SUMMARY
HIV-1 reverse transcriptase (RT) is translated as part of the Gag-Pol polyprotein that is proteolytically processed by HIV-1 protease (PR) to finally become a mature heterodimer, composed of a p66 and a p66-derived 51 kDa subunit, p51. Our prior work suggested that tRNALys3 binding to p66/p66 introduces conformational changes in the ribonuclease (RNH) domain of RT that facilitate efficient cleavage of p66 to p51 by PR. In this study, we characterized the conformational changes in the RNH domain of p66/p66 imparted by tRNALys3 using NMR. Moreover, the importance of tRNALys3 in RT maturation was confirmed in cellulo by modulating the levels of Lys-tRNA synthetase, which affects recruitment of tRNALys3 to the virus. We also employed nonnucleoside RT inhibitors, to modulate the p66 dimer–monomer equilibrium and monitor the resulting structural changes. Taken together, our data provide unique insights into the conformational changes in p66/p66 that drive PR cleavage.
An eTOC blurb
Slack et al. characterize conformational changes involved in the maturation of HIV-1 reverse transcriptase using NMR spectroscopy. Biochemical and virological experiments are carried out to explain how these factors affect the maturation.
Graphical Abstract

INTRODUCTION
Efficient maturation of HIV-1 proteins is critical for virus replication. HIV-1 reverse transcriptase (RT) is expressed as part of the viral Gag-Pol polyprotein, which is cleaved by HIV-1 protease (PR) to finally form a mature RT heterodimer composed of 66 (p66) and 51 kDa (p51) subunits (p66/p51) (Figure 1A) (Coffin et al., 1997; Katz and Skalka, 1994). The p51 subunit is generated upon removal of most of the ribonuclease H (RNH) domain from p66 (Chattopadhyay et al., 1992; Divita et al., 1995; Sharma et al., 1994). Two models of RT maturation have been proposed: a concerted model, in which the p66 and p51 subunits are cleaved independently from Gag-Pol, and a sequential model, in which PR first cleaves p66 from the polyprotein and, following p66 dimerization, the p66/p51 RT heterodimer is formed (Figueiredo et al., 2006; Lindhofer et al., 1995; Mattei et al., 2014; Pettit et al., 2004; Pettit et al., 2005b; Sluis-Cremer et al., 2004; Speck et al., 2000; Wapling et al., 2005; Zheng et al., 2015; Zheng et al., 2014). In regard to these models, prior biochemical data, including ours, demonstrated that p66/p66 homodimer formation is absolutely necessary for efficient in vitro RT maturation, thus supporting the sequential model (Figure 1C) (Abram and Parniak, 2005; Abram et al., 2010; Sluis-Cremer et al., 2004). Paradoxically, the p66/p66 homodimer adopts a symmetrical conformation in solution in which both RNH domains are folded and the p51-RNH cleavage sites are inaccessible to PR (Sharaf et al., 2014). Interestingly, in all structures of the mature p66/p51 heterodimer, the p51-RNH cleavage site is sequestered in a p-sheet within the RNH domain and is inaccessible to PR (Figure 1B) (Davies et al., 1991; Jacobo-Molina and Arnold, 1991; Jacobo-Molina et al., 1993; Kohlstaedt et al., 1992). Consequently, the pathways involved in p66/p51 RT maturation have not been defined. However, characteristic differences between the immature p66/p66 homodimer and the mature p66/p51 heterodimer, such as a ~ 10-fold decrease in the dimer dissociation constant (Sharaf et al., 2014; Sluis-Cremer et al., 2000; Venezia et al., 2006), have led to the hypothesis that significant structural differences exist between these RT proteins.
Figure 1. Structure of p66/p51 HIV-1 RT.
(A) Overall structure of the p66/p51 heterodimer. The fingers-palm, thumb, connection, and RNH domains in the p66 subunit are purple, green, yellow, and orange, respectively. The p51 subunit is white. (B) Structure of the RNH domain highlighting that the p51-RNH cleavage site (F440-Y441, yellow ribbon) is sequestered in the protein core. The RNH active site residues are shown by red sticks. (C) Schematic highlighting how p66/p51 is generated from p66/p66 by HIV-1 PR-mediated cleavage. In panels (A) and (B), graphics were generated using the structure of PDB 3MEE (Lansdon et al., 2010); the location of RPV is shown by red spheres in (A); locations of the Ile-δ1 methyl groups that were uniquely observed in the NMR data are shown by pink spheres. These are residues 202 in the fingers-palm domain, 254 and 259 in the thumb domain, 393 in the connection domain, and 434, 495, and 559 in the RNH domain. Note, since crystallographic coordinates are not available for residue 559, the position of residue 559 is approximated.
Recently, we developed an in vitro RT maturation assay that evaluates processing of p66 by active HIV-1 PR to yield p66/p51 heterodimer, and we proposed that interaction of tRNALys3 with the p66/p66 homodimer enhances specific cleavage by PR at the p51-RNH cleavage site (Ilina et al., 2018). Although this study identified key factors in RT maturation including: (i) the fundamental importance of homodimer formation; (ii) an interaction between tRNALys3 and p66/p66; and (iii) enhancement of p66/p51 production in the presence of tRNALys3, the conformational changes that the p66/p66 homodimer undergoes during maturation are unknown. Another detail of the sequential model that remained unclear was whether tRNALys3 enhanced p66/p51 production due to its ability to increase p66/p66 homodimer formation, or if a specific p66/p66 conformation induced by tRNALys3 was required for the RT maturation. Although tRNA, especially tRNALys3, is abundantly present in the virus (Jiang et al., 1993; Jiang et al., 1992; Kleiman et al., 1991; Mak et al., 1994; Pavon-Eternod et al., 2010), it is also unclear whether tRNALys3 affects RT maturation in the virus to impact viral replication.
Herein, we present an analysis of the conformational changes of p66/p66 homodimer upon tRNALys3 interaction in solution, as well as changes in PR-mediated production of p66/p51, using NMR spectroscopy. Since our previous data suggested that p66 undergoes fast monomer-dimer equilibrium (Sharaf et al., 2014), and that tRNALys3 interacts with p66 monomer as well as the p66/p66 homodimer (Ilina et al., 2018), we designed experiments to distinguish the homodimer interaction with tRNALys3 from that of the monomer. We achieved this by using non-nucleoside reverse transcriptase inhibitors (NNRTIs) known to interact with the p66/p66 homodimer at a 1:1 stoichiometry, to enhance p66/p66 homodimer formation, and to change the environment of the NNRTI binding pocket in p66/p66 similar to that of the p66/p51 (Braz et al., 2010; Sharaf et al., 2017; Tachedjian et al., 2005). Importantly, using in vitro RT maturation experiments and by employing size-exclusion chromatography (SEC) of the protein in various conditions, we show that the application of NNRTIs alone does not alter our underlying premise that tRNALys3 binding to p66/p66 generates a conformational change in the homodimer that facilitates RT maturation. Notably, in HIV-1, the primer tRNA, tRNALys3, is required for reverse transcription initiation complex formation, and is recruited to the virus by interacting with lysine-tRNA synthetase (KARS) (Cen et al., 2002; Cen et al., 2001; Khorchid et al., 2000; Kleiman and Cen, 2004; Kleiman et al., 2010; Mak et al., 1994; Mak et al., 1997). Therefore, we also assessed the impact of tRNALys3 on RT maturation by KARS knockdown in HIV-1 producing cells.
RESULTS
NMR spectra of p66/p66 homodimer
To gain insight into the conformational changes in p66/p66 that facilitate in vitro RT maturation, we monitored the 1H−13C HMQC spectral features of [U-2H], Ile δ1-[13CH3]-labelled p66 protein over time in solution at 35 °C (Figure 2A, 2B). As described in the Materials and Methods, we used four columns to purify p66 for NMR, to avoid contamination by E. coli proteases that can process p66 to p51 (Bavand et al., 1993; Clark et al., 1995; Lowe et al., 1988). These experiments were carried out using a concentration of 35 μM (as p66/p66), a concentration at which we would expect 80% of the protein to exist as a homodimer. The overall HMQC spectral features of the protein did not change over 50 hours (Figure S1), consistent with our previous observation using 1H-15N NMR of [U-2H, 15N]-labelled p66 (Sharaf et al., 2014). A small reduction in the NMR signal intensity (~15%) was observed, presumably due to instability of the magnet or protein solution (Figure 2C); a gain in signal-intensity would be expected if protein unfolding occurred. The spectrum shows a set of protein resonances that are indicative of a symmetric homodimeric form of p66/p66, consistent with previously published p66/p66 spectra, albeit lacking evidence of previously described slow conformational changes that had occurred over 40 hours (Zheng et al., 2017; Zheng et al., 2015; Zheng et al., 2014). In addition, as previously observed, several resonances overlapped in the central region of the spectrum (dashed rectangular in Figure 2A) even though the Ile δ1-methyl-labeled residues are distributed across the p66 domains (highlighted by pink spheres in Figure 1A) (Zheng et al., 2017; Zheng et al., 2015; Zheng et al., 2014).
Figure 2. 1H-13C SOFAST TROSY-HMQC NMR spectra of [U-2H], Ile δ1-[13CH3]-labelled p66/p66 at 35 °C.
(A) p66/p66 spectrum immediately following NMR sample preparation; (B) the random coil region of the spectrum shown in A is overlaid with NMR spectra obtained for the same sample at 2.9, 25, and 57 hours; (C) a plot of the average intensity decay of 42 resonances collected from p66/p66 over 57 hours; (D) comparison of the p66/p66 spectrum (black) with that of a p66/p51 sample (red) in which only the p66 subunit was labelled with [U-2H], Ile δ1-[13CH3]; (E) comparison of the p66/p66 spectrum (black) with that after 3 hour digestion of the NMR sample by active PR in the presence of unlabelled tRNALys3 (pink, see the Materials and Methods); (F) the indicated area of the spectrum in E is shown at high threshold level. Residue numbers (those in the RNH domain are coloured red), except for I559, were based on prior literature (Zheng et al., 2014), except for I559. In (B) and (F), slices taken at the dashed lines, in which cross section, 1H 0.83 ppm and 13C 12.6 ppm, is nearly at the random coil position of the Ile-δ1 methyl group (Wishart et al., 1995), are plotted along the outer edge of the spectrum. Note, since approximately 80% of the p66 forms homodimer at the p66 concentration used in this study, we use the notation of p66/p66, to compare with the p66/p51. See also Figure S1.
The observed spectral features of p66/p66 homodimer were compared with those of the p66/p51 heterodimer (Figure 2D) and with a partially matured sample in which p66/p66 was incubated with HIV-1 PR in the presence of tRNALys3 (Figure 2E). Consistent with previously published data (Zheng et al., 2014), the p66/p66 NMR spectrum was distinct compared to that of p66/p51. When PR was added to p66/p66 in the presence of tRNALys3, we observed an increase in the signal intensity at the random coil position (Figure 2F) and a spectral pattern similar to that of p66/p51 (Figure 2E). Because the cleavage of p66/p66 to p66/p51 was incomplete, spectral patterns for both p66/p66 and p66/p51 can be observed in Figure 2E. Overall, the observed spectral features of p66/p66, are distinct compared to those of p66/p51 and are suggestive of a symmetric homodimer conformation.
NMR spectra of p66 in the presence of tRNALys3
We hypothesized that tRNALys3 interaction with p66/p66 introduces conformational changes in a single RNH domain that facilitate efficient cleavage of p66 to p51 by HIV-1 PR (Ilina et al., 2018). To address the hypothesis, we monitored changes in the 1H-13C HMQC spectrum of [U-2H], Ile δ1-[13CH3]-labelled p66 protein in the absence and presence of unlabelled tRNALys3 at a [tRNALys3]:[p66/p66] = 1.4:1 molar ratio. We observed that upon addition of tRNALys3, the p66 spectrum, which shows only p66 signals and not tRNALys3, exhibited a slight increase in the signal intensity, nearly at the random coil position of the Ile-δ1 methyl group at 1H 0.83 ppm and 13C 12.6 ppm (Wishart et al., 1995) (cross section of the dashed lines in Figure 3A), suggesting partial unfolding of the protein, although many of the resonance positions did not change (Figure 3A, discussed below).
Figure 3. NMR spectra of p66 in the presence of tRNALys3.
(A) 1H-13C SOFAST-HMQC NMR spectra of [U-2H], Ile δ1-[13CH3]-labelled p66/p66 recorded at 35 °C and (B) 1H-15N TROSY-HSQC NMR spectra of [U-2H, 15N]-labelled p66/p66, in the absence (black) or presence (red) of unlabelled tRNALys3, recorded at 20 °C. In (A), a selected region (box) is shown at high threshold level with slices taken at the dashed lines, the cross section of which is nearly at the random coil position. In (B), resonances that were previously found to overlap with the isolated thumb and RNH domains are circled by green and orange colours, respectively (Sharaf et al., 2014). Note, a lower temperature was used for the 1H-15N experiments compared to the temperature used for the 1H-13C experiments, presuming greater protein stability at a lower temperature.
Given that methyl signal intensities, as peak height, are mainly determined by a fast methyl three-site jump (Nicholson et al., 2002), Ile δ1-methyl 1H-13C spectra are less sensitive to reductions in domain motion compared to backbone 1H-15N amide NMR spectra, which are more sensitive to changes in molecular tumbling, domain motion, and internal motion. To further elucidate the conformational changes of p66/p66 imparted by tRNALys3 binding, we also recorded 1H-15N TROSY-HSQC spectra of [U-2H,15N]-labelled p66 in the absence and presence of tRNALys3 at a [tRNALys3]:[p66/p66] = 1:1 molar ratio (Figure 3B). At 75 μM, p66/p66 contains ~90% dimer, with fast exchange occurring between monomer and dimer. The 1H-15N TROSY-HSQC spectrum exhibits a single set of clearly identifiable signals stemming from the RNH and thumb domains (circled orange and green, respectively, in Figure 3B) based on previous assignments, suggesting symmetrical p66/p66 conformation in solution (Sharaf et al., 2014). As reported previously (Sharaf et al., 2014), the resonance positions of the thumb and RNH domains within p66 spectra were highly similar to those of the isolated domains, and also to those in p51. Reported dissociation constants indicate that the p66 homodimer has a tenfold higher affinity than that of the p51 homodimer at equilibrium (Sharaf et al., 2014; Venezia et al., 2006). Based on these observations, and the assumption that resonances observed for the p66 dimer/monomer equilibrium were in the fast exchange regime, we derived a model in which the thumb and RNH domains undergo domain motion, allowing for the observed resonance similarity with respect to spectra of the isolated domains (Sharaf et al., 2014). Indeed, the observation of one set of resonances in the Ile δ1-methyl 1H-13C spectra is consistent with the 1H-15N data (Figure 3).
Upon tRNALys3 addition, many resonances in the 1H-15N NMR spectrum of p66/p66 exhibited a significant reduction in intensity. In particular, signals from the thumb domain significantly decreased, undergoing line broadening or disappearance upon interaction with tRNALys3, while resonances from the RNH domain remained mostly unchanged. This reduction in the signal intensity of the thumb domain resonances is reasonable in the sense that nucleic acid binding would reduce the domain motion of the thumb, resulting in a decrease in signal intensities. It is also consistent with existing structural data, which clearly show that the canonical nucleic acid binding site in RT involves extensive contacts with the p66 thumb and fingers-palm subdomains (Bakhanashvili and Hizi, 1994; Jacobo-Molina et al., 1993). On the other hand, if the RNH domain were in an equilibrium between either rigid and mobile domain states or folded and unfolded states, then the signals would be expected to broaden as a result of the exchange equilibrium. Thus, our observation of the RNH resonances may signify that one RNH domain remains mobile in the tRNALys3-bound form of p66/p66 (discussed below).
NNRTI minimizes p66 monomer interaction with tRNA Lys3
As previously mentioned, the p66/p66 sample contains both monomer and dimer species in equilibrium. Because NMR resonance intensities are inversely proportional to the hydrodynamic radius of macromolecules in solution, even small amounts of monomer bound tRNALys3 could potentially complicate our interpretation of NMR data. NNRTIs have been shown to promote homodimerization of the polyprotein Pol and p66 in cells and in vitro (Braz et al., 2010; Sharaf et al., 2017; Tachedjian et al., 2005). We therefore hypothesized that the inclusion of an NNRTI could be used to reduce the monomeric p66 species within our NMR sample. To confirm that NNRTIs are useful to reduce the monomer component of our p66/p66 samples, we first performed analytical SEC experiments with p66 in the absence or presence of NNRTI and/or tRNALys3. As previously reported, the SEC elution profile of p66 protein alone showed both monomer and dimer elution peaks with a UV254/UV280 ratio of ~0.5, while the SEC profile of tRNALys3, also monitored by fluorescence, showed a single elution peak with a UV254/UV280 ratio of ~2 (Figure 4A and 4B). In the presence of a small amount of tRNALys3 ([p66/p66]:[tRNALys3] = 1:0.22 molar ratio), the elution peak of the dimer shifted to a larger molecular mass, presumably a tRNA-bound form (Figure 4C). However, with excess tRNALys3 ([p66/p66]:[tRNALys3] = 1:1.25), a new elution peak, located between the monomer and dimer peaks and presumably tRNA-bound p66 monomer, appeared (Figure 4D). Indeed, as described previously, even in the presence of a small amount of tRNALys3 (Figure 4C), the maximum position of the p66 monomer at UV254 is slightly shifted from that of UV280, suggesting the existence of a tRNALys3-p66 monomer bound form, the retention of which may depend on the rate of exchange between the monomer and dimer fractions, or of the complexes.
Figure 4. SEC elution profiles of p66.
(A) p66 only, (B) tRNALys3 only, (C) p66 and tRNALys3 at [p66/p66]:[tRNALys3] = 1:0.22, (D) p66 and tRNALys3 at [p66/p66]:[tRNALys3] = 1:1.25, (E) p66 and RPV at [p66:p66]:[RPV] = 1:1.3 ratio, (F) p66, RPV and tRNALys3 at [p66/p66]:[RPV]:[tRNALys3] = 1:1.3:0.22, and (G) p66, RPV and tRNALys3 at [p66/p66]:[RPV]:[tRNALys3] = 1:1.5:2.0. Elution profiles were monitored by UV absorbance at 280 nm (black line) and 254 nm (gray line), and by fluorescence detection for the labeled tRNALys3 (dotted line). Black and gray arrows indicate protein alone elution peaks and those containing tRNALys3, respectively. Note, the molar extinction coefficient of tRNALys3 at 254 and 280 nm are 10.2 and 1.8 times those of p66, respectively, and in the panel (D), the elution peaks of free tRNALys3 and monomer p66 partially overlap with that of the tRNALys3-bound monomer p66, that we estimate to be 20–40% of total p66.
The NNRTI rilpivirine (RPV) is known to enhance p66 homodimer formation with an apparent RPV-p66/p66 dissociation constant of 0.86 ± 0.064 μM (Braz et al., 2010; Hughes, 2001; Sharaf et al., 2017; Tachedjian et al., 2005; Tachedjian et al., 2001; Venezia et al., 2006). Thus, not surprisingly, in the presence of RPV, the SEC profile of p66/p66 exhibited only a homodimer fraction, and a monomer elution peak was not detected (Figure 4E). RPV is known to bind to p66/p66 with a 1:1 ratio (Sharaf et al., 2016; Sharaf et al., 2017). Incubation of RPV-bound p66/p66 with a small amount of tRNALys3 did not produce the tRNALys3-p66 monomer peak that was seen in the absence of RPV, but, instead, produced a single elution peak, earlier than the p66/p66 homodimer, which is presumably tRNALys3-bound p66/p66 and may include its oligomer in an exchange equilibrium (Figure 4F). Even with two-fold excess tRNALys3, the tRNALys3-bound p66 monomer form was not observed in the presence of RPV (Figure 4G).
Effect of NNRTIs on the maturation of HIV-1 RT in vitro
Our SEC data clearly indicate that an NNRTI can suppress the amount of p66 monomers in our p66/p66 samples. To further characterize how NNRTI-mediated reduction in the p66 monomer component modulates RT maturation, we conducted in vitro RT maturation assays. In these experiments, purified p66 is incubated with HIV-1 PR and the cleavage of p66 to p51 is monitored by SDS-PAGE (Ilina et al., 2018) and generation of equivalent amounts of p66 and p51 is indicative of p66/p51 heterodimer production. Incubation of p66 alone with PR does not result in significant p66/p51 heterodimer formation (Figure 5A), while addition of tRNALys3 does (Figure 5B) (Ilina et al., 2018). Of note, in the absence of NNRTI, p66 exists in monomer-dimer equilibrium with a 4–10 μM dissociation constant for the homodimer (Sharaf et al., 2014; Sluis-Cremer et al., 2000; Venezia et al., 2006), similar to the concentration of p66 used in these experiments (4 μM as p66/p66). Previously, we have also shown that heterodimer production is more efficient at higher protein concentration, i.e., homodimer formation is necessary (Ilina et al., 2018).
Figure 5. Time-dependent proteolytic cleavage of p66 by HIV-1 PR monitored by SDS-PAGE.
Cleavage experiments were conducted in the (A, B) absence or (C, D) presence of RPV, and (B, D) presence or (A, C) absence of tRNALys3. In (E), p51 band intensities shown in panels A-D were quantified and plotted. Concentrations of p66 and PR were 4 μM, as p66/p66 homodimer, and 1 μM, respectively. Both tRNALys3 and RPV concentrations were 4 μM. See also Figure S2 – S4.
When the monomer component of the p66 sample was suppressed by addition of 4 μM RPV (a similar molar ratio was used for the SEC experiments), we found that PR-mediated processing of p66 was mostly unchanged (Figure 5C, Figure S2). Neither varying the RPV concentration (Figure S3), nor using efavirenz (EFV), which belongs to a different NNRTI class (Figure S4), altered the p66 processing kinetics. In contrast, addition of tRNALys3 to p66/p66 in the presence of RPV promoted efficient RT maturation, which was similar to that observed in the presence of tRNALys3 alone (Figures 5D, 5E). Collectively, these data show that NNRTIs, which induce p66/p66 homodimer formation, have minimal impact on p66 processing, suggesting that p66/p66 homodimer formation alone is not sufficient to drive proteolytic processing of p66 to p51 and the presence of tRNALys3 introduces a change that allows efficient processing.
Probing RPV-bound p66/p66 conformation in the absence and presence of tRNALys3
To further probe the RPV-induced conformational changes in p66/p66, we first titrated [U-2H], Ile δ1-[13CH3]-labelled p66/p66 with increasing concentrations of RPV and monitored chemical shifts of the protein by 1H-13C SOFAST-HMQC experiments. We found that some signal intensities in the RNH domain decreased and new signals appeared (Figure 6A). The most salient example is residue I434. In the apo-form, residue 434 appears as a single isolated resonance near 16 ppm 13C chemical shift (bottom of the spectrum); the intensity of this resonance (labelled A) decreased while a new resonance, B, appeared with increasing RPV concentration (Figure 6A). An analysis of the intensity change indicates a binding ratio [RPV]:[p66/p66] of 1:1 (Figure 6A, graph). This observation of two sets of signals in RPV-bound p66/p66 suggests introduction of conformational asymmetry in the RNH domain of p66/p66 (or rigorously speaking, chemical shift), with two folded RNH domains that have different resonance positions relative to each other. Despite this asymmetry, introduced by inhibitor binding, in vitro RT maturation of RPV-p66/p66 was similar to p66/p66 in the absence of RPV, with low efficiency (Figure 5). This suggests that conformational asymmetry alone is not sufficient to facilitate efficient RT maturation.
Figure 6. 1H-13C SOFAST-HMQC NMR spectra of [U-2H], Ile δ1-[13CH3]-labelled p66/p66.
HMQC spectra (A) in the absence (black) or presence (green) of RPV, and (B) in the presence of RPV (green) or RPV plus tRNALys3 (blue), recorded at 35 °C, and 1H-15N TROSY-HSQC NMR spectra of [U-2H, 15N]-labelled p66/p66 (C) in the absence (black) or presence (green) of RPV, and (D) in the presence of RPV, (green) or RPV plus tRNALys3 (blue), recorded at 20 °C. In (A) and (B), inset g raphs show relative intensity changes of residue 434 resonances A and B at different [RPV]:[p66/p66] or [tRNA]:[p66/p66-RPV] ratios. In (B), a selected region (box) is shown at high threshold level with slices taken at the dashed lines, the cross section of which is nearly at a random coil position. In (C), resonances that overlap with previously assigned resonances of the isolated thumb and RNH domains are circled by green and orange colours, respectively (Sharaf et al., 2014).
Next, we titrated p66/p66-RPV with tRNALys3, and monitored the p66 signals by 1H-13C SOFAST-HMQC experiments, to gain further insight into the conformational changes that facilitate RT maturation (Figure 6B). We found that resonance A of residue 434 decreased in signal intensity while resonance B remained stable, indicating that tRNALys3 influences the “A” RNH domain in p66/p66 homodimer more than the “B” RNH domain (Figure 6B) (described below). The observed change in the chemical shift of resonance A suggests either conformational change of a region that includes I434 or changes of the chemical environment surrounding I434, presumably by domain orientation changes or by interaction with tRNALys3. Consistent with tRNALys3 titration into p66/p66 alone (Figure 3A), tRNALys3 titration into p66/p66-RPV produced a slight increase in the resonances located in the random coiled region (Figure 6B, side panel).
In contrast to the 1H-13C SOFAST-HMQC experiments of Ile δ1 methyl groups, 1H-15N TROSY-HSQC did not show clear changes in signal positions for the amide backbone signals of p66/p66 upon RPV interaction; instead, only a reduction of amide backbone signal intensity was observed, including some of the thumb and RNH domain resonances (Figure 6C). This is consistent with the fact that the NNRTI-bound p66/p66 conformation is similar to that of the NNRTI-bound heterodimer (Sharaf et al., 2017), including possibly reduced RNH and thumb domain mobility, and that NNRTI rigidities the thumb conformation (Ivetac and McCammon, 2011; Schauer et al., 2014; Termiz and Bahar, 2002). tRNALys3 interaction with p66/p66-RPV further reduced molecular tumbling (Figure 6D), presumably due to dimer-oligomer equilibrium as seen in the SEC (Figure 4F, 4G).
In Figure 7, we summarize the observed NMR spectral changes, recorded at 35 °C, for three different residues in the RNH domain of RT: I434, I495 and I559. As described above, I434 exhibits a single signal in the spectrum of p66/p66 (resonance A, Figure 7A top), under experimental conditions in which ~80% of the p66 exists as a homodimer (Sharaf et al., 2014; Sluis-Cremer et al., 2000; Venezia et al., 2006; Venezia et al., 2009). Upon RPV binding, a second I434 signal is observed (resonance B; Figure 7B top). Addition of tRNALys3 eliminates resonance A and slightly changes the position of resonance B (resonance B’, Figure 7C top). This resonance B’ is similar to what is observed in the partially processed RT, i.e., containing both p66/p66 and p66/p51 (Figure 7D top). Although we do not know where the A resonance moved, we note that the resonance at the random coil position was increased in the presence of tRNALys3. Thus, it is possible that the region including I434 in subunit A (light yellow RNH domain in the cartoon of Figure 7C) is unfolded. Importantly, resonance A is absent in the p66/p51 spectrum, while resonance B’ is clearly present (Figure 7E top). Similar spectral changes were also observed at RNH domain residues I495 and I559 (Figure 7, the second and third rows). However, the chemical resonance at I495 in the p66/p51 heterodimer does not line up with the same chemical shift as the partially digested p66 (Figure 7D and 7E, the second row), suggesting that this residue may undergo internal dynamics. Data recorded at 20 °C indicate similar tendencies but exhibit more conformers, presumably due to slower rates of exchange (Figure S5).
Figure 7. Overview of the observed signal patterns of p66/p66 RNH domain residues I434, I495 and I559.
(A) p66/p66 only, (B) p66/p66 + RPV, (C) p66/p66 + RPV + tRNA, (D) partially digested p66/p66 sample and (E) p66/p51 in which only the p66 subunit is [U-2H]- and Ile δ1-[13CH3] labelled. Spectra in panels (A – D) were recorded at 35 °C while those in panel (E) were recorded at 35 °C. Cartoon at the bottom indicates conformational changes deduced from the observed spectra in each condition. The A designation in the spectra indicates NMR resonance positions stemming from the p66/p66 homodimer while B and B’ indicate newly generated resonance positions upon RPV interaction and partial digestion of p66/p66, respectively. See also Figure S5.
Based on these spectral changes and previous 19F NMR that monitored residue 181 located at the NNRTI binding pocket of p66/p51 and p66/p66 (Sharaf et al., 2016; Sharaf et al., 2017), the following scenario for p66/p66 conformational changes is derived (cartoons at the bottom of Figure 7A – 7E). (i) p66/p66 is in equilibrium with p66 monomer and exhibits one set of stable signals, with the two RNH domains in the p66/p66 homodimer folded and symmetrical. (ii) RPV binding induces some asymmetry, or conformational change, in one RNH domain to create an environment similar to that of the RNH domain in p66/p51, such that the p51-RNH site is protected (orange in the cartoon of Figure 7C). However, this conformational change is not sufficient to drive proteolytic processing. (iii) tRNA interaction affects the “A” peak within the RNH domain (yellow in the cartoon of Figure 7C), which is the subunit that is cleaved by PR (note the reduced intensity of peak A in Figure 7D compared to 7A). Overall, tRNALys3 generates partial unfolding of the protein, presumably of the RNH domain region, in the presence and absence of RPV (Figure 3).
Knockdown of KARS in 293T cells affects intracellular RT processing and reduces virus particle production
Collectively, our data underscore that tRNALys3 binding to the p66/p66 RT homodimer triggers the necessary conformational changes that facilitate PR access to the cleavage site. During the HIV-1 life-cycle, tRNALys3 is essential as a primer for reverse transcription reaction and is recruited into the budding virus through its interaction with KARS and Gag-Pol (Cen et al., 2002; Cen et al., 2001; Khorchid et al., 2000; Kleiman and Cen, 2004; Kleiman et al., 2010; Mak et al., 1994; Mak et al., 1997). However, it is unknown whether tRNALys3 affects RT maturation during viral replication. Thus, to investigate the role of tRNALys3 in RT maturation, we knocked down KARS expression in 293T cells by siRNA, and then transfected these cells with a full-length replication competent molecular clone of HIV-1 (HIV-1 LAI). We anticipated that this knockdown would impact virus replication, Gag-Pol polyprotein processing in the host cell and/or virus, and possibly the formation of the reverse-transcription-initiation complex. It has been previously shown that KARS knockdown does not alter general protein translation (Nam et al., 2015). Forty-eight hours post HIV-1LAI transfection, we evaluated RT expression in both the 293T cells and in purified viral particles.
The siRNA knockdown of KARS expression in the 293T cells was stable for the duration of the experiment (Figure 8A). We found intracellular accumulation of RT that was not observed in the control cells (Figure 8B and 8C). Interestingly, the KARS knockdown cells accumulated p66, which did not appear to be efficiently processed to p51 by HIV-1 PR (Figure 8B and 8C), indicating a possible effect of tRNALys3 on RT maturation within the cellular environment. Compared to control cells, KARS knockdown resulted in a significant reduction in viral particle production, as assessed by quantification of p24 (Figure 8D). However, in the viral particles that were produced from KARS knock-down cells, the p66:p51 ratio was 1:1 (Figure 8E and 8F), with no difference in relative infectivity (as measured in TZM-bL cells) between the viruses generated from the control and KARS-knockdown cell lines (Figure 8G). These observations may suggest a role for tRNALys3 in viral assembly, which is beyond the scope of the current study. We could not measure tRNALys3 levels in the viral particles produced by KARS-knockdown cell lines due to low virus production of these cells.
Figure 8. siRNA mediated knockdown of KARS in 293T cells.
(A) Western blot analysis of KARS and B-actin expression in 293T cells 48 h post HIV-1 transfection; (B) Western blot of intracellular RT expression; (C) Densiometric analysis of (B); Amount of HIV-1 produced, as assessed by p24, from the KARS-knockdown and control 293T cells; (E) Virion associated RT and p24; (F) Densiometric analysis of (E); Single-cycle infectivity of HIV-1 generated from KARS-knockdown and control 293T cells as assessed in TZM-bL cells. The data in (C), (D), (F) and (G) are reported as the mean ± standard error from 3 independent experiments.
DISCUSSION
In all structures of the mature p66/p51 heterodimer, the p51-RNH cleavage site is sequestered in a p-sheet within the RNH domain and is inaccessible to PR (Figure. 1B). Thus, the pathways involved in maturation of the asymmetric p66/p51 heterodimer are unknown. Using an in vitro RT maturation assay, we previously demonstrated that interaction of tRNALys3 with the p66/p66 homodimer enhances specific cleavage by PR at the p51-RNH cleavage site, resulting in p66/p51 formation (Ilina et al., 2018). The mechanisms by which tRNALys3 enhances p66/p51 heterodimer production, however, are unclear and could involve its ability to increase p66/p66 homodimer formation and/or introduce conformational changes, particularly in the RNH domain of RT, that facilitate PR-mediated processing of p66 to p51. Thus, we assessed the impact of tRNALys3 interaction on p66/p66 conformation in solution using 1H-13C HMQC NMR of 3C δ1-Ile signals of p66, to assess specific signals with high sensitivity, and using 1H-15N TROSY-HSQC NMR of [U-2H,15N]-labelled p66, to gain insight into overall conformational changes in the protein.
The results indicate a partial unfolding of p66/p66, reduction of thumb domain motion, and reduction in the mobility of at least one RNH domain upon tRNALys3 interaction (Figure 3). In addition, a slight increase in the signal intensity proximal to the random coil position of the Ile-δ1 methyl group was observed (Figure 3). In large protein NMR, even a small number of fragments, can give significant signals, due to the small rotational correlation time of fragments compared to that of the large protein. Such fragments could be introduced to a sample upon cleavage by contaminated E. Coli enzyme; however, in this study, the increases in the unfolded signals detected in the 1H-13C and 1H-15N data are not due to generation of fragmented protein products, as shown in the SDS gels (Figures S6 and S7).
To reduce the p66 monomer fraction in our samples, we utilized NNRTIs that are potent chemical enhancers of p66/p66 homodimer formation (Hughes, 2001; Tachedjian et al., 2001). Using an in vitro maturation assay (Figure 5), we unequivocally show that NNRTIs do not facilitate proteolytic processing of p66 to p51 whereas addition of tRNALys3 to the NNRTI-bound p66/p66 resulted in efficient cleavage. Our NMR experiments show that NNRTI binding induced conformational changes in p66/p66 homodimer that extended to the RNH domains (Figure 6A). However, these conformational changes were not sufficient to induce efficient PR processing at the p51-RNH site (Figure 5C). Indeed, the addition of tRNALys3 induced additional changes particularly in the RNH domain (Figure 6B), with an increase in the unfolded resonance similar to that observed in the experiments without RPV. Collectively, these data show that specific conformational changes in the p66/p66 homodimer, enhanced by nucleic acid, are needed for efficient RT maturation.
In the Ile-δ1 methyl 1H-13C HMQC spectrum of p66/p66-RPV in the presence of tRNALys3, we observed resonance changes for residues in the finger-palm and thumb domains, 202 and 274, as well as those in the RNH domain. Thus, tRNALys3 is expected to bind at the canonical nucleic acid binding site that spans the entire p51 domain in p66 (Sarafianos et al., 2001). This notion is consistent with the observed reduction in thumb domain signals upon tRNALys3 binding to p66, monitored by 1H-15N TROSY-HSQC NMR (Figure 3B). Previous 19F NMR studies have suggested that the NNRTI binding pocket of p66/p66 is similar to that of p66/p51 (Sharaf et al., 2016; Sharaf et al., 2017). If a p66/p51 like structure is present in the p66/p66-RPV form, our observation that the p66/p66-RPV bound conformation is asymmetric but not ideal for p66/p51 production in the absence of tRNALys3 suggests a steric effect of tRNALys3 on one of the RNH domains. Since we were unable to identify the specific region that undergoes partial unfolding, the RNH domain signal observed in the tRNALys3-bound p66/p66 in the 1H-15N TROSY-HSQC NMR spectrum (Figure 3B) could correspond to domain A or B in the Ile-δ1 methyl 1H-13C HMQC of Figure 6B or to the tRNALys3-p66 monomer form. In either case, our data do not support the model that p66/p66 alone, in the absence of nucleic acid or PR, slowly changes conformation in solution (Zheng et al., 2015; Zheng et al., 2014; Zheng et al., 2016), as we did not observe such a conformational change. Even if there is a minor conformer, it may be separated by a high energy barrier from the major population in p66/p66 alone.
During the HIV-1 life-cycle, tRNALys3 is recruited into the budding virus through its interaction with KARS and Gag-Pol (Cen et al., 2002; Cen et al., 2001; Khorchid et al., 2000; Kleiman and Cen, 2004; Kleiman et al., 2010; Mak et al., 1994; Mak et al., 1997). To investigate the role of tRNALys3 in RT maturation, we knocked down KARS expression in 293T cells by siRNA, and then transfected these cells with a full-length replication competent molecular clone of HIV-1 (HIV-1LAI). Interestingly, we found intracellular accumulation of inefficiently processed RT in cells with reduced KARS. Since KARS knockdown significantly reduced the amount of virus production, we think that the accumulated Gag-Pol and the products in the cell showed such difference in RT maturation in the intra cellular environment. Thus, the result is not a direct evidence of the RT maturation in virus, but suggests a possible role of KARS in the intracellular maturation of RT and supports application of tRNALys3 in our in vitro data.
The reduction of the amount of virus production is consistent with the notion that KARS is important for viral packaging of tRNALys3 and Gag-Pol (Cen et al., 2004; Guo et al., 2003). The virus that was produced from the KARS-knockdown cells, however, contained p66/p51 RT and exhibited similar infectivity to the control virus. While we observed robust knockdown of KARS in the 293T cells, there was residual protein expression, which may have been sufficient to facilitate some virus production. However, how tRNALys3 affects viral packaging is beyond the scope of the current study. Similarly, there are studies that have investigated the order of PR cleavage sites in Gag-Pol using different systems (Abram et al., 2010; Pettit et al., 2005a; Pettit et al., 2004; Pettit et al., 2005b). In this regard, our study does not address the entire RT maturation pathway from Gag-Pol processing to p66/p51 production, but illuminates the RT conformational characteristics in relation to functional heterodimer maturation.
STAR METHODS
LEAD CONTACT AND MATERIALS AVAILABILITY
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Rieko Ishima (ishima@pitt.edu).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Bacterial Strains
HIV-1 RT was expressed in commercially purchased Escherichia coli BL21(DE3) or Rosetta 2(DE3) cell lines.
Cells
We have used the reliable cell lines from AIDS reagent program (TZM-bL) or the American Type Culture Collection (HEK 293T). The 293T cell line is a highly transfectable derivative of human embryonic kidney 293 cells, and contains the SV40 T-antigen. TZM-bl is a HeLa cell line. Both cell lines tested negative for bacteria, mycoplasma and fungi.
Viruses
We have used HIV-1LAI which is an X4 tropic strain routinely used in in vitro HIV studies. All virus preparations were carried out in a Biosafety Level 2+ (BSL-2+) containment laboratory in accordance with proper BSL-2+ safety procedures.
METHOD DETAILS
In vitro RT maturation experiments
RT proteins, p66/p51 and p66 alone were prepared using the p6HRT-PROT plasmid (Le Grice and Gruninger-Leitch, 1990), as described previously (Ilina et al., 2018). p66 protein was expressed in BL21 (DE3) E. coli cells and purified using a Strep-Trap HP column (GE Healthcare Lifesciences, Piscataway, NJ) and gel filtration on a Superdex 200 column (GE Healthcare, Piscataway, NJ). Purified proteins were stored in 25 mM sodium phosphate, pH 7.0, 250 mM NaCl and 50% v/v glycerol at −80 °C. HIV-1 PR, clone purchased from ATUM (Newark, CA), was expressed and purified as described previously (Khan et al., 2018). Rilpivirine (RPV) and efavirenz (EFV) (Selleckchem, Houston, TX, and NIH AIDS reagent program) stock solutions, at 50 mM concentration, were prepared in 100% DMSO (Sharaf et al., 2016).
Proteolytic processing of p66 protein by HIV-1 PR was carried out in 20 mM sodium acetate buffer, pH 5.2, at 37 °C. RPV was added to the reaction with a final DMSO concentration of 2%. All reactions that did not contain RPV included 2% DMSO for control. 4 μM of p66/p66, calculated as a dimer, was incubated for 5 min at room temperature in four conditions: p66 alone; with 4 μM tRNALys3; with 4 μM RPV; with 4 μM tRNALys3 and 4 μM RPV. Processing was initiated by addition of HIV-1 PR to a final concentration 1 μM and incubated at 37°C. Aliquots were collected following different time intervals and quenched by the addition of Tricine sample loading buffer (Bio-Rad Laboratories, Berkeley, CA) and denatured at 95 °C for 5 min. Samples were loaded onto precast 4–15% Tris-glycine gels (Bio-Rad), stained with Bio-safe Coomassie stain (Bio-Rad) and analyzed with Amersham Imager 600 (GE Healthcare Life Sciences).
In vitro tRNA transcription
tRNALys3 was prepared using a DNA template for tRNA transcription, which was PCR amplified using the following oligonucleotides as primers (Miller et al., 2004):
Coding strand: 5’-GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCCA
Reverse primer: 5’-mUmGGCGCCCGAACAGGGACTTG
Forward Primer: 5’-AATTCCTGCAGTAATACGACTCACTATAGCCCGGATAGCTCAGTCG
PCR products were purified with phenol/chloroform extraction and used in transcription reactions. In vitro transcription of tRNALys3 was performed using NTPs and T7 RNA polymerase (Thermo Fisher Scientific, USA), as described by Sherlin et al (Sherlin et al., 2001), and purified by anion exchange using Hi Trap Q HP column (GE Healthcare, Piscataway, NJ), desalted with PD-10 columns (GE Healthcare, Piscataway, NJ) and aliquoted for further use. Prior to each experiment tRNA was reannealed by heating at 95 °C for 5 min flowed by slow cooling to room temperature.
Analytical Size Exclusion Chromatography to monitor p66/p66-tRNA interaction
Size Exclusion Chromatography (SEC) experiments were performed using a 24-ml analytical Superdex 200 Increase 10/300 GL column (GE Healthcare), at room temperature at a flow rate of 0.5 mL/min. Either p66 protein at 20 – 46 μM, with 0 – 25 μM tRNALys3 or the tRNALys3 alone that contains tracer tRNA 3′-end labeled with pCp-Cy3 (Jena Bioscience, Jena, Germany) was prepared in 25 mM Bis-tris buffer, pH 7.0, containing 100 mM NaCl, 1% DMSO, and 0.02% sodium azide. RPV was added at [p66:p66]:[RPV] = 1: 1.3 or 1.5 ratio. Each injection volume was 50 μL. Elution profiles were monitored by UV absorbance at 254 and 280 nm and, for the samples with tRNALys3, additionally by in-line Shimadzu RF-10AXL Fluorescence Detector with fluorescence excitation at 485 nm and the emission at 560 nm.
Sample preparation for NMR experiments
We used the same coding sequence of the RT p66 as described previously (Sharaf et al., 2014), except (i) a V559I polymorphism mutation was included to increase the number of Ile NMR resonances in 1H-13C NMR spectra and (ii) an N-terminal His6-fusion tag containing a TEV-protease cleavage site was added. [U-2H] and Ile δ1-[13CH3] labelled p66 and [U-2H,15N] labelled p66 was expressed using a published protocol (Tugarinov et al., 2006). In brief, isotopes were purchased from Cambridge Isotope Laboratories, Inc. (Tewksbury, MA) or MilliporeSigma (St. Louis, MO). Proteins were expressed in Rosetta 2(DE3) cells and were purified using HisTrap HP columns (GE Healthcare, Piscataway, NJ) and gel filtration on a Superdex 200 column (GE Healthcare, Piscataway, NJ). The N-terminal fusion tag was digested with His6-TEV-protease. The p66 was separated from the remaining digestion products using a HisTrap HP column (GE Healthcare, Piscataway, NJ), followed by a final purification step on a Superdex 200 column (GE Healthcare, Piscataway, NJ). Purified proteins were exchanged to a buffer containing 50 mM Tris, 250 mM NaCl, 0.02% NaN3 and 50% v/v Glycerol, pH 8.0 and stored at −80 °C.
NMR experiments
All the NMR experiments were recorded on a Bruker Avance 900 spectrometer. Prior to NMR, the buffers of all proteins were exchanged to a deuterated and non-deuterated, the latter containing 5% D2O, 25 mM Bis-Tris buffer pH 7.1 containing 100 mM KCl, 0.02% NaN3, and 5% v/v Glycerol-d8 (named NMR buffer hereafter) for [U-2H] and Ile δ1-[13CH3] labelled p66/p66, and for [U-2H,15N] labelled p66/p66, respectively. NMR experiments in the presence of RPV were performed by adding 0.5–1.0% d6-DMSO in the NMR buffer.
The time-dependent spectral changes of 35 μM, [U-2H] and Ile δ1-[13CH3] labelled p66/p66 were monitored by recording 1H-13C SOFAST-HMQC spectra using Bruker sequence, sf_metrosygpph, at time points 0, 4.85, 15.29, 20.12, 24.97, 29.80, 37.27, 42.42, 47.27, 52.10 and 56.95 hours at 35 °C. The time point indicates the starting time of each HSQC spectrum which took 4.85 hours to complete. Because over 90% of p66 is expected to form a homodimer (Sharaf et al., 2014; Venezia et al., 2006), we simplify the expression as p66/p66, to complement the p66/p51 heterodimer description. The NMR spectra of the Ile δ1-labelled p66/p66 were compared to those of (1) p66/p51; and (2) of partially matured RT in vitro. For (1), p66/p51 protein was prepared by using [U-2H], Ile δ1-[13CH3]-labelled p66 and unlabelled p51. Both p66/p66 and p66/p51 spectra were recorded using the NMR buffer, but without 100 mM KCl, at 35 °C. For (2), partial matu ration was achieved by adding 3 μM PR and ~20 μM tRNALys3 to the 25 μM [U-2H], Ile δ1-[13CH3]-labelled p66/p66 solution in the NMR buffer, incubating at 35 °C for 3 hours, followed by addition of the P R inhibitor, darunavir (obtained from NIH AIDS reagent program), to stop the reaction.
Spectral changes of p66/p66 upon interaction with tRNALys3 or RPV and with both tRNALys3 and RPV were monitored by recording 1H-13C SOFAST-HMQC spectra of a ~25 μM [U-2H], Ile δ1-[13CH3]-labelled p66/p66 in the deuterated NMR buffer at the anticipated ratios of tRNALys3/[p66/p66] = 1.4, RPV/[p66/p66] = 2.0, and tRNALys3/[p66/p66-RPV] = 1.0, at 35 °C. Titrations of p66/p 66 with RPV and with tRNALys3 in the presence of RPV were monitored by recording 1H-13C SOFAST-HMQC spectra of the Ile δ1-labelled p66/p66, at 35 °C, at relative concentrations of [RPV]:[p66/p66] of 0:1,0.5:1, 1:1, and 2:1 and at [tRNA]:[p66/p66-RPV] of 0:1,1:1,2:1. These p66/p66 spectra, in the presence of tRNALys3, RPV, or both, were also recorded at 20 °C.
Spectral changes of p66/p66 upon interaction with these molecules were also monitored by recording 1H-15N TROSY-HSQC spectra of 75 μM [U-2H, 15N]-labelled p66/p66 in the protonated NMR buffer at anticipated ratios of tRNALys3/[p66/p66] = 1.0, RPV/[p66/p66] = 1.3, and tRNALys3/[p66/p66-RPV] = 1.0, at 20 °C. All the NMR spectra were proc essed using nmrPipe and analyzed using nmrDraw, nmrView or ccpNMR (Delaglio et al., 1995; Johnson, 2004; Vranken et al., 2005).
KARS knockdown experiments
Small interfering RNAs (siRNAs) targeting KARS, as well as a control scrambled sequence control siRNA, were purchased from Sigma (St Louis, MO, USA). 293T cells were transfected with 80-nmol/L siRNA using the Neon Transfection System (Thermo Fisher Scientific, USA), according to the manufacturer’s protocol. The efficiency of gene knockdown was assessed by western blot analyses of protein expression. Anti-KARS antibodies were also purchased from Sigma. HEK 293T cells (ATCC® CRL-3216™) were transfected with HIV-1LAI (Shi and Mellors, 1997) and RT and p24 antigen expression levels were measured by Western Blot (Abram and Parniak, 2005). Viral infectivity was assessed using TZM-bl cells (Giacobbi and Sluis-Cremer, 2017).
QUANTIFICATION AND STATISTICAL ANALYSIS
Figure 2: Bars show means ± S.D of intensity decay of 42 resonances picked by nmrDraw software.
Figure 5: Repeated experiment, repeated experiment using EFV, and experiments by varying RPV concentration are shown in Figure S1 – S3.
Figure 6: Error bars in the graph were calculated from intensity uncertainty by nmrDraw software
Figure 8: Bars show mean ± standard error from 3 independent experiments.
DATA AND CODE AVAILABILITY
All time dependence of the NMR spectra is available in Mendeley (http://dx.doi.Org/10.17632/zkc75shfc5.1).
Supplementary Material
KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-KARS antibodies | Sigma Aldrich | SAB5300071 |
| RT antigen | Abcam | ab63911 |
| p24 antigen | Abcam | ab63913 |
| Bacterial and Virus Strains | ||
| Escherichia coli Rosetta 2(DE3) - Novagen | Millipore Sigma | 71400 |
| Escherichia coli BL21(DE3) - Novagen | Millipore Sigma | 70235 |
| HEK 293T cells | ATCC | CRL-3216 |
| TZM-bl cells | NIH AIDS Reagent Program | 8129 |
| HIV-1LAI virus strain | NIH AIDS Reagent Program | 2522 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Rilpivirine | selleckchem | S7303 |
| Additional Rilpivirine | NIH AIDS Reagent Program | 12147 |
| Efavirenz | NIH AIDS Reagent Program | 4624 |
| Darunavir | NIH AIDS Reagent Program | 11447 |
| Glycerol-d8 | Millipore Sigma | 447498–1G |
| 2H2O | Millipore Sigma | 151882 |
| dimethyl sulfoxide | Millipore Sigma | D4540–500ML |
| D-glucose (1,2,3,4,5,6,6-D7, 97–98%) | Cambridge Isotope Lab | DLM-2062–1 |
| α-ketobutyric acid, sodium salt (methyl 13C; 3,3-D2) | Cambridge Isotope Lab | CDLM-7318 |
| l5NH4Cl | Cambridge Isotope Lab | NLM-467–5 |
| dimethyl sulfoxide-d6 | Cambridge Isotope Lab | DLM-10–5X1 |
| DSS | ||
| pCp-Cy3 | Jena Bioscience | NU-1706-CY3 |
| T7 RNA Polymerase | Thermo Fisher Scientific | AM2718 |
| Phusion PCR kit | Thermo Fisher Scientific | F553L |
| Oligonucleotides | Oligonucleotides | Oligonucleotides |
| siRNA | Millipore Sigma | NM_005548 |
| Recombinant DNA | ||
| HIV-1 RT (1–560) | ATUM (former DNA2.0) | N/A |
| pJexpress404 | ATUM (former DNA2.0) | N/A |
| pET15b | Millipore Sigma | 69661 |
| Deposited Data | ||
| structure of HIV-1 RT (used) | Lansdon et al., 2010 | PDB:3MEE |
| Software and Algorithms | ||
| NMRPipe | IBBR/NIST | http://www.ibbr.umd.edu/nmrpipe/ |
| NMRview | One Moon Scientific | http://onemoonsci.com/ |
| ccpNMR | CCPN | http://www.ccpn.ac.uk/ |
Highlights.
tRNALys3 mediates maturation of HIV-1 reverse transcriptase (RT) in vitro.
Conformational states that enhance the RT maturation were investigated using NMR.
Lys-tRNA synthetase knockdown expt suggests the tRNALys3 role in the RT maturation.
Biochemical, biophysical, and virological data support the RT maturation model.
ACKNOWLEDGEMENTS
We thank Michel Guerrero to technical support and Teresa Brosenitsch for reading the manuscript. This study was supported by grants from the National Institutes of Health (R01GM105401 to R.I., U54AI150472 and R01GM118012 to S.G.S, R01GM068406 to N.S.C, and P50AI150481 to R.I. and N.S.C.), and the MEXT-Supported Program for the Strategic Research Foundation at Private Universities in Japan (the term, 2011-2015, to G.K.).
Footnotes
DECLARATION OF INTERESTS
The authors declare no competing interests.
SUPPLEMENTARY INFORMATION
The following supplementary data are available: Figure S1, all the time course NMR spectra used to generate Figure 2A–2C: Figure S2, entire gels shown in Figure 5 and additional gels to show data reproducibility; Figure S3, RPV-dose dependence of p66 processing by PR; Figure S4, time dependence of p66 processing by PR in the absence and presence of EFV; Figure S5, Overview of the observed signal patterns of p66 RNH domain residues I434, I495 and I559 recorded at 20 °C; Figure S6. SDS gels of protein samples used to record 1H-13C SOFAST-HMQC NMR spectra of p66; Figure S7. SDS gels of protein samples used to record 1H-15N TROSY HSQC spectra of p66.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Abram ME, and Parniak MA (2005). Virion instability of human immunodeficiency virus type 1 reverse transcriptase (RT) mutated in the protease cleavage site between RT p51 and the RT RNase H domain. Journal of Virology 79, 11952–11961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abram ME, Sarafianos SG, and Parniak MA (2010). The mutation T477A in HIV-1 reverse transcriptase (RT) restores normal proteolytic processing of RT in virus with Gag-Pol mutated in the p51-RNH cleavage site. Retrovirology 7, 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bakhanashvili M, and Hizi A (1994). Interaction of the reverse transcriptase of human immunodeficiency virus type 1 with DNA. Biochemistry 33, 12222–12228. [DOI] [PubMed] [Google Scholar]
- Bavand MR, Wagner R, and Richmond TJ (1993). HIV-1 reverse transcriptase: polymerization properties of the p51 homodimer compared to the p66/p51 heterodimer. Biochemistry 32, 10543–10552. [DOI] [PubMed] [Google Scholar]
- Braz VA, Holladay LA, and Barkley MD (2010). Efavirenz binding to HIV-1 reverse transcriptase monomers and dimers. Biochemistry 49, 601–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cen S, Javanbakht H, Kim S, Shiba K, Craven R, Rein A, Ewalt K, Schimmel P, Musier-Forsyth K, and Kleiman L (2002). Retrovirus-specific packaging of aminoacyl-tRNA synthetases with cognate primer tRNAs. J Virol 76, 13111–13115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cen S, Javanbakht H, Niu M, and Kleiman L (2004). Ability of wild-type and mutant lysyl-tRNA synthetase to facilitate tRNA(Lys) incorporation into human immunodeficiency virus type 1. J Virol 78, 1595–1601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cen S, Khorchid A, Javanbakht H, Gabor J, Stello T, Shiba K, Musier-Forsyth K, and Kleiman L (2001). Incorporation of lysyl-tRNA synthetase into human immunodeficiency virus type 1. J Virol 75, 5043–5048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chattopadhyay D, Evans DB, Deibel MR Jr., Vosters AF, Eckenrode FM, Einspahr HM, Hui JO, Tomasselli AG, Zurcher-Neely HA, Heinrikson RL, et al. (1992). Purification and characterization of heterodimeric human immunodeficiency virus type 1 (HIV-1) reverse transcriptase produced by in vitro processing of p66 with recombinant HIV-1 protease. J Biol Chem 267, 14227–14232. [PubMed] [Google Scholar]
- Clark AD, JacoboMolina A, Clark P, Hughes SH, and Arnold E (1995). Crystallization of human immunodeficiency virus type 1 reverse transcriptase with and without nucleic acid substrates, inhibitors, and an antibody fab fragment. Method Enzymol 262, 171–185. [DOI] [PubMed] [Google Scholar]
- Coffin JM, Hughes SH, and Varmus HE (1997). Retroviruses (Plainview, NY: Cold Spring Harbor Laboratory Press; ). [PubMed] [Google Scholar]
- Davies JF 2nd, Hostomska Z, Hostomsky Z, Jordan SR, and Matthews DA (1991). Crystal structure of the ribonuclease H domain of HIV-1 reverse transcriptase. Science 252, 88–95. [DOI] [PubMed] [Google Scholar]
- Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, and Bax A (1995). NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6, 277–293. [DOI] [PubMed] [Google Scholar]
- Divita G, Rittinger K, Geourjon C, Deleage G, and Goody RS (1995). Dimerization kinetics of HIV-1 and HIV-2 reverse transcriptase: a two step process. J Mol Biol 245, 508–521. [DOI] [PubMed] [Google Scholar]
- Figueiredo A, Moore KL, Mak J, Sluis-Cremer N, de Bethune MP, and Tachedjian G (2006). Potent nonnucleoside reverse transcriptase inhibitors target HIV-1 Gag-Pol. PLoS Pathog 2, e119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giacobbi NS, and Sluis-Cremer N (2017). In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection. Antimicrob Agents Chemother 61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo F, Cen S, Niu M, Javanbakht H, and Kleiman L (2003). Specific Inhibition of the Synthesis of Human Lysyl-tRNA Synthetase Results in Decreases in tRNALys Incorporation, tRNA3LysAnnealing to Viral RNA, and Viral Infectivity in Human Immunodeficiency Virus Type 1. J Virol 77, 9817–9822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hughes SH (2001). Molecular matchmaking: NNRTIs can enhance the dimerization of HIV type 1 reverse transcriptase. Proceedings of the National Academy of Sciences of the United States of America 98, 6991–6992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ilina TV, Slack RL, Elder JH, Sarafianos SG, Parniak MA, and Ishima R (2018). Effect of tRNA on the Maturation of HIV-1 Reverse Transcriptase. J Mol Biol 430, 1891–1900. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ivetac A, and McCammon JA (2011). Molecular recognition in the case of flexible targets. Curr Pharm Des 17, 1663–1671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jacobo-Molina A, and Arnold E (1991). HIV reverse transcriptase structure-function relationships. Biochemistry 30, 6351–6356. [DOI] [PubMed] [Google Scholar]
- Jacobo-Molina A, Ding J, Nanni RG, Clark ADJ, Lu X, Tantillo C, Williams RL, Kamer G, Ferris AL, Clark P, et al. (1993). Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 A resolution shows bent DNA. Proc Natl Acad Sci U S A 90, 6320–6324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang M, Mak J, Ladha A, Cohen E, Klein M, Rovinski B, and Kleiman L (1993). Identification of tRNAs incorporated into wild-type and mutant human immunodeficiency virus type 1. J Virol 67, 3246–3253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang M, Mak J, Wainberg MA, Parniak MA, Cohen E, and Kleiman L (1992). Variable tRNA content in HIV-1IIIB. Biochem Biophys Res Commun 185, 1005–1015. [DOI] [PubMed] [Google Scholar]
- Johnson BA (2004). Using NMRView to visualize and analyze the NMR spectra of macromolecules. Methods Mol Biol 278, 313–352. [DOI] [PubMed] [Google Scholar]
- Katz RA, and Skalka AM (1994). The retroviral enzymes. Annu Rev Biochem 63, 133–173. [DOI] [PubMed] [Google Scholar]
- Khan SN, Persons JD, Paulsen JL, Guerrero M, Schiffer CA, Kurt-Yilmaz N, and Ishima R (2018). Probing Structural Changes among Analogous Inhibitor-Bound Forms of HIV-1 Protease and a Drug-Resistant Mutant in Solution by Nuclear Magnetic Resonance. Biochemistry 57, 1652–1662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khorchid A, Javanbakht H, Wise S, Halwani R, Parniak MA, Wainberg MA, and Kleiman L (2000). Sequences within Pr160gag-pol affecting the selective packaging of primer tRNA(Lys3) into HIV-1. J Mol Biol 299, 17–26. [DOI] [PubMed] [Google Scholar]
- Kleiman L, Caudry S, Boulerice F, Wainberg MA, and Parniak MA (1991). Incorporation of tRNA into normal and mutant HIV-1. Biochem Biophys Res Commun 174, 1272–1280. [DOI] [PubMed] [Google Scholar]
- Kleiman L, and Cen S (2004). The tRNALys packaging complex in HIV-1. Int J Biochem Cell Biol 36, 1776–1786. [DOI] [PubMed] [Google Scholar]
- Kleiman L, Jones CP, and Musier-Forsyth K (2010). Formation of the tRNALys packaging complex in HIV-1. FEBS Lett 584, 359–365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kohlstaedt LA, Wang J, Friedman JM, Rice PA, and Steitz TA (1992). Crystal structure at 3.5 A resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science 256, 1783–1790. [DOI] [PubMed] [Google Scholar]
- Lansdon EB, Brendza KM, Hung M, Wang R, Mukund S, Jin D, Birkus G, Kutty N, and Liu X (2010). Crystal structures of HIV-1 reverse transcriptase with etravirine (TMC125) and rilpivirine (TMC278): implications for drug design. J Med Chem 53, 4295–4299. [DOI] [PubMed] [Google Scholar]
- Le Grice SF, and Gruninger-Leitch F (1990). Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur J Biochem 187, 307–314. [DOI] [PubMed] [Google Scholar]
- Lindhofer H, von der Helm K, and Nitschko H (1995). In vivo processing of Pr160gag-pol from human immunodeficiency virus type 1 (HIV) in acutely infected, cultured human T-lymphocytes. Virology 214, 624–627. [DOI] [PubMed] [Google Scholar]
- Lowe DM, Aitken A, Bradley C, Darby GK, Larder BA, Powell KL, Purifoy DJ, Tisdale M, and Stammers DK (1988). HIV-1 reverse transcriptase: crystallization and analysis of domain structure by limited proteolysis. Biochemistry 27, 8884–8889. [DOI] [PubMed] [Google Scholar]
- Mak J, Jiang M, Wainberg MA, Hammarskjold M-L, Rekosh D, and Kleiman L (1994). Role of Pr160gag-pol in mediating the selective incorporation of tRNALys into human immunodeficiency virus type 1 particles. J Virol 68, 2065–2072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mak J, Khorchid A, Cao Q, Huang Y, Lowy I, Parniak MA, Prasad VR, Wainberg MA, and Kleiman L (1997). Effects of mutations in Pr160gag-pol upon tRNA(Lys3) and Pr160gag-pol incorporation into HIV-1. J Mol Biol 265, 419–431. [DOI] [PubMed] [Google Scholar]
- Mattei S, Anders M, Konvalinka J, Krausslich HG, Briggs JA, and Muller B (2014). Induced maturation of human immunodeficiency virus. J Virol 88, 13722–13731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miller JT, Khvorova A, Scaringe SA, and Le Grice SF (2004). Synthetic tRNALys,3 as the replication primer for the HIV-1HXB2 and HIV-1Mal genomes. Nucleic Acids Res 32, 4687–4695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nam SH, Kim D, Lee MS, Lee D, Kwak TK, Kang M, Ryu J, Kim HJ, Song HE, Choi J, et al. (2015). Noncanonical roles of membranous lysyl-tRNA synthetase in transducing cell-substrate signaling for invasive dissemination of colon cancer spheroids in 3D collagen I gels. Oncotarget 6, 21655–21674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nicholson LK, Kay LE, Baldisseri DM, Arango J, Young PE, Bax A, and Torchia DA (2002). Dynamics of methyl groups in proteins as studied by proton-detected carbon-13 NMR spectroscopy. Application to the leucine residues of staphylococcal nuclease. Biochemistry 31, 5253–5263. [DOI] [PubMed] [Google Scholar]
- Pavon-Eternod M, Wei M, Pan T, and Kleiman L (2010). Profiling non-lysyl tRNAs in HIV-1. RNA 16, 267–273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pettit SC, Clemente JC, Jeung JA, Dunn BM, and Kaplan AH (2005a). Ordered processing of the human immunodeficiency virus type 1 GagPol precursor is influenced by the context of the embedded viral protease. J Virol 79, 10601–10607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pettit SC, Everitt LE, Choudhury S, Dunn BM, and Kaplan AH (2004). Initial cleavage of the human immunodeficiency virus type 1 GagPol precursor by its activated protease occurs by an intramolecular mechanism. J Virol 78, 8477–8485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pettit SC, Lindquist JN, Kaplan AH, and Swanstrom R (2005b). Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates. Retrovirology 2, 66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarafianos SG, Das K, Tantillo C, Clark AD Jr., Ding J, Whitcomb JM, Boyer PL, Hughes SH, and Arnold E (2001). Crystal structure of HIV-1 reverse transcriptase in complex with a polypurine tract RNA:DNA. EMBO J 20, 1449–1461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schauer GD, Huber KD, Leuba SH, and Sluis-Cremer N (2014). Mechanism of allosteric inhibition of HIV-1 reverse transcriptase revealed by single-molecule and ensemble fluorescence. Nucleic Acids Res 42, 11687–11696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharaf NG, Ishima R, and Gronenborn AM (2016). Conformational plasticity of the NNRTI-binding pocket in HIV-1 reverse transcriptase - A fluorine NMR study. Biochemistry 55, 3864–3873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharaf NG, Poliner E, Slack RL, Christen MT, Byeon IJ, Parniak MA, Gronenborn AM, and Ishima R (2014). The p66 immature precursor of HIV-1 reverse transcriptase. Proteins 82, 2343–2352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharaf NG, Xi Z, Ishima R, and Gronenborn AM (2017). The HIV-1 p66 homodimeric RT exhibits different conformations in the binding-competent and -incompetent NNRTI site. Proteins 85, 2191–2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharma SK, Fan N, and Evans DB (1994). Human immunodeficiency virus type 1 (HIV-1) recombinant reverse transcriptase. Asymmetry in p66 subunits of the p66/p66 homodimer. FEBS Lett 343, 125–130. [DOI] [PubMed] [Google Scholar]
- Sherlin LD, Bullock TL, Nissan TA, Perona JJ, Lariviere FJ, Uhlenbeck OC, and Scaringe SA (2001). Chemical and enzymatic synthesis of tRNAs for high-throughput crystallization. RNA 7, 1671–1678. [PMC free article] [PubMed] [Google Scholar]
- Shi C, and Mellors JW (1997). A recombinant retroviral system for rapid in vivo analysis of human immunodeficiency virus type 1 susceptibility to reverse transcriptase inhibitors. Antimicrob Agents Chemother 41, 2781–2785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sluis-Cremer N, Arion D, Abram ME, and Parniak MA (2004). Proteolytic processing of an HIV-1 pol polyprotein precursor: insights into the mechanism of reverse transcriptase p66/p51 heterodimer formation. International Journal of Biochemistry & Cell Biology 36, 1836–1847. [DOI] [PubMed] [Google Scholar]
- Sluis-Cremer N, Dmitrienko GI, Balzarini J, Camarasa MJ, and Parniak MA (2000). Human immunodeficiency virus type 1 reverse transcriptase dimer destabilization by 1-{spiro[4 ”-amino-2 “,2 “-dioxo-1 “,2 “-oxathiole-5 “,3 ‘-[2 ‘,5 ‘-bis-O-(tert-butyldimethylsilyl)-beta-D-ribofuranosyl]]}−3-ethylthymine. Biochemistry 39, 1427–1433. [DOI] [PubMed] [Google Scholar]
- Speck RR, Flexner C, Tian CJ, and Fu XF (2000). Comparison of human immunodeficiency virus type 1 Pr55(Gag) and Pr160(Gag-Pol) processing intermediates that accumulate in primary and transformed cells treated with peptidic and nonpeptidic protease inhibitors. Antimicrobial Agents and Chemotherapy 44, 1397–1403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tachedjian G, Moore KL, Goff SP, and Sluis-Cremer N (2005). Efavirenz enhances the proteolytic processing of an HIV-1 pol polyprotein precursor and reverse transcriptase homodimer formation. FEBS Lett 579, 379–384. [DOI] [PubMed] [Google Scholar]
- Tachedjian G, Orlova M, Sarafianos SG, Arnold E, and Goff SP (2001). Nonnucleoside reverse transcriptase inhibitors are chemical enhancers of dimerization of the HIV type 1 reverse transcriptase. Proc Natl Acad Sci U S A 98, 7188–7193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Termiz NA, and Bahar I (2002). Inhibitor binding alters the directions of domain motions in HIV-1 reverse transcriptase. Proteins 49, 61–70. [DOI] [PubMed] [Google Scholar]
- Tugarinov V, Kanelis V, and Kay LE (2006). Isotope labeling strategies for the study of high-molecular-weight proteins by solution NMR spectroscopy. Nat Protoc 1, 749–754. [DOI] [PubMed] [Google Scholar]
- Venezia CF, Howard KJ, Ignatov ME, Holladay LA, and Barkley MD (2006). Effects of efavirenz binding on the subunit equilibria of HIV-1 reverse transcriptase. Biochemistry 45, 2779–2789. [DOI] [PubMed] [Google Scholar]
- Venezia CF, Meany BJ, Braz VA, and Barkley MD (2009). Kinetics of association and dissociation of HIV-1 reverse transcriptase subunits. Biochemistry 48, 9084–9093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vranken WF, Boucher W, Stevens TJ, Fogh RH, Pajon A, Llinas M, Ulrich EL, Markley JL, Ionides J, and Laue ED (2005). The CCPN data model for NMR spectroscopy: development of a software pipeline. Proteins 59, 687–696. [DOI] [PubMed] [Google Scholar]
- Wapling J, Moore KL, Sonza S, Mak J, and Tachedjian G (2005). Mutations that abrogate human immunodeficiency virus type 1 reverse transcriptase dimerization affect maturation of the reverse transcriptase heterodimer. Journal of Virology 79, 10247–10257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wishart DS, Bigam CG, Holm A, Hodges RS, and Sykes BD (1995). (1)H, (13)C and (15)N random coil NMR chemical shifts of the common amino acids. I. Investigations of nearest-neighbor effects. J Biomol NMR 5, 332. [DOI] [PubMed] [Google Scholar]
- Zheng X, Mueller GA, Kim K, Perera L, DeRose EF, and London RE (2017). Identification of drivers for the metamorphic transition of HIV-1 reverse transcriptase. Biochem J 474, 3321–3338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng X, Perera L, Mueller GA, DeRose EF, and London RE (2015). Asymmetric conformational maturation of HIV-1 reverse transcriptase. Elife 4, e06359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng XH, Pedersen LC, Gabel SA, Mueller GA, Cuneo MJ, DeRose EF, Krahn JM, and London RE (2014). Selective unfolding of one Ribonuclease H domain of HIV reverse transcriptase is linked to homodimer formation. Nucleic Acids Research 42, 5361–5377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng XH, Pedersen LC, Gabel SA, Mueller GA, DeRose EF, and London RE (2016). Unfolding the HIV-1 reverse transcriptase RNase H domain - how to lose a molecular tug-of-war. Nucleic Acids Research 44, 1776–1788. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All time dependence of the NMR spectra is available in Mendeley (http://dx.doi.Org/10.17632/zkc75shfc5.1).








