick, P. 2005. A standardized genetic differentiation measure. Evolution 59: 1633–1638. [PubMed] [Google Scholar]
- Kamvar, Z. N. , Tabima J. F., and Grunwald N. J.. 2014. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2: e281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Keenan, K. , McGinnity P., Cross T. F., Crozier W. W., and Prodöhl P. A.. 2013. diveRsity: An R package for the estimation and exploration of population genetics parameters and their associated errors. Methods in Ecology and Evolution 4: 782–788. [Google Scholar]
- Klink, C. A. , and Machado R. B.. 2005. Conservation of the Brazilian Cerrado. Conservation Biology 19: 707–713. [Google Scholar]
- Miranda, E. A. G. C. , Boaventura‐Novaes C. R. D., Braga R. S., Reis E. F., Pinto J. F. N., and Telles M. P. C.. 2016. Validation of EST‐derived microsatellite markers for two Cerrado‐endemic Campomanesia (Myrtaceae) species. Genetics and Molecular Research 15: gmr.15017658. [DOI] [PubMed] [Google Scholar]
- Nucci, M. , and Alves‐Junior V. V.. 2017. Biologia floral e sistema reprodutivo de Campomanesia adamantium (Cambess) O. Berg‐Myrtaceae em área de cerrado no Sul do Mato Grosso do Sul, Brasil. Interciência 42: 127–131. [Google Scholar]
- Pascoal, A. C. R. F. , Ehrenfried C. A., Lopez B. G. C., Araujo T. M., Pascoal V. D. B., Gilioli R., Anhê G. F., et al. 2014. Antiproliferative activity and induction of apoptosis in PC‐3 cells by the chalcone cardamonin from Campomanesia adamantium (Myrtaceae) in a bioactivity‐guided study. Molecules 19: 1843–1855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pavan, F. R. , Leite C. Q. F., Coelho R. G., Coutinho I. D., Honda N. K., Cardoso C. A. L., Vilegas W., et al. 2009. Evaluation of anti‐Mycobacterium tuberculosis activity of Campomanesia adamantium (Myrtaceae). Química Nova 32: 1222–1226. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Queirós, J. , Godinho R., Lopes S., Gortazar C., Fuente J., and Alves P. C.. 2015. Effect of microsatellite selection on individual and population genetic inferences: An empirical study using cross‐specific and species‐specific amplifications. Molecular Ecology Resources 15: 747–760. [DOI] [PubMed] [Google Scholar]
- R Core Team . 2018. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria: Website http://www.R-project.org/ [accessed 23 August 2019]. [Google Scholar]
- Resende, H. C. , and Teixeira T. A.. 2015. Diversidade genética em Campomanesia (Myrtacea) estimada por análise multivariada de características fenotípicas. Ceres 56: 85–92. [Google Scholar]
- Untergasser, A. , Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., and Rozen S. G.. 2012. Primer3–new capabilities and interfaces. Nucleic Acids Research 40: e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P. F.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.