Skip to main content
NCBI home page
EPA Author Manuscripts logoLink to EPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Aug 1.
Published in final edited form as: Chemosphere. 2019 Apr 27;228:676–684. doi: 10.1016/j.chemosphere.2019.04.151

Adsorption and degradation in the removal of nonylphenol from water by cells immobilized on biochar

Liping Lou a,b,*, Huang Qian a,c, Yiling Lou a, Jingrang Lu d, Baolan Hu a, Qi Lin a,b,*
PMCID: PMC6771920  NIHMSID: NIHMS1530673  PMID: 31063914

Abstract

To investigate the role of adsorption by biochar and biodegradation by bacteria in the wastewater treatment system of microorganisms immobilized on biochar, Nonylphenol (NP) removal (adsorption + degradation) rates and degradation rates from water by NP degrading bacteria immobilized on bamboo charcoal (BC) and wood charcoal (WC) were examined in a short-term and long-term. Results showed that cells immobilized on different biochar had different NP removal effects, and cells immobilized on bamboo charcoal (I-BC) was better. After eight rounds of long-term reuse, the cumulative removal rate and the degradation rate of NP in water by I-BC were 93.95% and 41.86%, respectively, significantly higher than those of cells immobilized on wood charcoal (69.60%, 22.78%) and free cells (64.79%, 19.49%) (P < 0.01). The rise in the ratio of the degradation rate to the removal rate indicated that the long-term NP removal effect is more dependent on biodegradation. The amount of residual NP in I-BC still accounted for about 50%, indicating that the secondary pollution in the disposal of carrier could not be ignored. In addition, promotion effect of biochar on microorganisms were observed by SEM, quantitative PCR and 16S rRNA. Pseudomonas, Achromobacter, Ochrobactrum and Stenotrophomonaswere predominant bacteria for NP degradation. The addition of biochar (especially bamboo charcoal) also effectively delayed the transformation of their community structure.

Keywords: biochar, immobilization, adsorption, degradation, microbial community

Graphical Abstract

graphic file with name nihms-1530673-f0001.jpg

1. Introduction

Biodegradation is one of the most effective and environmentally friendly methods of persistent organic pollutants removal from wastewater (Bai et al., 2017). However, biodegradation is often limited by cell growth, cell separation, substrate inhibition and sensitivity to environmental factors such as the fluctuation of influent quality and constituent concentration (Chen et al., 2016; Gao et al., 2011; Lin et al., 2014; Zhuang et al., 2015). To address these problems, cell immobilization can be applied to microbial treatment, by which microorganisms are circumscribed to a certain spatial region, thus maintain biological activity and a higher multiplying rate (Karel et al., 1985). Furthermore, immobilization provides higher cell density, better reusability and stronger resistance to poison compounds (Mollaei et al., 2010; Zur et al., 2016).

Key to immobilization technology are support materials, which play a crucial role in the function of microorganisms (Kumar etal., 2016). Suitable support materials should be characterized by low toxicity to cells, high mechanical strength and chemical stability, good mass transfer performance (Chen et al., 2012; Pino et al., 2016). Since activated carbon was first corroborated to be beneficial to microbial growth in 1967 (Parkhurst et al., 1967), carbonaceous materials have been frequently used as immobilized carriers for the degradation of organic pollutants. Among them, biochar has attracted much attention due to its cost-effectiveness, various sources and good physical and chemical properties (Liu et al., 2012; Xiong et al., 2017), such as large specific surface area and high porosity, which provide a valuable habitat for bacteria and increase cell concentration and the removal efficiency of pollutants.

Biochar has been used as a carrier to inoculate microorganisms for immobilization and applied to waste water treatment in recent years (Chen et al., 2013; Du et al., 2016; He et al., 2017). Frankel et al. (2016) immobilized bacteria on softwood barkcharcoal to remove naphthenic acids and found that the removal rate of the combined biofilm-biochar reached 87%, while that of the sterile biochar stood at 30%. Zhuang et al. (2015) also observed that immobilized cells had better quinolineremoval ability under different quinoline concentrations (100–400 mg/L), pH (5–10) and temperature (20–45 °C) compared with free cells. Most studies have focused on the removal rate of pollutants in water, so analyzed pollutants in water and immobilized on biochar as a whole. Little has been known, however, about the role of biochar adsorption and microbial degradation. It is very important to identify this role for following reasons. Firstly, it is related to the constant pollutant removal efficiency. It could be demonstrated that the technology has a long-term effect if cells immobilized on biochar still have great efficiency after adsorption is saturated. Secondly, it is related to the follow-up recovery and regeneration of carriers. After long-term operation, part of contaminants would be enriched in biochar due to its adsorption. Clarifying the quantity of remaining pollutants in biochar was conducive to avoiding secondary pollution and guiding the recovery of biochar. Therefore, it is essential to examine the amount of adsorption and degradation and clarify the fate of pollutants in the bacteria-biochar system.

In this study, Nonylphenol (NP), an environmental pollutant with estrogenic activity, which persisted in the sewage sludge in waste water treatment plants, was chosen as the target contaminant while bamboo charcoal (BC) and wood charcoal (WC), which have different physicochemical properties, were selected as carriers for cell immobilization. The adsorption and biodegradation of different treatments (cells immobilized on biochar, biochar only and free cells) were analyzed by measuring the NP concentration of the aqueous phase and the solid phase in the system. To explore the reusability of immobilized cells, the total amount allocation of NP (effluent + residue + biodegradation) by different system was compared through the short-term test and long-term reuse. Moreover, the effects of immobilization on microbial community structure were also investigated with quantitative PCR and 16SrRNA gene high-throughput sequencing. The aim of this paper is to investigate the influence of biochar properties on its adsorption capacities, immobilization and degradation efficiency of microbe, and to examine the role of follow-up treatment of carriers by mass balance calculation of pollutant.

2. Materials and methods

2.1. Chemicals and bacterial cultures

Nonylphenol (>99% purity) was acquired from Aladdin (China). Acetonitrile, methanol and toluene (all HPLC-spectro grade) were purchased from Sigma-Aldrich (USA). All the other chemicals were of analytical grade and were obtained from local suppliers.

The degrading bacteria used in this experiment were enriched from sediments in the Hangzhou section of Qiantang River using NP as the sole carbon source, which can effectively degrade NP (Lou et al., 2015). The degrading bacteria were activated by 24-h incubation at 30 °C on a shaker rotating at 150 rpm in MSM with 50 mg/L NP adjusted to a pH value of 7.0 using 2 M NaOH. Following incubation, 100 μL activated culture was transferred into a 250 mL beef extract peptone medium and grown in the same condition until the logarithmic phase of growth. After growth, bacterial suspensions were centrifuged at 8000 rpm for 10 min. Cell pellets were collected and resuspended three times with sterilized 0.85% NaCl solution. Bacterial pellets were then harvested in MSM when the absorbance at 600 nm (read using a UV-2100 spectrophotometer) reached a value of 1.00 ± 0.02.

2.2. Biochar preparation and characterization

Bamboo charcoal (BC) and wood charcoal (WC) were used in this experiment, the former made from bamboo sawdust by pyrolysis at 500 °C for 8 h in a muffle furnaceunder limited oxygen conditions, and the latter purchased from Jiangsu Huangfeng Biology Co., Ltd. (China). The biochar had been air-dried, ground and sieved to the diameter of 0.6–0.85 mm before use. The surface area and pore distribution of biochar were measured by N2 sorption analysis in an automatic surface area and pore analyzer (TristarⅡ3020, Micromeritica Instrument Corporation, USA). Previous experiments about adsorption isotherms of NP fitted with the Langmuir model showed that Qmax was 52,903.07 and 2814.23 mg/kg for BC and WC. Biochar characteristics are presented in Table 1.

Table 1.

Physicochemical properties of biochar

Kinds Major elemental content (%)
 Surface area (m2/g) Pore size (nm) Pore volume (m3/g)
 Qmax (mg/kg)
C H N O Ash Average Mesopore Micropore
BC 56.05 1.32 0.23 2.62 39.78 247.33 0.21 3.33 0.13 0.06 52903.07
WC 70.04 3.91 0.44 22.43 3.18 1.39 0.00 5.97 0.00 - 2814.23
Open in a new tab

2.3. Immobilization of microbes on biochar

To immobilize the degrading bacteria on biochar, about 0.05 g biochar was firstly added to 50 mL glass centrifuge tubes and sterilized at 121 °C for 20 min. Cell suspension was added to the tubes after they had cooled off, with each tube receiving 3 mL of condensed cell suspension (OD = 1). Subsequently, the mixture of cell suspension and biochar was incubated on a rotary shaker at 30 °C, 150 rpm for 24 h (the time determined by previous experiments) till cells were adsorbed onto the surface and pores of biochar, thereby forming an immobilized biofilm. The mixture was separated and rinsed gently with deionized water three times to remove the free cells.

2.4. Biodegradation of NP

2.4.1. Short-term removal of NP

Five treatments were performed in the NP removal experiment conducted in 50 mL glass tubes: (I) cells immobilized on bamboo charcoal (I-BC), 0.05 g sterile bamboo charcoal inoculated with 3 mL of cell suspensions; (II) cells immobilized on wood charcoal (I-WC), 0.05 g sterile wood charcoal inoculated with 3 mL of cell suspension; (III) free cells (F), 3 mL of cell suspensions; (IV) 0.05 g sterile bamboo charcoal only (BC); (V) 0.05 g sterile wood charcoal only (WC). All glass tubes were supplemented with MSM solutions to obtain a final volume of 10 mL, with the initial concentration of NP being 50 mg/L. Then samples were prepared in triplicate and placed on a rotary shaker with a constant agitating rate of 150 rpm in the dark at 30 °C. Samples were withdrawn at 0, 1, 2, 3, 5, 8 days and centrifuged at 3000 rpm for 10 min to separate the aqueous and solid phases.

2.4.2. Long-term reuse of NP

To explore the reusability of immobilized cells, five treatments above were repeatedly used in eight cycles of the consecutive nonylphenol removal biodegradation process. In the first round, immobilized cells (I-BC, I-WC), biochar only (BC, WC) and free cells (F) were prepared in glass tubes in triplicate and incubated into a medium containing nonylphenol 50 mg/L for 3 d. After the first test, tubes were taken from the shaker and centrifuged at 4000 g for 10 min to separate the aqueous and solid phases (Immobilized cells/free cells). Immobilized cells/free cells were washed three times with deionized water, and then reused to test the NP removal efficiency in the fresh medium immediately under the same conditions as performed in the first round. The same operations above were performed for eight times.

In the eight rounds of reuse, the fate of NP in the treatments with bacteria could be defined as the following three ways: (1) Effluent: the NP in the aqueous phase, which remained in water; (2) Residue: the NP in the solid phase fixed by the adsorption of biochar and bacteria, which has been removed from aqueous phase, but still existed in the system; (3) Degradation: the NP biodegraded by free and immobilized cells, which has disappeared completely from the system.

2.4.3. Analysis of NP concentration

The concentration of NP in the aqueous phase and solid phase were analyzed by high performance liquid chromatography (Agilent 1100 series) using the previously reported method (Lou et al., 2014, 2015). The recovery rates of NP adsorbed on sterile WC and BC system were both above 85% (Lou et al., 2015; Wang et al., 2018), which means the data of residue NP in the biodegradation experiment (include the aqueous phase and the solid phase) is valid.

2.5. DNA extraction, qPCR analysis and 16S rRNA gene high-throughput sequencing

In order to explore the microbial quantity and community structure, DNA was extracted from samples in first, fifth and eighth rounds using Fast DNA SPIN kit for soil (MP Biomedicals, USA) in accordance with the instructions on the manual. Before pyrosequencing, the purity and integrity of extracted genomic DNA was evaluated after extraction by 1% agarose gel electrophoresis and then stored at −20 °C until qPCR. Quantitative PCR amplification was carried out in triplicate using forward primer 338F (ACTCCTACGGGAGGCAGCAG) and reverse primer 518R (ATTACCGCGGC TGCTGG) (Wang et al., 2015b). ABI Stepone plus (ABI, USA) in a total reaction volume of 20 μL consisting of 10 μLx2 SybrGreen qPCR Master Mix, 7.2 μL ddH2O, 0.4 μL of each primer (10 μM), and 2 μL of DNA template. For the amplification of PCR, the following steps were taken: 3 min at 95 °C, 15 s at 95 °C, then 45 cycles of denaturing at 57 °C, annealing at 72 °C for 30 s. Bacterial 16S rRNA (V3-V4 region) was amplified with universal primers 341F/805R. Illumina Miseq 2000 was used for conducting high throughput sequencing of PCR products and was performed by Shanghai Majorbio (China) (http://www.majorbio.com/).

2.6. SEM observation

To investigate the morphologies of biochar and immobilized cells, a SEM (Scanning Electron Microscope) observation was conducted. Samples were prepared by chemical fixation and critical-point drying (CPD) (Chen et al., 2016). Briefly, samples were firstly fixed in the glutaraldehyde at 4 °C for one night, and washed by 0.1 M phosphate buffers (PBS, pH 7.2) three times for 15 min. Then they were fixed with 1% osmium tetroxide solution for 1–2 h and washed with PBS again. Afterwards, dehydration was carried out in a series of gradually increasing ethanolconcentrations (30%, 50%, 70%, 80%, 90% and 100%), each for 15 min. The samples were dried to the critical-point with carbon dioxide and then they were coated with gold powder and attached onto the microscope supports with silver glue. SEM photographs were taken at 25.0 kV using a scanning electron microscope (FEI SIRION-100, Netherlands).

2.7. Statistical analysis

Microsoft Excel 2016 and Origin Pro 2016 were used for data processing and charting respectively. T-test was used to analyzed statistically significant differences between pairwise sample data. All statistical analyses were performed using SPSS Statistics (Version 23, IBM, NY, USA). Differences were considered significant at p < 0.05. Principal coordinate analysis (PCoA) was performed based on different treatments and reuse rounds using R language with vegan package. Based on the mass balance calculation, and measurements of the NP concentrations in the aqueous and solid phases (adsorbed by biochars and/or microorganisms), the amount of biodegraded NP was calculated following the formula: the quantity of NP biodegraded = the quantity of NP initially added - the quantity of NP in the aqueous phase - the quantity of NP in the solid phase. First-order kinetic models were used to fit the degradation data.

3. Results and discussion

3.1. Short-term removal efficiency of NP by free and immobilized cells

Fig. 1 shows the NP concentration of the aqueous phase (Fig. 1-a), the solid phase(Fig. 1-b) and the total system (Fig. 1-c) for each treatment. The NP concentration of the total system is the sum of the NP concentrations of the aqueous and the solid phases. Up to 40% of the NP was concentrated in the solid phase, while only less than 10% of the NP was in the aqueous phase. For the later, the initial concentration of each treatment (day 0) was approximately 5–6 mg/L. After day 1, the concentrations of NP in I-BC and BC decreased to none detectible, while those in I-WC and WC were still detectible. At the end of the reaction, the concentrations of NP in F and I-WC tended to increase.

Fig. 1.

Fig. 1

Open in a new tab

Degradation of NP by different treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), (III) free cells (F), (IV) 0.05g sterile bamboo charcoal only (BC), and (V) 0.05 g sterile wood charcoal only (WC) to show NP concentrations in aqueous phase (a), solid phase (b) and total system (c) for each treatment

The solid phase is the form adsorbed by biochar and/or microorganisms (biosorption) (Gadd, 2009; Shukla et al., 2017). The trend of NP concentration in the solid phase (Fig. 1-b) was similar to that in the total system (Fig. 1-c) in each treatment. In Fig. 1-c, there was a clear decreasing trend in NP concentration by using free and immobilized cells. After 8 days of reaction, I-BC had the highest NP degradation rate, reaching 69.50%, followed by F and I-WC, which stood at 43.27% and 37.50% respectively. I-BC had superior NP degradation efficiency to F, while I-WC had inferior degradation efficiency to F, indicating that there was difference in terms of the removal of pollutants by immobilized cells compared with free cells.

The impacts of the adsorption properties of BC and WC on NP biodegradation were probably the main cause of the NP concentrations in different treatments. Biochar had a fast adsorption effect on NP until adsorption equilibrium after 16 h. According to Table 1, the Qmax of NP for BC and WC were 52903.067 mg/kg and 2814.255 mg/kg, respectively, indicating that 0.05 g BC and WC could adsorb up to 2.645 mg and 0.141 mg NP, thus, the amount of added NP was less than the adsorption capacity of NP to BC, but it exceeded the adsorption capacity of WC. The difference of degradation efficiency between I-BC and I-WC could be attributed to the property of biochar. As a carrier, the physicochemical properties (such as surface area and pore volume) had a notable impact on the biodegradation ability of immobilized cells by affecting the adsorption and fixation of microorganisms (Cheng et al., 2017). In addition, the concentrations of NP in WC and BC, in which the NP recovery rates were higher than 85%, remained stable within 8 days, and the concentrations of NP in WC (46 mg/L) was slightly higher than those in BC (41–44 mg/L) (Fig. 1-b). The differences of NP recovery rates between WC and BC in the solid phase was caused by the surface structure discrepancy between them. BC had a larger specific surface areas and high porosity, which facilitate BC to perform higher adsorption irreversibility to NP, than WC. Nevertheless, the bacterial cells and extracellular polymers (EPS) might also contribute the increase of soluble NP in water (Hong et al., 2015).

3.2. Long-term reuse of NP by free and immobilized cells

In order to investigate the reusability of immobilized cells, a long-term reuseexperiment on various treatments was conducted, and the results of eight rounds are presented in Fig. 2. With the increasing number of rounds, the aqueous phase NP concentrations trended to increase in all the treatments, of which those in F and I-WC were significantly higher than the other treatments (Fig. 2-a). Furthermore, in each round of reuse, the aqueous phase NP concentrations in F in the later stage of reaction (d3) was significantly higher than those in the initial stage (d0). There were two possible explanations for this result: (1) free cells were dispersed in the solution discretely after long-term cultivation, leading to a high NP concentration in the aqueous phase, and (2) extracellular polymers (EPS) generated with the proliferation of microorganisms increased the solubility of NP in water (Hong et al., 2015). The aqueous phase NP concentrations in I-WC showed a similar trend to those in F, except for the low concentrations in the first round. This consistency may be ascribed to the weak adsorption capacity in WC, which limits the immobilization of microorganisms. However, the aqueous phase NP concentration remained approximately 5 mg/L. Together with Fig. 2-b and Fig. 2-c, the NP concentrations in WC showed little variations with the steady NP concentrations. Thus, it was considered that the adsorption of NP to WC was in saturation status in the first round of utilization. Subsequently, in the WC system, WC was supersaturated with NP, and the NP floated in water as liquid oil drops or spread on the surface of WC, or attached to the pipe wall.

Fig. 2.

Fig. 2

Open in a new tab

The NP concentrations of reuse rounds in effluent, residue and the whole system by different treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), (III) free cells (F), (IV) 0.05g sterile bamboo charcoal only (BC), and (V) 0.05 g sterile wood charcoal only (WC) to show NP reusability in aqueous phase (a), solid phase (b) and total system (c) for each treatment

Unlike in I-WC and WC, the aqueous phase NP concentrations in I-BC and BC sharply decreased to undetectable in the first three rounds in which the adsorption capacity in BC probably played a crucial role. After the three rounds, the aqueous phase NP concentrations in BC rose gradually, and increased to 1.42 mg/L and 4.26 mg/L in the fourth and fifth rounds, respectively, while those in I-BC remained unchanged until the sixth round. This difference between BC and I-BC could be attributed to the continuous degradation of NP adsorbed on BC by immobilized cells. Our previous studies found that NP could be degraded rapidly not only in the free state but also in the adsorption state after biofilm was formed (Cheng et al., 2017). The degradation process released some adsorption sites, allowing the remaining NP to be absorbed, which could be defined as “adsorption regeneration”. Hence, the immobilization of microorganisms on biochar could not only improve the degradation of degrading bacteria, but also increase the adsorption capacity of biochar (Li et al., 2015).

Fig. 2-b and Fig. 2-c revealed that there has been an equally steady increase in the concentration of NP in the solid phase and the whole system. The reason why the concentration of NP in the system showed a gradual upward trend was that the solid phase containing biochar and bacteria would constantly adsorb the NP in the new round of reuse. A decline of NP concentration was seen in I-BC, I-WC and F in each round of experiment, because of the presence of degrading bacteria. Fig. 2-b showed that the solid phase NP concentration in I-BC remained the highest among the three treatments because a small amount of NP was removed with the aqueous phase due to the low aqueous phase NP concentration in I-BC, especially in the first five rounds (Fig. 2-a), resulting in the majority of undegraded NP being continuously accumulated in carriers as the number of rounds increased. In the same way, the solid phase NP concentration in I-WC was higher than that in F. In addition, the solid phase NP concentration in these three treatments were significantly lower than that in the treatments with biochar only (BC, WC), which lacked biodegradation.

3.3. The fate of NP in the system

Fig. 3 showed a comparison of the total amount allocation of NP among I-BC, I-WC and F by calculating data as presented in Fig. 2. The amounts of NP rose gradually during eight rounds of reuse, regardless of those in effluent, residue or degradation. The removed NP consisted of residual NP and degraded NP. After eight rounds of reuse, the amounts of NP in the effluent in I-BC was only 0.24 mg and the removal efficiency reached to 93.95%, which was much higher than those in I-WC (69.60%) and in F (64.79%). This was principally due to the lowest proportion of NP in the effluent in I-BC, in which the NP was as low as undetectable in the first five rounds. The amounts of NP in the residual in I-BC, I-WC and F were 2.04 mg, 1.98 mg and 1.80 mg, respectively, accounting for approximately 50.00% of the total NP, which resulted primarily from the adsorption of biochar and bacteria. To avoid secondary pollution, the subsequent recovery of biochar carriers was very essential. The amounts of NP eventually degraded in I-BC (1.67 mg) was much higher than those in I-WC (0.91 mg) and F (0.81 mg) in each round and the cumulative degradation rates were 41.86%, 22.78%, 20.41%, respectively. The NP degradation rate for each round in the reused experiment was further calculated and demonstrated that the rate in I-BC maintained a high rate of degradation. There was a slight fall in the single-round degradation rate of NP with the increasing number of rounds. The single-round NP degradation rate in I-BC, I-WC and F decreased from 45.00%, 25.57% and 29.87% in the first round to 43.39%, 19.71% and 19.49% in the eighth round, respectively. Thus, it can be concluded that the order of NP amounts was F > I-WC > I-BC in the effluent fraction and I-BC > I-WC > F in the residual and degradation fractions. Considering that only the degraded NP was actually removed from the environment, attention should be paid more on I-BC than on F and I-WC.

Fig. 3.

Fig. 3

Open in a new tab

The total amount allocation of NP by different treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), and (III) free cells (F)

In conventional water treatment process, the removal rates of contaminants are determined by their concentration in the aqueous solution. In this experiment, the removal rate of NP by cells immobilized on bamboo charcoal was still up to 93.95% after eight rounds of reuse (Fig. 3), which was similar to many previous studies (He et al., 2017; Qiao et al., 2010; Zhuang et al., 2015). However, this NP degradation rate was far from enough, because the removed NP derived from the adsorption part by biochar and the degradation part by microorganisms, with the former accounting for nearly 50% even only in the I-BC group which had the highest NP removal rate. The amount of NP adsorbed in the carbon carrier could not be ignored and much more attentions should be paid to avoid secondary pollution. At present, NP in waste water treatment plants is removed by the adsorption of sludge and bacterial biodegradation, so the concentrations of NP in the sludge are as high as 172.35 mg/kg SS (Hao et al., 2007). If microbial immobilization is used, the concentrations of NP in sludge will decrease. It is easier to treat biochar than sludge in that the amounts of biochar are far less than those of sludge.

3.4. SEM imaging of biochar and immobilized cells

Fig. 1S exhibited the SEM images of biochar before and after immobilization. Both kinds of biochar had large internal surface and open porous structures, and the macropore size ranged from tens of nanometers up to tens of microns. Compared to WC, BC showed denser and irregular arrangement pores, folds and rough surfaces, suggesting a good matrix for cell adhesion. Those attachments on BC might be the secretions of bamboo or the residues generated during the carbonization process.

A large number of bacterial cells were anchored onto the surface and internal pores of the biochar as shown in Fig. 1S. The phenomenon was similar to an earlier observation made by Liu et al. (2012). Compared to I-WC, cells immobilized on bamboo charcoal (I-BC) were dense, unevenly distributed, and dominantly rod-shaped, covering most of the pores of bamboo charcoal. The numbers of cells immobilized on wood charcoal were significantly less than those on bamboo charcoal. This might be closely related to the physicochemical properties of two types of biochar. The mesopore volume (0.13 m3/g) suitable for the microbial growthon bamboo charcoal was over a hundred times as large as that on wood charcoal (0.002 m3/g). Smaller-size and faster-growing cells were more suitable for immobilization in the pores of biochar. When the diameter of biochar was larger than that of microorganisms, microorganisms might enter the pores and utilize the nutrients therein (Pietikainen et al., 2000).

3.5. Effect of immobilization on microbial quantity

To observe the change of microbial biomass, samples of the first, fifth, and eighth rounds were taken for DNA extraction and quantitative PCR. Fig. 4 showed the changes of the NP degradation rate and microbial biomass in I-BC, I-WC and F systems in the first, fifth and eighth rounds. The overall microbial biomass showed a downward trend, and the amount of microbial biomass in I-BC was much higher than that in the other two treatments. Correlation analysis between the degradation rate and microbial biomass of each treatment was conducted and the results displayed that they had a significant correlation with each other (P < 0.01).

Fig. 4.

Fig. 4

Open in a new tab

The degradation rates (a) and microbial quantity (b) of NP in the treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), and (III) free cells (F)

3.6. Effect of immobilization on the microbial community

In order to investigate the effect of immobilization on the structure of the microbial community during the reaction, high-throughput 16S rRNA sequencing was performed. There were 559,385 high-quality microbial gene sequences in total from all 9 samples. The average read length was 461 bp. Sequence numbers per sample ranged from 52,083 to 69,044 with a coverage rate of nearly 99%, which could basically reflect the species and community structure of each sample.

The histogram representing dominating genus in I-BC, I-WC and F was shown in Fig. 5. Pseudomonas, Achromobacter, Ochrobactrum and Stenotrophomonas were dominant genera with over 85% relative abundance in total, and all of them had been reported to degrade NP (Wang et al., 2015a). Among them, Pseudomonas was one of the most common NP-degrading bacteria, which had high biodegradabilityto NP and was widely distributed in soil, sediment and seawater.

Fig. 5.

Fig. 5

Open in a new tab

Microbial community structure (genus level) in round 1 (1-), 5 (5-) and 8 (8-) by three treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), and (III) free cells (F)

In the first round, the relative abundance of Pseudomonas in I-BC, I-WC and F reached 97.68%, 97.28% and 98.73% respectively, far exceeding the combined sum of all other species. Pseudomonas absolutely dominated in the microbial community indicated that the pre-enrichment culture formed a Pseudomonas-dominated degrading flora. As the number of rounds increased, the bacterial community structure in the three treatments also changed. In the fifth round, the relative abundance of Pseudomonas in I-BC, I-WC and F declined to 79.64%, 87.81% and 51.43% respectively, while that of Achromobacter/Ochrobactrum increased to 10.06%/6.89%, 1.9%/7.95% and 26.69%/9.45%, respectively. There has been a sharp fall in the abundance of Pseudomonas in F in the eighth round when Ochrobactrumbecame the predominant genus with a relative abundance of 51.89%. However, Pseudomonas remained the dominant bacteria in I-BC and I-WC with the relative abundance of 43.32% and 50.31%. One possible explanation for the reduction of the relative abundance of Pseudomonas might be the enhancement of the NP concentration in the system. It was reported that Pseudomonasis featured by better degradation efficiency on NP with a lower concentration (Chakraborty and Dutta, 2006). The relative abundance of Pseudomonas in I-BC and I-WC was significantly higher than that in F in the later period of the experiment, because the presence of biochar could play a protective role in the survival of Pseudomonas, maintaining a relatively stable microenvironment suitable for bacteria growth and reproduction. Yuan et al. (2004) found that the intermediate product resulting from the degradation of NP by Pseudomonas was 4-aminoacetophenone, indicating that the degradation of NP by Pseudomonas began with the disassociation of alkyl chains, which might produce octylphenol and pentylphenol (Xu et al., 2017). The increase of the relative abundance of Ochrobactrum, a genus that could degrade phenol as well, was probably related to the production of short-chain alkylphenol during degradation.

PCoA results (Fig. 6) showed that there was a significant difference in the microbial community structure among different rounds, whereas there was no significant difference among different treatments. This demonstrated that although the addition of biochar could not change the microbial community structure in the samples, it could effectively delay the transformation of the community structure to provide a better environment for microbial degradation for a long time.

Fig. 6.

Fig. 6

Open in a new tab

Principal coordinate analysis (PCoA) based on the data from three treatments: (I) cells immobilized on bamboo charcoal (I-BC), (II) cells immobilized on wood charcoal (I-WC), and (III) free cells (F) in 8 rounds of reuses

3.7. Advantages and disadvantages of free and immobilized cells

Based on the comprehensive analysis of the NP removal rate and the degradation rate in different treatments, the efficiency rate of NP in these five treatments was arranged as follows: I-BC>I-WC/F> BC > WC.

  1. For BC and WC, the removal of NP in water could only rely on the adsorption of biochar. BC had a larger specific surface area (247.33 m2/g) than WC (1.39 m2/g), due to its maximum NP adsorption capacity, which was about 20 times higher than that of WC. Nevertheless, it should be noticed that NP transferred from water to biochar was not removed fundamentally in the process of adsorption. Once the quantity of pollutants exceeded the maximum adsorption capacity of biochar, removal efficiency by adsorption would be greatly reduced.

  2. The NP removal by cells immobilized on biochar was a combination of the adsorption of biochar and the degradation of bacteria, thus, the immobilized cells on biochar performed better than only biochar or only free cells. The reason was that the NP that was adsorbed on the surface and inside of the carbon carrier and the degrading bacteria attached to the surface of the carbon carrier to degrade the NP with a shortened reaction time and increase degradation efficiency, in addition to degradation of the NP in the aqueous phase. Biochar could provide not only shelter but also nutrients for microorganisms to promote the formation of biofilms. Moreover, the presence of biochar could relieve the external interference with microorganisms (such as high concentrations of pollutants or degradation intermediates).

  3. Biochar with different types varied greatly in their physicochemical property, resulting in significant discrepancy in their adsorption capacity as well as the biodegradability of immobilized bacteria. Regardless of the NP removal rate or the degradation rate, the treatment efficiency of I-BC was significantly higher than those of I-WC and F. After eight rounds of reuse, the cumulative removal rate of NP of I-BC reached 93.95%, which was much higher than that in I-WC (69.60%) and F (64.79%). In addition, the NP degradation rate of I-BC was 41.86%, which was also higher than those of I-WC (22.78%) and F (19.49%).

  4. The NP removal by immobilized cells relied on the strong adsorption of biochar in the early stage of reaction, and then relied on the biodegradation of microorganisms in the latter stage of reaction. For example, in the first round, the removal rate of NP was 100% and the degradation rate of NP was 45.00%. While in the eighth round, the removal rate of NP was 75.01% and the degradation rate of NP was 43.39%. The ration of the degradation rate to the removal rate improved from 0.45 to 0.58, indicating that the long-term NP removal effect should be more dependent on biodegradation.

  5. After eight rounds of reuse, the amount of NP remaining in I-BC still accounted for nearly 50%, which might return to the environment and lead to secondary pollution, so the follow-up recovery issues are worth considering.

4. Conclusions

I-BC showed the best efficiency for treating wastewater polluted by NP in the removal rate and the degradation rate, which were both higher than those by the other treatments (P < 0.01). Bacteria immobilized on biochar performed dual functions of adsorption and biodegradation, while the biodegradation played greater role on the long-term removal of NP. To enhance NP removal efficiency, the remained NP in the carrier, which could probably cause secondary pollution, should be taken into consideration. Furthermore, Pseudomonas, Achromobacter, Ochrobactrumand Stenotrophomonas were the dominant bacteria for NP degradation. The addition of biochar (especially bamboo charcoal) could promote the growth of microorganisms and slow down the change of the dominant microflora for NP degradation.

Supplementary Material

Supplement1

Acknowledgments:

This work was financially supported by a grant from the National Natural ScienceFoundation of China (No. 41877463 and 21677123) and Natural Science Foundation of Zhejiang Province (No. LZ19D030001).

References

  1. Bai N, Abuduaini R, Wang S, Zhang M, Zhu X, Zhao Y, 2017. Nonylphenol biodegradation characterizations and bacterial composition analysis of an effective consortium NP-M2. ENVIRON POLLUT 220, 95–104. [DOI] [PubMed] [Google Scholar]
  2. Chakraborty J, Dutta TK, 2006. Isolation of a Pseudomonas sp. capable of utilizing 4-nonylphenol in the presence of phenol. J MICROBIOL BIOTECHN 16(11), 1740–1746. [Google Scholar]
  3. Chen B, Yuan M, Qian L, 2012. Enhanced bioremediation of PAH-contaminated soil by immobilized bacteria with plant residue and biochar as carriers. J SOIL SEDIMENT 12(9), 1350–1359. [Google Scholar]
  4. Chen D, Fang J, Shao Q, Ye J, Ouyang D, Chen J, 2013. Biodegradation of tetrahydrofuran by Pseudomonas oleovorans DT4 immobilized in calcium alginate beads impregnated with activated carbon fiber: Mass transfer effect and continuous treatment. BIORESOURCE TECHNOL 139, 87–93. [DOI] [PubMed] [Google Scholar]
  5. Chen J, Li S, Liang C, Xu Q, Li Y, Qin H, Fuhrmann JJ, 2017. Response of microbial community structure and function to short-term biochar amendment in an intensively managed bamboo (Phyllostachys praecox) plantation soil: Effect of particle size and addition rate. SCI TOTAL ENVIRON 574, 24–33. [DOI] [PubMed] [Google Scholar]
  6. Chen Y, Yu B, Lin J, Naidu R, Chen Z, 2016. Simultaneous adsorption and biodegradation (SAB) of diesel oil using immobilized Acinetobactervenetianus on porous material. CHEM ENG J 289, 463–470. [Google Scholar]
  7. Cheng G, Sun M, Ge X, Xu X, Lin Q, Lou L, 2017. Exploration of biodegradation mechanisms of black carbon-bound nonylphenol in black carbon-amended sediment. ENVIRON POLLUT 231(1), 752–760. [DOI] [PubMed] [Google Scholar]
  8. Du JT, Sun PF, Feng Z, Zhang X, Zhao YH, 2016. The biosorption capacity of biochar for 4-bromodiphengl ether: study of its kinetics, mechanism, and use as a carrier for immobilized bacteria. ENVIRON SCI POLLUT R 23(4), 3770–3780. [DOI] [PubMed] [Google Scholar]
  9. Frankel ML, Bhuiyan TI, Veksha A, Demeter MA, Layzell DB, Helleur RJ, Hill JM, Turner RJ, 2016. Removal and biodegradation of naphthenic acids by biochar and attached environmental biofilms in the presence of co-contaminating metals. BIORESOURCE TECHNOL 216, 352–361. [DOI] [PubMed] [Google Scholar]
  10. Gadd GM, 2009. Biosorption: critical review of scientific rationale, environmental importance and significance for pollution treatment. J CHEM TECHNOL BIOT 84,13–28. [Google Scholar]
  11. Gao QT, Wong YS, Tam NFY, 2011. Removal and biodegradation of nonylphenol by immobilized Chlorella vulgaris. BIORESOURCE TECHNOL 102(22), 10230–10238. [DOI] [PubMed] [Google Scholar]
  12. Hao RX, Liang P, Zhou YW, 2007. Study on translation and conversion behavior of Nonylphenol in municipal wastewater treatment. CHINA WATER & WASTEWATER 23(1), 105–109. [Google Scholar]
  13. He SY, Zhong LH, Duan JJ, Feng YF, Yang B, Yang LZ, 2017. Bioremediation of Wastewater by Iron Oxide-Biochar Nanocomposites Loaded with Photosynthetic Bacteria. FRONT MICROBIOL 8(823). [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hong C, Si Y, Xing Y, Wang Z, Qiao Q, Liu M, 2015. Effect of surfactant on bound water content and extracellular polymers substances distribution in sludge. RSC ADV 5(30), 23383–23390. [Google Scholar]
  15. Karel SF, Libicki SB, Robertson CR, 1985. The immobilization of whole cells-engineering principles. CHEM ENG SCI 40(8), 1321–1354. [Google Scholar]
  16. Kumar G, Mudhoo A, Sivagurunathan P, Nagarajan D, Ghimire A, Lay C, Lin C, Lee D, Chang J, 2016. Recent insights into the cell immobilization technology applied for dark fermentative hydrogen production. BIORESOURCE TECHNOL 219, 725–737. [DOI] [PubMed] [Google Scholar]
  17. Li L, Chen X, Wu D, Wang AL, Yang LY, 2015. Adsorption of Aqueous Nitrate-N by Immobilized Modified Biochar. JOURNAL OF AGRO-ENVIRONMENT SCIENCE 34, 137–143. [Google Scholar]
  18. Lin C, Gan L, Chen Z, Megharaj M, Naidu R, 2014. Biodegradation of naphthalene using a functional biomaterial based on immobilized Bacillus fusiformis (BFN). BIOCHEM ENG J 90, 1–7. [Google Scholar]
  19. Liu Y, Gan L, Chen ZL, Megharaj M, Naidu R, 2012. Removal of nitrate using Paracoccus sp. YF1 immobilized on bamboo carbon. J HAZARD MATER 229, 419–425. [DOI] [PubMed] [Google Scholar]
  20. Lou LP, Cheng GH, Deng JY, Sun MY, Chen HY, Yang Q, Xu XH, 2014. Mechanism of and relation between the sorption and desorption of nonylphenol on black carbon-inclusive sediment. ENVIRON POLLUT 190, 101–108. [DOI] [PubMed] [Google Scholar]
  21. Lou LP, Yao LD, Cheng GH, Wang LX, He YF, Hu BL, 2015. Application of Rice-Straw Biochar and Microorganisms in Nonylphenol Remediation: Adsorption-Biodegradation Coupling Relationship and Mechanism. PLOS ONE 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mollaei M, Abdollahpour S, Atashgahi S, Abbasi H, Masoomi H, Rad I, Lotfi AS, Zahiri HS, Vali H, Noghabi KA, 2010. Enhanced phenol degradation by Pseudomonas sp. SA01: Gaining insight into the novel single and hybrid immobilizations. J HAZARD MATER, 284–292. [DOI] [PubMed]
  23. Parkhurst JD, Dryden FD, Mcdermott GN, 1967. Pomona activated carbon pilot plant. Water Pollution Control Federation 10, 70–81. [PubMed] [Google Scholar]
  24. Pietikainen J, Kiikkila O, Fritze H, 2000. Charcoal as a habitat for microbes and its effect on the microbial community of the underlying humus. OIKOS 89, 231–242. [Google Scholar]
  25. Pino NJ, Munera LM, Penuela GA, 2016. Bioaugmentation with Immobilized Microorganisms to Enhance Phytoremediation of PCB-Contaminated Soil. SOIL SEDIMENT CONTAM 25, 419–430. [Google Scholar]
  26. Qiao L, Wen DH, Wang JL, 2010. Biodegradation of pyridine by Paracoccus sp. KT-5 immobilized on bamboo-based activated carbon. BIORESOURCE TECHNOL 101(14), 5229–5234. [DOI] [PubMed] [Google Scholar]
  27. Shukla A, Parmar P, Sarar M, 2017. Radiation, radionuclides and bacteria: An in-perspective review. J ENVIRON RADIOACTIV 180, 27–35. [DOI] [PubMed] [Google Scholar]
  28. Wang LX, Lou YL, Zhu H, Huang Q, Yao LD, Lou LP, Lin Q, 2018. Comparison of carbonized materials from wastes of different origin for nonylphenol removal by adsorption. WATER SCI TECHNOL 77, 1791–1801. [DOI] [PubMed] [Google Scholar]
  29. Wang X, Wang X, Liu M, Bu Y, Zhang J, Chen J, Zhao J, 2015. Adsorption-synergic biodegradation of diesel oil in synthetic seawater by acclimated strains immobilized on multifunctional materials. MAR POLLUT BULL 92, 195–200. [DOI] [PubMed] [Google Scholar]
  30. Wang Z, Yang Y, Sun W, Dai Y, Xie S, 2015. Variation of nonylphenol-degrading gene abundance and bacterial community structure in bioaugmented sediment microcosm. ENVIRON SCI POLLUT R 22, 2342–2349. [DOI] [PubMed] [Google Scholar]
  31. Xiong BJ, Zhang YC, Hou YW, Arp HPH, Reid BJ, Cai C, 2017. Enhanced biodegradation of PAHs in historically contaminated soil by M. gilvum inoculated biochar. CHEMOSPHERE 182, 316–324. [DOI] [PubMed] [Google Scholar]
  32. Xu CB, Dong WL, Dong X, Ren XF, Qi XY, Ma XP, 2017. Study on biodegradation characteristics of nonylphenol. ENVIRONMENTAL SCIENCE AND MANAGEMENT 42, 43–46. [Google Scholar]
  33. Yuan SY, Yu CH, Chang BV, 2004. Biodegradation of nonylphenol in river sediment. ENVIRON POLLUT 127(3), 425–430. [DOI] [PubMed] [Google Scholar]
  34. Zhuang HF, Han HJ, Xu P, Hou BL, Jia SY, Wang DX, Li K, 2015. Biodegradation of quinoline by Streptomyces sp N01 immobilized on bamboo carbon supported Fe3O4 nanoparticles. BIOCHEM ENG J 99, 44–47. [Google Scholar]
  35. Zur J, Wojcieszynska D, Guzik U, 2016. Metabolic Responses of Bacterial Cells to Immobilization. MOLECULES 21(958). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement1
NIHMS1530673-supplement-Supplement1.docx (2.5MB, docx)

RESOURCES