Skip to main content
NCBI home page
Cell Cycle logoLink to Cell Cycle
. 2019 Aug 12;18(20):2629–2640. doi: 10.1080/15384101.2019.1652472

High cGMP and low PDE3A activity are associated with oocyte meiotic incompetence

Eran Gershon a,*, Iris Maimon b,*, Dalia Galiani b, Michal Elbaz a, Sharon Karasenti a, Nava Dekel b,✉
PMCID: PMC6773239  PMID: 31401933

ABSTRACT

Resumption of meiosis in mammalian oocytes, defined as oocyte maturation, is stimulated by luteinizing hormone (LH). Fully grown oocytes can also mature spontaneously, upon their release from the ovarian follicle. However, growing oocytes fail to resume meiosis in vitro and the mechanism underlying their meiotic incompetence is unknown. It is commonly accepted that a drop in intraoocyte cyclic guanosine monophosphate (cGMP) resulting in the elevated activity of the oocyte-specific PDE3A leads to a decrease in cAMP content, essential for reinitiation of meiosis. We explored the regulation of these cyclic nucleotides and their degrading PDE3A in growing oocytes. Our research addressed the LH-induced rather than spontaneous oocyte maturation. We examined 16–21 as compared to 25-day-old, PMSG-primed rats, treated with the LH analog, hCG. The effect of LH was also examined ex vivo, in isolated ovarian follicles. We found that hCG failed to induce oocyte maturation and ovulation in the younger animals and that ovulation-associated genes were not upregulated in response to this gonadotropin. Furthemore, the drop of intraoocyte cGMP and cAMP observed in fully grown oocytes upon exposure of the ovary to LH, was not detected in growing oocytes. Interestingly, whereas the global expression of PDE3A in growing and fully grown oocytes is similar, a significantly lower activity of this enzyme was determined in growing oocytes. Our findings show that meiotic incompetence is associated with a relatively high oocyte cGMP concentration and a low activity of PDE3A, which in follicle-enclosed oocytes may represent the failure of the somatic follicle cells to respond to LH.

KEYWORDS: Meiotic incompetence, growing oocytes, cAMP, cGMP, PDE3A

Introduction

Meiosis in mammalian oocytes, which is initiated during embryonic life, proceeds up to the diplotene of the first prophase and is arrested at birth. Prophase-arrested oocytes are characterized by a nuclear structure known as “germinal vesicle” (GV). Upon reinitiation of meiosis, the nuclear membrane dissolves in a process referred to as GV breakdown (GVB), which is associated with chromosome condensation and the first metaphase (MI) spindle formation. Oocytes complete the first meiotic division by the emission of the first polar body (PBI), immediately followed the second metaphase (MII), a stage at which they are ready for fertilization. This course of events is therefore defined as oocyte maturation. It is only after sperm penetration that meiosis in oocytes is fully accomplished [1].

Oocyte maturation in mammals can also occur spontaneously upon the release of the oocytes from the ovarian follicle [2]. Nevertheless, Spontaneous maturation cannot be achieved in oocytes that are isolated from female mice, hamster and rats, younger than 15, 23 and 22 days, respectively [3,4]. Oocyte development is not synchronous and the ovary of older rodent females consists of a heterogeneous population. Nevertheless, the ability to resume meiosis spontaneously is limited to those oocytes that have reached their final size [3,5–9]. Thus, oocytes that are incompetent and competent to resume meiosis are referred to as growing and fully grown, respectively [3].

Previous studies suggested that insufficient amounts of cell cycle proteins might be responsible for meiotic incompetence [10–13]. These studies agree with earlier reports demonstrating that either fusion with or microinjection of cytoplasm from competent mouse oocytes induced GVB in incompetent oocytes [5,14]. Nevertheless, other studies showed that rat and pig oocytes do express comparable amounts of the cell cycle proteins [15–17], leaving the identity of the missing cytoplasmic components in incompetent oocytes unresolved. The intrinsic, yet unknown, changes in the oocyte may represent some autonomous differentiation program, as well as the effect of external stimuli such as follicle stimulating hormone (FSH) [6]. The effect of FSH is, at least in part, mediated by ovarian estradiol production [6]. The effect of other external factors, possibly supplied by the somatic follicle cells has been also suggested by a later study, demonstrating that incubation of incompetent oocytes with fibroblast-conditioned medium or dibutyryl-cyclic adenosine monophosphate (cAMP) promoted the resumption of meiosis [10].

Resumption of meiosis in fully grown oocytes is negatively regulated by cAMP [18,19]. The negative effect of cAMP on the resumption of meiosis in fully grown oocytes is mediated by the cAMP-dependent protein kinase A (PKA) [20,21]. A role for PKA in regulating meiotic arrest has been also demonstrated in growing oocytes [22,23]. It has been proposed that cAMP produced in the follicular granulosa/cumulus cells is transferred to the oocyte via gap junctions [24,25]. This hypothesis further suggests that luteinizing hormone (LH)-induced oocyte maturation is subsequent to interruption of gap junctional communication, which has been shown to occur in the ovarian follicle in response to this gonadotropin [25–28]. According to this hypothesis, the release of the oocyte from the ovarian follicle, which results in its spontaneous maturation, actually mimics the effect of LH, as it terminates the supply of the follicle somatic inhibitory cAMP to the oocyte. This theory is strongly supported by the demonstration of cAMP transport from granulosa cells into the oocyte through gap junctions, which is subjected to negative regulation by gonadotropins [29]. Later studies suggested that gap junctional communication between the somatic cells and the oocyte is also employed for the transfer of cyclic guanosine monophosphate (cGMP) [30]. This cyclic nucleotide known as a negative regulator of phosphodiesterases [31], is constitutively generated in the granulosa/cumulus cells by the C-type natriuretic peptide (CNP) and its guanylyl cyclase receptor NPR2 [32–35]. The combined transfer of these two nucleotides into the oocyte effectively maintains meiotic arrest. Alternatively, cessation of their supply, either mechanically or in response to LH, acts as a highly efficient mechanism for stimulation of oocyte maturation [25–28,32]. The efficiency of this control mechanism is further increased by an LH-stimulated decrease in the ovarian cGMP. This effect of LH is mediated by the CNP and NPR2 [32–35].

Despite the large body of knowledge presently accumulated about the external and intraoocyte factors involved in the regulation of the meiotic status of the oocyte, the mechanism responsible for the acquisition of meiotic competence remains largely unknown. Furthermore, all previous attempts to explore the mechanism underlying meiotic incompetence were conducted on oocytes isolated from the ovarian follicles, which resume meiosis spontaneously. Our present research addressed the LH-induced, rather than spontaneous oocyte maturation. In this study, we show that meiotic incompetence of follicle-enclosed oocytes is primarily associated with a low activity of phosphodiesterase 3A (PDE3A), which may represent the failure of the somatic follicle cells to respond to LH.

Materials & methods

Animals

Wistar female rats were purchased from Harlan laboratories (Harlan, Rehovot, Israel) and treated in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, National Academy of Science). The Weizmann Institutional Animal Care and Use Committee (IACUC) approved the use of those animals specifically for this study.

Monitoring ovulation

Female rats, at ages ranging between 16 and 25 days, were injected with the FSH analog, pregnant mare serum gonadotropin (PMSG; 5IU, Chrono-gest Intervest, Amsterdam, Netherland). The PMSG-primed rats were induced to ovulate by the LH analog, human Chronic Gonadotropin (hCG, 5IU, hrono-gest Intervest, Amsterdam, Netherland), administered 48 h later. Ovulation was examined 20 h after hCG treatment. For this purpose, the oviducts were recovered and the number of oocytes counted. The ovulated oocytes were further subjected to microscopic examination for their meiotic status as described below.

Histology

Ovaries obtained from rats at the ages of 16, 17 and 21 days, with or without gonadotropin treatment, were fixed in 4% paraformaldehyde (PFA, BDH chemicals, Leicestershire, England) for 24 h and paraffin embedded. Sections of 5 µm were mounted and the slides were stained by hematoxylin and eosin (H&E).

Ovarian follicles culture

Either intact ovaries or follicle clusters recovered from PMSG-primed 17-day-old and 25-day-old rats, respectively, were incubated in L-15 tissue culture medium containing 5% FBS (both purchased from Biological Industries, Kibbutz Bet-HaEmek, Israel) in 25 ml flasks gassed with 50% O2 and 50% N2 as previously described [36]. Incubations were carried out at 37ºC in an oscillating water bath in the presence or absence of 2 µg/ml of ovine LH (o-LH, NIH LH S-24, Bethesda, MD). At the end of the incubation, the follicles were incised and the recovered oocytes were subjected to either morphological examination or further analysis as described below.

Assessment of the meiotic status

The meiotic status of the oocytes was assessed by differential interference contrast (DIC) microscopy (Nikon, Tokyo, Japan). The oocytes were examined for the presence of GV (indicating meiotic arrest) or its absence (GVB, indicating reinitiation of meiosis). The presence of PBI denoted the completion of the first meiotic division.

RNA extraction and RT-PCR analysis

Total RNA was extracted from ovaries isolated from either 17-day-old rats or 25-day-old rats using Gene Jet RNA purification kit, according to the manufacturer’s guidelines (Thermo Scientific, Waltham, MA). Conversion of RNA into cDNA was done using the High-Capacity cDNA kit (Thermo Scientific, Waltham, MA). The cDNAs were used for real-time PCR analysis with primer sets for LH receptor (LH-R, 5ʹ-gtaacacaggcatccgaacc and 3ʹ-ccgggtatggtggttatgtg), CYP19a1 (5ʹ-cgtcatgttgcttctcatcg and 3ʹ-taccgcaggctctcgttaat), progesterone receptor (PgR, 5ʹ- tggtccttggaggtcgtaag and 3ʹ- ccagggtctggctctcatta) and HPRT (5ʹ- gcagtacagccccaaaatgg and 3ʹ- ggtccttttcaccagcaagct). All real-time PCRs were carried out on a step one plus (applied Biosystems, Foster City, CA), using the Absolute Blue QPCR Master Mix (Thermo Scientific, Waltham, MA) with SYBR Green. Reaction protocols had the following format: 15 min at 95°C for enzyme activation, followed by 40 cycles of: 15 sec at 95°C, 30 sec at 60°C, and 15 sec at 72°C, at the end of which fluorescence was measured with the Rotor-Gene. SYBR Green-I assays also included a melt curve at the end of the cycling protocol, with continuous fluorescence measurement from 65°C to 99°C. All reactions contained the same amount of cDNA, 10 μl Absolute Blue QPCR Master Mix, primers for the indicated genes and UltraPure PCR-grade water (Biological Industries, Kibbutz Bet HaEmek, Israel) to a final volume of 20 μl. Each real-time PCR included a no-template control, in duplicate. Relative expression levels (ΔΔCt) were calculated by normalizing to HPRT. Primers were designed using the primer3 website (http://frodo.wi.mi- t.edu/primer3).

cAMP determination

Cumulus-oocyte complexes were recovered from the ovarian cultures described above into IBMX (0.2 mM)-containing medium. The oocytes were striped from their surrounding cumulus cells by repetitive pipetting after treatment with 5 mM EDTA (in L-15, 30 min at 37°C), suspended in 0.1 N HCL and flash frozen in liquid nitrogen. Determinations were performed using the cyclic AMP (low pH) immunoassay kit, according to the manufacturer protocol (R&D systems, Abingdon, UK). The sensitivity of this cAMP assay is 0.039 pmol/mL for the acetylated procedure. The inter-assay coefficients of variability (CVs) for this assay were 7.3% and the intra-assay coefficients of variability (CVs) for this assay were 3.6%.

cGMP determination

Determination of cGMP was performed as described previously [30]. Briefly, either follicle clusters or oocytes were collected as described above, snap-frozen in liquid nitrogen, and stored at −80°C. For cGMP determination, samples were treated and resuspended in buffer supplied with the EIA kit as described previously [30]. Samples and cGMP standards were acetylated and quantified as described in the cGMP EIA kit (Enzo, Farmingdale, NY). The sensitivity of this cGMP assay is 0.025 pmol/mL for the acetylated procedure. The inter-assay coefficients of variability (CVs) for this assay were 6.2% and the intra-assay coefficients of variability (CVs) for this assay were 3.5%.

PDE3A activity assay

Cumulus-free oocytes were homogenized in isotonic buffer (10 mM sodium phosphate buffer pH 7.2) containing 50 mM NaF, 150 mM NaCl, 2 mM EDTA, 5 mM β-mercaptoethnol, 30 mM sodium pyrophosphate, 3 mM benzamidine, 5 µg/ml leupeptin, 20 µg/ml pepstatin, and 2 mM phenylmethylsulfonyl fluoride (PMSF, all purchased from Sigma, Rehovot, israel). Triton X-100 (0.5%) was used as a detergent to obtain the whole-cell extracts. The use of Triton X-100 was avoided in experiments designed to assay the cytosolic fraction. Under both conditions, the homogenate was centrifuged at 4°C for 30 min at 14,000 rpm and the soluble fraction recovered. The activity of PDE was assayed using 1 µM cAMP (Sigma, Rehovot, Israel) as substrate as described previously [37]. Samples were assayed at 34°C in a final volume of 200 µl of a solution consisting of 40 mM Tris-HCl pH 8.0, 10 mM MgCl2, 5 mM β-mercaptoethnol, 1 mg/ml BSA, and 1 µM cAMP (all from Sigma, Rehovot, israel) and 25 nM [3H]cAMP (PerkinElmer, Hod HaSharon, Israel) approximately 0.1 × 106 cpm/tube, 20 Ci/mmol. A preliminary experiment in the presence of cilostamide, a PDE3A inhibitor was preformed to confirm that the results obtained represent specifically PDE3A activity (data not shown).

Western blot analysis

To examine PDE3A expression, growing oocytes were isolated from 17-day-old rats and fully grown oocytes were recovered from 25-day-old rats. Western blot analysis was performed as described previously [38]. Briefly, the oocytes were lysed in Laemmli buffer (125 mM Tris pH 6.8, 4% SDS, 10% glycerol, 0.006% bromophenol blue, 2% β-mercaptoethanol) and the samples were boiled for 5 min. Given the difference in their protein content (27.5 and 19.25 ng/oocyte in fully grown and growing oocytes respectively), the protein amounts in each sample loaded on the gel were adjusted accordingly. Samples were then electrophoretically separated on a 10% acrylamide gel, followed by their transfer to a nitrocellulose membrane. After blocking with 5% skimmed milk, the membranes were incubated with PDE3A primary antibodies (1:500, kindly provided by Prof. Manganiello) and beta-actin (1:1000, thermo scientific, Rockford, IL) overnight at 4°C followed by the secondary antibodies for 1 h in room temperature. The immunoreactive bands were detected by ECL (Amersham).

Statistical analysis

Each experiment was carried out at least three times, with at least three rats at each experimental point. Data points are presented as mean ±SEM. Statistical significance was calculated using ANOVA and the post-hoc t-test (JMP).

Results

Detection of the earliest age of the ovarian response to gonadotropins and its characterization

According to the commonly practiced protocol described in Materials and Methods, 16–24-day-old, wistar female rats (6 for each age group) were primed with PMSG followed by hCG administration for induction of ovulation. We found that rats younger than 20 days did not respond to this treatment and that their ability to ovulate is acquired gradually (Figure1(a)). Furthermore, the ovulated oocytes, recovered from the oviducts of 20-day-old animals reinitiated meiosis as indicated by GVB but failed to complete the first meiotic division; some of these oocytes exhibited a large protrusion, which was not followed by the formation of PBI (Figure1(b)). This step-wise acquisition of meiotic competence was also reported previously for spontaneous oocyte maturation [6,39].

Figure 1.

Figure 1.

Open in a new tab

Age-dependent acquisition of ovarian response to gonadotropins (a) Animals at the indicated ages were primed by PMSG and administrated with hCG 48 h later. Oviductal oocytes were counted 24 h after hCG injection (n = 6 rats/age group) (b) Ovulated oocytes isolated from 20-day-old rats were monitored for PBI extrusion (n = 60 oocytes from 6 animals). (c) Ovaries isolated from either untreated (a,c,e) or PMSG/hCG treated (b,d.f), 16-(a,b), 17-(c,d) and 21-(e,f) day-old rats were subjected to histological examination. GF-Graafian follicle. CL-corpus luteum. Arrows indicate PBI and oocytes extrusion.

Histological examinations of ovaries isolated from non-treated 16-day-old females revealed, as expected, the absence of follicles at advanced stages of folliculogenesis (Figure 1(Ca)). This histological phenotype did not change upon PMSG/hCG treatment (Figure 1(Cb)), confirming failure to respond to gonadotropins. Hormonal stimulation was initially detected in ovaries of 17-day-old females. The ovarian follicles in gonadotropin-treated rats at this age (Figure1(Cd)), but not in the untreated rats (Figure1(Cc)), reached the primary to antral developmental stages, with only few of them further developing to the Graafian stage. Nevertheless, these seemingly preovulatory follicles failed to ovulate (Figure 1(A)). Ovaries from 21-day-old females did ovulate upon gonadotropin stimulation (Figure 1(A)). In agreement, the presence of corpora lutea was identified in the histological examination of their ovaries (Figure 1(Cf)), but not in the ovaries isolated from untreated 21-day-old females (Figure 1(Ce)).

To confirm the possibility that 17-day-old rats have a reduced response to PMSG/hCG we examined the ovaries for the presence of LH receptor (Lhcgr) and Cyp19a1, the expression of which is induced by FSH, as well as that of progesterone receptor (Pgr), known to be upregulated by LH. These genes were detected in the ovaries of 17-day-old rats (Figure 2), however the expression levels of Lhcgr and Cyp19 as well as that of Pgr mRNA (Figure 2) were not upregulated in response to gonadotropins. As expected, in 25-day-old females, PMSG induced the expression of Lhcgr as well as that of Cyp19a1; in these rats hCG further stimulated the expression of Pgr (Figure 2).

Figure 2.

Figure 2.

Open in a new tab

The expression of ovulation-associated genes in ovaries of 17-day-old rats. RNA extracted from ovaries recovered from either untreated, PMSG-treated or PMSG/hCG-treated, either 17-day-old or 25-day-old rats, was reverse transcribed and subjected to real-time PCR analysis for the expression of Lhgcr, Cyp19 and PgR (n = 5 rats/age group). Lhgcr-LH receptor, PgR-progesterone receptor. Different letters indicate significant differences.

Assessment of the meiotic status of oocytes released from ovaries of 17-day-old PMSG/hCG treated females

Our finding that 17-day-old rats do not ovulate in response to PMSG/hCG treatment was followed by the assessment of the meiotic status of oocytes that reside in these follicles. To evaluate the ability of LH to induce maturation in young age rats, oocytes from PMSG/hCG-treated,17-day-old rats were monitored for the presence or absence of the GV. No difference in the meiotic status was found between oocytes from ovaries of untreated and hormonally treated females (99.1%±0.7% and 97.845%±1.875% GV oocytes, respectively, Figure 3(A)). This experiment was complemented by examination of the ability of the oocytes to resume meiosis in response to LH ex vivo. For this purpose, ovaries were recovered from 17-day-old, PMSG-primed animals, and follicle clusters were incubated in the presence or absence of LH for 24 h. The same fraction of oocytes displayed an intact GV in ovaries incubated with or without LH (95.73%±1.71% and 97.08%±2.94%, respectively, Figure 3(B)). These experiments revealed that oocytes from 17-day-old rats fail to resume meiosis not only spontaneously, but also in response to LH.

Figure 3.

Figure 3.

Open in a new tab

Failure of growing oocytes to resume meiosis in response to LH either in-vivo or ex vivo. (a) Oocytes released from ovaries of 17-day-old rats either treated or untreated with PMSG/hCG were monitored for their meiotic status, indicated by the presence or the absence of GV (n = 30 oocytes/group from 6 rats/group). (b) Ovaries isolated from PMSG-primed, 17-day-old animals were incubated with LH for 24 h followed by oocyte recovery and their monitoring for the presence of GV (n = 30 follicles/group from 6 rats/group).

The effect of LH on cGMP levels in the ovarian follicles

A dramatic drop in cGMP is a characteristic response of the ovarian follicles to LH [40]. The experiments described previously in this paper demonstrated that follicles of PMSG-treated rats, younger than 20 days do not express Lhcgr (Figure 2). Inability of the ovarian follicles to respond to LH was further subjected to a functional analysis. For that purpose, we determined the levels of cGMP in follicle clusters recovered from PMSG-primed 17-day-old females exposed to LH ex vivo. We found that unlike follicles recovered from 25-day-old rats, which showed a significant 3.3-fold reduction in the cGMP levels (Figure 4(a)), a nonsignificant drop in cGMP was observed in follicles recovered from 17-day-old rats upon their exposure to LH (Figure 4(b)).

Figure 4.

Figure 4.

Open in a new tab

Determination of cGMP in ovarian follicles exposed to LH. (a) Intact follicles recovered from PMSG-primed 25-day-old rats, were incubated with LH. The levels of cGMP were determined. (b) Follicle clusters recovered from PMSG-treated 17-day-old rats were incubated with LH. Level of cGMP was determined. * indicates p < 0.05. An average of 3 repeats is presented. In each repeat, 80 oocytes from 6 rats were collected for each treatment.

CAMP and cGMP regulation in oocytes

Reduction of cAMP in fully grown oocytes follows the binding of LH to its corresponding ovarian receptors [36]. As expected, exposure of large antral follicles of 25-day-old rats to LH leads to a significant decrease in the oocyte content of cAMP (Figure 5(a)). Interestingly, no changes in cAMP levels were detected in the growing oocytes residing in the ovarian follicles of 17-day-old animals upon exposure to this gonadotropin (Figure 5(b)).

Figure 5.

Figure 5.

Open in a new tab

Determination of cAMP and cGMP in oocytes recovered from ovarian follicles exposed to LH. Concentrations of cAMP were determined in (a) fully grown oocytes and (b) growing oocytes recovered from isolated intact follicles exposed to LH ex vivo. Concentrations of cGMP were determined in (c) fully grown oocytes and (d) growing oocytes recovered from isolated intact follicles exposed to LH ex vivo. (n = 80 oocytes/group, isolated from 6 rats) * indicates p < 0.05.

The hydrolysis of the oocyte cAMP is executed by the enzymatic activity of PDE3A, which is negatively regulated by cGMP [41]. Therefore, we determined the levels of cGMP present in oocytes isolated from ovaries of PMSG-primed 17-day-old females. We found that exposure of large antral ovarian follicles recovered from 25-day-old rats, to LH, resulted in a significant decrease in the oocyte content of cGMP (Figure 5(c)). However, changes in cGMP levels detected in the oocytes residing in the ovarian follicles of 17-day-old animals upon exposure to this gonadotropin were not significant (Figure 5(d)).

PDE3A activity in oocytes recovered from 17-day-old rats

It has been shown previously that oocytes of PDE3A null mice failed to resume meiosis both, in vivo and in vitro due to their inability to degrade cAMP and reduce its intraoocyte levels [42,43]. These data combined with our finding that cAMP content in oocytes residing in ovarian follicles of 17-day-old mice remained high, led us to examine the PDE3A expression levels in these oocytes. No significant difference in Pde3a mRNA (Figure 6(a)), as well as protein levels (Figure 6(b)), was detected between growing and fully grown oocytes.

Figure 6.

Figure 6.

Open in a new tab

PDE3A expression and activity in growing oocytes (a) Samples of 200 ng mRNA, extracted from either fully grown or growing oocytes were reverse-transcribed and subjected to real-time PCR analysis for Pde3a transcript levels; HPRT was employed as the reference gene. (b) PDE3A protein expression in fully grown and growing oocytes using western blot analysis with specific anti-PDE3A antibody. A representative result out of 2 replicates is presented. In each replicate, oocytes were collected from 6 animals. (c) Whole-cell PDE3 activity, determined in the presence of 0.05% triton X-100. (d) Cytosolic PDE3 activity, determined in the absence of detergent. Data represent the mean ± SEM of 3 independent experiments. * indicates p < 0.05.

In the absence of both, transcriptional and translational differences in oocyte PDE3A we further analyzed the activity of PDE3A in fully grown and growing oocytes. Interestingly, despite the similar expression levels, the activity of PDE3A in growing oocytes was significantly lower than that determined in fully grown oocytes (Figure 6(c)). There are two forms of PDE3A, a membrane-associated PDE3A and a soluble-truncated form of this enzyme [44]. It has been reported that the majority of PDE3A activity in fully grown rodent oocytes is recovered from the soluble fraction of the homogenate [45–47]. Taking this information into account, we performed the PDE activity assay in the whole cell as well as in the cytosolic fraction of oocyte cell lysates [45]. This experiment revealed that the cytosolic PDE3A activity of growing oocytes reached only 25% of the activity determined in fully grown oocytes (Figure 6(d)).

Discussion

Our present study demonstrates that the failure of LH to induce meiosis in growing oocytes is associated with a low response of the ovarian follicles to gonadotropins. Specifically, ovarian follicles of 19-day-old rats and younger exhibit a poor response to FSH, manifested by their failure to express the LH receptor (LHR) and the resulting inability to detect the corresponding gonadotropin. The oocytes that reside in these gonadotropins-naïve follicles contain relatively high cGMP, known as a negative regulator of PDE, thus exhibiting a low activity of their specific PDE3A and the subsequent, relatively high, cAMP content. This is unlike fully grown oocytes, that reside in follicles, in which exposure to LH leads to a decrease in cGMP followed by elevated activity of PDE3A and the resultant drop in cAMP to levels that go under the threshold required for maintenance of meiotic arrest.

The ovulatory response to LH, which includes oocyte maturation, mainly refers to the process of follicle rupture and the release of the ovum. In order to challenge the capacity of the ovary of rats younger than 22 days to respond to LH, we subjected these animals to the commonly used protocol for induction of ovulation. We found that administration of hCG to PMSG-primed rats, younger than 20 days, totally failed to induce ovulation. Histological examinations of the ovaries of 17-day-old rats confirmed the limited response of the younger animals to gonadotropins and their ovulation failure was also indicated by the absence of corpora lutea.

The failure of young rats to ovulate was associated with their inability to upregulate the expression of ovulation-associated genes. The FSH analog, PMSG failed to induce the expression of aromatase (Cyp19) as well as that of the LH receptor (Lhcgr), suggesting that although some follicles of 17-day-old rats seem to develop into the Graafian stage, their response to FSH is impaired. The failure of PMSG-primed, 17-day-old rats to express the progesterone receptor (Pgr) upon hCG administration, is apparently secondary to their poor response to PMSG. We assume that the restricted ability of the ovarian follicle to respond to gonadotropins contributes to the failure of the oocyte to resume meiosis. A major role for FSH in the development of meiotic competence has been suggested previously [6]. Acquisition of meiotic competences abolished upon hypophysectomy of 15-day-old female rat was rescued, in this early study, by exogenous administration of FSH. As the response to LH is secondary to that of FSH, treatment with LH was unsuccessful in stimulating the oocytes to acquire meiotic competence in the hypophysectomized animals [6].

It has been suggested that GPR3, a constitutively active Gs-coupled receptor expressed in mouse oocytes, generates in ovo cAMP [48–50]. Nevertheless, maintenance of meiotic arrest in fully grown oocytes is highly dependent on their junctional communication with the somatic cells of the ovarian follicle [25–28,51]. Under conditions of established cell-to-cell communication, intraoocyte levels of cAMP are relatively high due to the combined supply of the inhibitory nucleotide itself, as well as that of cGMP, known as a negative regulator of PDE [31]. Alternatively, cessation of their flow, upon interruption of communication, either mechanically or in response to LH, acts as a highly efficient mechanism for stimulation of oocyte maturation. The efficiency of this control mechanism is further elevated by the LH-stimulated decrease in the ovarian supply of cGMP (32). This effect of LH is elicited by downregulation of the ovarian follicle natriuretic peptide, CNP expression [33] and the inactivation of its guanylyl cyclase receptor NPR2 [32,34].

Our present experiments revealed that unlike fully grown oocytes, which exhibit a drop in cAMP upon exposure of the ovary to LH [19], levels of cAMP in growing oocytes stay relatively high. Intraoocyte cAMP in growing oocytes could be generated by GPR [3], the activity of which in oocytes isolated from small follicles has been recently demonstrated [52]. In addition, similar to fully grown oocytes, a major fraction of this nucleotide could be contributed by the somatic follicle cells. This assumption agrees with our previously reported reduction in intraoocyte concentration of cAMP in small oocytes upon their release from the ovarian follicle [16], representing apparently their full dissociation from the somatic supply of this cyclic nucleotide as well as that of the PDE inhibitor, cGMP. On the other hand, in follicles that have not acquired the capacity to respond to LH, junctional cell-to-cell communication stays intact, allowing the continuous transfer of cAMP and cGMP to the oocyte. Under these conditions, unlike those generated upon the release of oocytes from the ovarian follicle, the levels of cAMP stay relatively high. Nevertheless, even upon its complete separation from the ovarian follicle, the levels of cAMP in growing oocytes are still not sufficiently low to allow the exit from meiotic arrest. This could be possibly attributed to the high basal PKA activity demonstrated previously in these oocytes [23].

Intracellular concentration of cAMP in any cellular system represents the balance between its synthesis and degradation. As mentioned above, a major fraction of cAMP in oocytes is uniquely contributed by the somatic follicle compartment. This is being balanced by the degradation of cAMP, executed by the oocyte-specific PDE3A [53]. Indispensability of PDE3A for oocyte maturation is strongly evident by the failure of oocyte of null mice to undergo GVB [42], and by the rescue of pde3a-/- oocyte competence to resume meiosis upon reintroduction of this enzyme [54]. Unlike the PDE3A null mice, growing oocytes do express this enzyme [45–47]. We show herein that the amount of the cytosolic PDE3A in fully grown and growing oocytes is similar. Nevertheless, we demonstrate that the activity of PDE3A in the cytosolic fraction of growing oocytes is significantly lower than that in fully grown oocytes. This last finding may explain the relatively high abundance of cGMP in growing oocytes.

In summary, we demonstrate herein that meiotic incompetence represents, at least in part, the initial limited effect of FSH on the ovarian follicle, followed by its failure to respond to LH. This in turn is manifested, among other, by a sustained level of cGMP in the ovarian follicle and continuous supply of both cyclic nucleotides, cAMP and cGMP, from the somatic cells to the oocyte. The high quantity of cGMP in the oocyte, which is secondary to the limited response of the somatic cells in the corresponding follicle to LH, lowers the activity of PDE3A. These conditions, account apparently for the failure of growing oocytes to resume meiosis in vivo.

Acknowledgments

The Authors would like to thank Dr. Lital Kalich and Ms. Nitzan Rimon for critical reading of the manuscript.

Disclosure statement

No potential conflict of interest was reported by the authors.

References

  • [1].Masui Y. From oocyte maturation to the in vitro cell cycle: the history of discoveries of Maturation-Promoting Factor (MPF) and Cytostatic Factor (CSF). Differentiation. 2001 Dec;69(1):1–17. [DOI] [PubMed] [Google Scholar]
  • [2].Tsafriri A, Dekel N.. Molecular mechanisms in ovulation. Mol Biol Female Reprod Sys Acad Press. 1994;1:207–257. [Google Scholar]
  • [3].Iwamatsu T, Yanagimachi R. Maturation iv vitro of ovarian oocytes of prepubertal and adult hamsters. J Reprod Fertil. 1975;45:83–90. [DOI] [PubMed] [Google Scholar]
  • [4].Szybek K. In-vitro maturation of oocytes from sexually immature mice. J Endocrinol. 1972;54:527–528. [DOI] [PubMed] [Google Scholar]
  • [5].Balakier H. Induction of maturation in small oocytes from sexually immature mice by fusion with meiotic or mitotic cells. Exp Cell Res. 1978;112:137–141. [DOI] [PubMed] [Google Scholar]
  • [6].Bar-Ami S, Nimrod A, Brodie AM, et al. Role of FSH and oestradiol-17 beta in the development of meiotic competence in rat oocytes. J Steroid Biochem. 1983;19:965–971. [DOI] [PubMed] [Google Scholar]
  • [7].Harrouk W, Clarke HJ. Mitogen-activated protein (MAP) kinase during the acquisition of meiotic competence by growing oocytes of the mouse. Mol Reprod Dev. 1995;41:29–36. [DOI] [PubMed] [Google Scholar]
  • [8].Hirao Y, Miyano T, Kato S. Acquisition of maturational competence in in vitro grown mouse oocytes. J Exp Zool. 1993;267:543–547. [DOI] [PubMed] [Google Scholar]
  • [9].Sorensen RA, Wassarman PM. Relationship between growth and meiotic maturation of the mouse oocyte. Dev Biol. 1976;50:531–536. [DOI] [PubMed] [Google Scholar]
  • [10].Chesnel F, Wigglesworth K, Eppig JJ. Acquisition of meiotic competence by denuded mouse oocytes: participation of somatic-cell product(s) and cAMP. Dev Biol. 1994;161:285–295. [DOI] [PubMed] [Google Scholar]
  • [11].de Vantery C, Stutz A, Vassalli JD, et al. Acquisition of meiotic competence in growing mouse oocytes is controlled at both translational and posttranslational levels. Dev Biol. 1997;187:43–54. [DOI] [PubMed] [Google Scholar]
  • [12].Mitra J, Schultz RM. Regulation of the acquisition of meiotic competence in the mouse: changes in the subcellular localization of cdc2, cyclin B1, cdc25C and wee1, and in the concentration of these proteins and their transcripts. J Cell Sci. 1996;109(Pt 9):2407–2415. [DOI] [PubMed] [Google Scholar]
  • [13].Motlik J, Kubelka M. Cell-cycle aspects of growth and maturation of mammalian oocytes. Mol Reprod Dev. 1990;27:366–375. [DOI] [PubMed] [Google Scholar]
  • [14].Petr J, Rozinek J, Fulka J Jr., et al. Influence of cytoplasmic microinjection on meiotic competence in growing pig oocytes. Reprod Nutr Dev. 1994;34:81–87. [DOI] [PubMed] [Google Scholar]
  • [15].Christmann L, Jung T, Moor RM. MPF components and meiotic competence in growing pig oocytes. Mol Reprod Dev. 1994;38:85–90. [DOI] [PubMed] [Google Scholar]
  • [16].Goren S, Piontkewitz Y, Dekel N. Meiotic arrest in incompetent rat oocytes is not regulated by cAMP. Dev Biol. 1994;166:11–17. [DOI] [PubMed] [Google Scholar]
  • [17].Hirao Y, Tsuji Y, Miyano T, et al. Association between p34cdc2 levels and meiotic arrest in pig oocytes during early growth. Zygote. 1995;3:325–332. [DOI] [PubMed] [Google Scholar]
  • [18].Cho WK, Stern S, Biggers JD. Inhibitory effect of dibutyryl cAMP on mouse oocyte maturation in vitro. J Exp Zool. 1974;187:383–386. [DOI] [PubMed] [Google Scholar]
  • [19].Dekel N. Regulation of oocyte maturation. The role of cAMP. Ann N Y Acad Sci. 1988;541:211–216. [DOI] [PubMed] [Google Scholar]
  • [20].Bornslaeger EA, Mattei P, Schultz RM. Involvement of cAMP-dependent protein kinase and protein phosphorylation in regulation of mouse oocyte maturation. Dev Biol. 1986;114:453–462. [DOI] [PubMed] [Google Scholar]
  • [21].Maller JL, Krebs EG. Progesterone-stimulated meiotic cell division in Xenopus oocytes. Induction by regulatory subunit and inhibition by catalytic subunit of adenosine 3ʹ:5ʹ-monophosphate-dependent protein kinase. J Biol Chem. 1977;252:1712–1718. [PubMed] [Google Scholar]
  • [22].Bornslaeger EA, Mattei PM, Schultz RM. Protein phosphorylation in meiotically competent and incompetent mouse oocytes. Mol Reprod Dev. 1988;1:19–25. [DOI] [PubMed] [Google Scholar]
  • [23].Kovo M, Kandli-Cohen M, Ben-Haim M, et al. An active protein kinase A (PKA) is involved in meiotic arrest of rat growing oocytes. Reproduction. 2006;132:33–43. [DOI] [PubMed] [Google Scholar]
  • [24].Dekel N, Beers WH. Rat oocyte maturation in vitro: relief of cyclic AMP inhibition by gonadotropins. Proc Natl Acad Sci U S A. 1978;75:4369–4373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Dekel N, Lawrence TS, Gilula NB, et al. Modulation of cell-to-cell communication in the cumulus-oocyte complex and the regulation of oocyte maturation by LH. Dev Biol. 1981;86:356–362. [DOI] [PubMed] [Google Scholar]
  • [26].Norris RP, Freudzon L, Freudzon M, et al. A G(s)-linked receptor maintains meiotic arrest in mouse oocytes, but luteinizing hormone does not cause meiotic resumption by terminating receptor-G(s) signaling. Dev Biol. 2007;310:240–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Sela-Abramovich S, Chorev E, Galiani D, et al. Mitogen-activated protein kinase mediates luteinizing hormone-induced breakdown of communication and oocyte maturation in rat ovarian follicles. Endocrinology. 2005;146:1236–1244. [DOI] [PubMed] [Google Scholar]
  • [28].Sherizly I, Galiani D, Dekel N. Regulation of oocyte maturation: communication in the rat cumulus-oocyte complex. Hum Reprod. 1988;3:761–766. [DOI] [PubMed] [Google Scholar]
  • [29].Webb RJ, Marshall F, Swann K, et al. Follicle-stimulating hormone induces a gap junction-dependent dynamic change in [cAMP] and protein kinase a in mammalian oocytes. Dev Biol. 2002;246:441–454. [DOI] [PubMed] [Google Scholar]
  • [30].Vaccari S, Weeks JL 2nd, Hsieh M, et al. Cyclic GMP signaling is involved in the luteinizing hormone-dependent meiotic maturation of mouse oocytes. Biol Reprod. 2009;81:595–604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Cote RH, Bownds MD, Arshavsky VY. cGMP binding sites on photoreceptor phosphodiesterase: role in feedback regulation of visual transduction. Proc Natl Acad Sci U S A. 1994;91:4845–4849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Egbert JR, Shuhaibar LC, Edmund AB, et al. Dephosphorylation and inactivation of NPR2 guanylyl cyclase in granulosa cells contributes to the LH-induced decrease in cGMP that causes resumption of meiosis in rat oocytes. Development. 2014;141:3594–3604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Kawamura K, Cheng Y, Kawamura N, et al. Pre-ovulatory LH/hCG surge decreases C-type natriuretic peptide secretion by ovarian granulosa cells to promote meiotic resumption of pre-ovulatory oocytes. Hum Reprod. 2011;26:3094–3101. [DOI] [PubMed] [Google Scholar]
  • [34].Robinson JW, Zhang M, Shuhaibar LC, et al. Luteinizing hormone reduces the activity of the NPR2 guanylyl cyclase in mouse ovarian follicles, contributing to the cyclic GMP decrease that promotes resumption of meiosis in oocytes. Dev Biol. 2012;366:308–316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Zhang M, Su YQ, Sugiura K, et al. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Science. 2010;330:366–369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Sela-Abramovich S, Edry I, Galiani D, et al. Disruption of gap junctional communication within the ovarian follicle induces oocyte maturation. Endocrinology. 2006;147:2280–2286. [DOI] [PubMed] [Google Scholar]
  • [37].Thompson WJ, Brooker G, Appleman MM. Assay of cyclic nucleotide phosphodiesterases with radioactive substrates. Methods Enzymol. 1974;38:205–212. [DOI] [PubMed] [Google Scholar]
  • [38].Gershon E, Galiani D, Dekel N. Cytoplasmic polyadenylation controls cdc25B mRNA translation in rat oocytes resuming meiosis. Reproduction. 2006;132:21–31. [DOI] [PubMed] [Google Scholar]
  • [39].Alam MH, Lee J, Miyano T. Inhibition of PDE3A sustains meiotic arrest and gap junction of bovine growing oocytes in in vitro growth culture. Theriogenology. 2018;118:110–118. [DOI] [PubMed] [Google Scholar]
  • [40].Shuhaibar LC, Egbert JR, Norris RP, et al. Intercellular signaling via cyclic GMP diffusion through gap junctions restarts meiosis in mouse ovarian follicles. Proc Natl Acad Sci U S A. 2015;112:5527–5532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Degerman E, Belfrage P, Manganiello VC. Structure, localization, and regulation of cGMP-inhibited phosphodiesterase (PDE3). J Biol Chem. 1997;272:6823–6826. [DOI] [PubMed] [Google Scholar]
  • [42].Masciarelli S, Horner K, Liu C, et al. Cyclic nucleotide phosphodiesterase 3A-deficient mice as a model of female infertility. J Clin Invest. 2004;114:196–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Shen W, Ahmad F, Hockman S, et al. Female infertility in PDE3A(-/-) mice: polo-like kinase 1 (Plk1) may be a target of protein kinase A (PKA) and involved in meiotic arrest of oocytes from PDE3A(-/-) mice. Cell Cycle. 2010;9:4720–4734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Kasuya J, Goko H, Fujita-Yamaguchi Y. Multiple transcripts for the human cardiac form of the cGMP-inhibited cAMP phosphodiesterase. J Biol Chem. 1995;270:14305–14312. [DOI] [PubMed] [Google Scholar]
  • [45].Richard FJ, Tsafriri A, Conti M. Role of phosphodiesterase type 3A in rat oocyte maturation. Biol Reprod. 2001;65:1444–1451. [DOI] [PubMed] [Google Scholar]
  • [46].Shakur Y, Takeda K, Kenan Y, et al. Membrane localization of cyclic nucleotide phosphodiesterase 3 (PDE3). Two N-terminal domains are required for the efficient targeting to, and association of, PDE3 with endoplasmic reticulum. The. J Biol Chem. 2000;275:38749–38761. [DOI] [PubMed] [Google Scholar]
  • [47].Shitsukawa K, Andersen CB, Richard FJ, et al. Cloning and characterization of the cyclic guanosine monophosphate-inhibited phosphodiesterase PDE3A expressed in mouse oocyte. Biol Reprod. 2001;65:188–196. [DOI] [PubMed] [Google Scholar]
  • [48].Mehlmann LM. Oocyte-specific expression of Gpr3 is required for the maintenance of meiotic arrest in mouse oocytes. Dev Biol. 2005;288:397–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Mehlmann LM, Jones TL, Jaffe LA. Meiotic arrest in the mouse follicle maintained by a Gs protein in the oocyte. Science. 2002;297:1343–1345. [DOI] [PubMed] [Google Scholar]
  • [50].Mehlmann LM, Saeki Y, Tanaka S, et al. The Gs-linked receptor GPR3 maintains meiotic arrest in mammalian oocytes. Science. 2004;306:1947–1950. [DOI] [PubMed] [Google Scholar]
  • [51].Norris RP, Freudzon M, Mehlmann LM, et al. Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: one of two paths to meiotic resumption. Development. 2008;135:3229–3238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Firmani LD, Uliasz TF, Mehlmann LM. The switch from cAMP-independent to cAMP-dependent arrest of meiotic prophase is associated with coordinated GPR3 and CDK1 expression in mouse oocytes. Dev Biol. 2018;434:196–205. [DOI] [PubMed] [Google Scholar]
  • [53].Tsafriri A, Chun SY, Zhang R, et al. Oocyte maturation involves compartmentalization and opposing changes of cAMP levels in follicular somatic and germ cells: studies using selective phosphodiesterase inhibitors. Dev Biol. 1996;178:393–402. [DOI] [PubMed] [Google Scholar]
  • [54].Han SJ, Vaccari S, Nedachi T, et al. Protein kinase B/Akt phosphorylation of PDE3A and its role in mammalian oocyte maturation. Embo J. 2006;25:5716–5725. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES