Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2019 Aug 14;97(10):4171–4181. doi: 10.1093/jas/skz262

Impacts of postweaning growth rate of replacement beef heifers on their reproductive development and productivity as primiparous cows1

Kelsey M Schubach 1, Reinaldo F Cooke 1,, Alice P Brandão 1, Thiago F Schumaher 2, Ky G Pohler 1, David W Bohnert 3, Rodrigo S Marques 3
PMCID: PMC6776286  PMID: 31410478

Abstract

This experiment evaluated the effects of postweaning body weight (BW) gain of replacement beef heifers on their reproductive development and productivity as primiparous cows. Seventy-two Angus × Hereford heifers were ranked on day −6 of experiment (17 d after weaning) by age and BW (218 ± 1.6 d of age and 234 ± 3 kg of BW), and assigned to receive 1 of 3 supplementation programs from days 0 to 182: 1) no supplementation to maintain limited BW gain (LGAIN), 2) supplementation to promote moderate BW gain (MGAIN), or 3) supplementation to promote elevated BW gain (HGAIN). Heifers were maintained in 2 pastures (36 heifers/pasture, 12 heifers/treatment in each pasture) with free-choice alfalfa-grass hay, and supplements were offered individually 6 d per week. Heifer shrunk BW was recorded on days −6 and 183 for average daily gain (ADG) calculation. Blood samples were collected for puberty evaluation via plasma progesterone weekly from days 0 to 182. On day 183, heifers were combined into a single group and received the same nutritional management until the end of the experimental period (day 718). From days 183 to 253, heifers were assigned to a fixed-time artificial insemination program combined with natural service. Average daily gain from days 0 to 182 was greater (P < 0.01) in HGAIN vs. MGAIN and LGAIN (0.78, 0.60, and 0.37 kg/d, respectively; SEM = 0.02), and greater (P < 0.01) in MGAIN vs. LGAIN heifers. Puberty attainment by the beginning of the breeding season was also greater in HGAIN vs. MGAIN and LGAIN (87.5%, 62.5%, and 56.5%, respectively; SEM = 7.1) but similar (P = 0.68) between MGAIN vs. LGAIN heifers. A treatment × day interaction was detected (P < 0.01) for calving rate, as HGAIN heifers calved earlier compared with MGAIN and LGAIN heifers. Ten heifers per treatment were assessed for milk production via weigh-suckle-weigh at 56.8 ± 1.5 d postpartum, followed by milk sample collection 24 h later. No treatment differences were detected (P ≥ 0.16) for milk yield and composition. However, mRNA expression of GLUT1 in milk fat globules was less (P ≤ 0.02) in LGAIN vs. MGAIN and HGAIN heifers, and expression of GLUT8 mRNA was also less (P = 0.04) in LGAIN vs. HGAIN heifers. No treatment differences were detected (P ≥ 0.44) for offspring weaning BW. Collectively, results from this experiment indicate that HGAIN hastened the reproductive development of replacement heifers, without negatively affecting their milk productivity and offspring weaning weight as primiparous cows.

Keywords: beef heifers, growth, lactation, puberty, supplementation

Introduction

Cow–calf systems rely on the ability of beef females to initiate and maintain estrous cyclicity and ultimately produce a calf each year. Replacement beef heifers represent an opportunity to incorporate new genetics that will benefit both reproductive efficiency and profitability of cow–calf herds. In order for heifers to be efficacious, they need to attain puberty by 12 mo of age, conceive by 15 mo of age, and calve as 2-y-olds (Lesmeister et al., 1973). Therefore, management strategies that maximize the number of replacement heifers pubertal by 12 mo of age and pregnant as yearlings are critical to productivity of cow–calf operations.

Many factors, including nutrition, play a pivotal role in heifer development and puberty attainment. Endocrine activity involved in initiation of puberty is suppressed until the heifer is of sufficient size and body composition to be reproductively successful (Rawlings et al., 2003), typically 60%–65% of her mature body weight (BW; Patterson et al., 1992). Growing heifers fed to accelerate BW gain exhibit greater frequency of luteinizing hormone pulses and advanced onset of puberty (Cardoso et al., 2014). However, nursing beef heifers receiving creep-feeding beginning at 4 mo (Buskirk et al., 1996a) or 5 mo of age (Buskirk et al., 1996b) to increase preweaning average daily gain (ADG) had decreased milk production as primiparous cows. These outcomes were associated with greater fat accumulation in mammary tissues (Buskirk et al., 1996a), which impaired future lactation ability (Brown et al., 2005). Heifers with decreased milk yield utilize greater feed energy per unit of calf weaning weight, contributing to a reduction in lifetime calf weaning BW (Freking and Marshall, 1992).

Nevertheless, the most common period to manipulate heifer growth in typical cow–calf operations is between weaning at 7 mo of age and their first breeding season (Whittier, 1995; Funston et al., 2012). Buskirk et al. (1995) reported that increased postweaning ADG (0.6 vs. 0.4 kg/d) was beneficial to milk and overall productivity of traditionally weaned heifers; however, no mammary physiological responses were investigated to support these outcomes. To the best of our knowledge, research investigating the role of postweaning ADG and subsequent milk production in beef heifers is still limited. Based on the presented, we hypothesized that increased postweaning ADG of beef heifers weaned at 7 mo of age would hasten their puberty attainment without negatively affecting mammary development and subsequent lactation ability. Therefore, the objectives of this experiment were to evaluate the impacts of 3 levels of postweaning growth of beef heifers on their puberty attainment, pregnancy rates, as well as lactation and production responses as primiparous cows.

Materials and Methods

This experiment was conducted at the Oregon State University—Eastern Oregon Agricultural Research Center (Burns, OR). All animals were cared for in accordance with acceptable practices and experimental protocols reviewed and approved by the Oregon State University, Institutional Animal Care and Use Committee (#4864). This experiment was divided into 3 phases: 1) growing (days 0 to 182), 2) gestation (days 183 to 537), and 3) lactation (days 538 to 718) phases.

Heifer Management and Dietary Treatments

Seventy-two Angus × Hereford heifers, weaned at 201 ± 1.6 d of age, were utilized in this experiment. From weaning (day −23) until day −6, heifers were maintained in a single meadow foxtail (Alopecurus pratensis L.) pasture and fed alfalfa-grass hay for ad libitum consumption. This interval (days −23 to −6) served as a transition period between weaning and experimental procedures to alleviate behavioral distress caused by maternal separation (Weary et al., 2008). On day −6, heifers were ranked by BW and age (initial age = 218 ± 1.6 d; initial BW = 234 ± 3 kg) and randomly assigned to receive 1 of 3 supplementation strategies during the growing phase: 1) no supplementation to maintain limited BW gain (LGAIN; 0.40 kg/d), 2) supplementation to elicit moderate BW gain (MGAIN; 0.60 kg/d), or 3) supplementation to elicit elevated BW gain (HGAIN; 0.80 kg/d). During the growing phase, heifers were maintained in 1 of 2 meadow foxtail (Alopecurus pratensis L.) pastures (25-ha pastures, 36 heifers/pasture, 12 heifers/treatment in each pasture) with limited forage availability due to previous hay harvest and subsequent wintery conditions.

Throughout the growing phase (days 0 to 182), alfalfa-grass hay was offered in feed bunks located in each pasture (linear space of approximately 1.0 m/heifer) for ad libitum consumption. All heifers were gathered 6 d per week and individually sorted into 1 of 24 drylot pens (1 heifer/pen; 6 × 9 m pens). Heifers assigned to MGAIN and HGAIN were individually offered supplement treatments (Table 1) in feed bunks with linear space of approximately 1.6 m/heifer, and supplement was promptly consumed within 30 min of feeding. Heifers assigned to LGAIN were also sorted into pens but did not receive supplement. This process was repeated until all heifers had been individually sorted into pens and offered their treatments. Immediately after feeding, heifers were returned to their respective pastures. Treatments were formulated using the NASEM (2016) to yield a postweaning ADG of 0.40, 0.60, and 0.80 kg/d for LGAIN, MGAIN, and HGAIN, respectively. The LGAIN and MGAIN treatments were designed to further investigate the findings reported by Buskirk et al. (1995). The HGAIN treatment was designed to elicit a postweaning ADG beyond the levels already investigated (Buskirk et al., 1995), but still practical in forage-based cow–calf systems (Schubach et al., 2017).

Table 1.

Composition and nutrient profile of supplements designed to yield moderate (MGAIN) or elevated body weight gain (HGAIN) in replacement beef heifers from weaning until their first breeding season1

MGAIN HGAIN
Item A B C A B C
Ingredients, kg/d (dry matter basis)
 Whole corn 0.30 0.52 0.81 1.26 1.61 2.88
 Dried distillers’ grains with solubles 0.31 0.53 0.81 1.27 1.63 0.97
Nutrient profile,2 dry matter basis
 Total digestible nutrients, % 82 82 82 82 82 85
 Net energy for maintenance, Mcal/kg 2.07 2.07 2.07 2.07 2.07 2.13
 Net energy for growth, Mcal/kg 1.40 1.40 1.40 1.40 1.40 1.46
 Neutral detergent fiber, % 20.4 20.4 20.4 20.4 20.4 14.6
 Crude protein, % 24.6 24.6 24.6 24.6 24.6 16.7

1A = days 0 to 64, B = days 65 to 114, C = days 114 to 182. Supplements were offered 6 d per week, and values reported represent supplement provision during each feeding day.

2Based on nutritional profile of each ingredient, which were analyzed via wet chemistry procedures by a commercial laboratory (Dairy One Forage Laboratory, Ithaca, NY). Calculations for net energy for maintenance and growth used the equations proposed by the NRC (2000).

For the remainder of the experimental period (days 183 to 718), all heifers were managed as a single group and received the same nutritional and overall management (Marques et al., 2016). During the gestation phase (days 183 to 537), heifers were assigned to an estrus synchronization + fixed-time artificial insemination (FTAI) protocol (Larson et al., 2006). Heifers were exposed to mature bulls (1:36 bull to heifer ratio) for 48 h following prostaglandin F administration (bulls removed ~8 h prior to FTAI), and then for 60 d beginning 12 h after FTAI on day 193 (Cooke et al., 2009). Heifers were inseminated by a single technician using semen from 2 Angus bulls balanced between treatments. Heifer pregnancy status was verified using transrectal ultrasonography (5.0 MHz transducer, Aloka 500V) by detecting a fetus 104 d after the end of the breeding season (day 357). Heifers diagnosed as nonpregnant were removed from the experiment. Heifers calved between days 474 and 537 of the experiment, and their offspring was weaned on day 718.

Heifers were assigned to their second breeding season from days 592 to 657 of experiment, including an estrus synchronization + FTAI protocol (FTAI on day 602; Larson et al., 2006) and natural service for 41 d (1:35 bull to heifer ratio) beginning 14 d after FTAI. Heifers were inseminated by a single technician using semen randomly chosen from 2 Angus bulls. Heifer pregnancy status was verified via rectal palpation 103 d after bulls were removed, whereas date of parturition during the subsequent calving season was recorded to determine whether calves were conceived to FTAI or bull breeding. No additional experimental procedures were applied to heifers after weaning on day 718; hence, their pregnancy diagnosis and second calving season were not included in the experimental timeline.

Sampling

Samples of hay and concentrate ingredients offered during the growing phase were collected weekly, pooled across all weeks, and analyzed for nutrient content by a commercial laboratory (Dairy One Forage Laboratory, Ithaca, NY). All samples were analyzed by wet chemistry procedures for concentrations of crude protein (method 984.13; AOAC, 2006), acid detergent fiber (method 973.18 modified for use in an Ankom 200 fiber analyzer, Ankom Technology Corp., Fairport, NY; AOAC, 2006), and neutral detergent fiber (Van Soest et al., 1991; modified for use in an Ankom 200 fiber analyzer, Ankom Technology Corp.). Calculations for total digestible nutrients used the equations proposed by Weiss et al. (1992), whereas net energy for maintenance and gain were calculated with the equations proposed by the NRC (2000). Nutritional profiles of the supplement treatments are described in Table 1. Nutritional profile of alfalfa-grass hay (dry matter basis) was 59% of total digestible nutrients, 1.19 Mcal/kg of net energy for maintenance, 0.64 Mcal/kg of net energy for gain, 49.4% of neutral detergent fiber, and 14.2% of crude protein. Throughout the experimental period (days −23 to 718), heifers had ad libitum access to water and a commercial mineral + vitamin mix (Cattleman’s Choice; Performix Nutrition Systems, Nampa, ID) containing 14% Ca, 10% P, 16% NaCl, 1.5% Mg, 6000 ppm Zn, 3200 ppm Cu, 65 ppm I, 900 ppm Mn, 140 ppm Se, 136 IU/g of vitamin A, 13 IU/g of vitamin d3, and 0.05 IU/g of vitamin E.

Heifer shrunk BW was recorded after 16 h of feed and water withdrawal on days −6 and 183 for ADG calculation. Each week during the growing phase (days 0 to 182), heifer full BW was recorded, and blood samples were collected via jugular venipuncture. Growth rate of each heifer was also modeled by linear regression of BW against sampling days, and each regression coefficient was used as individual response. Blood samples were collected into commercial blood collection tubes (Vacutainer, 10 mL; Becton Dickinson, Franklin Lakes, NJ) with 158 US Pharmacopeial Convention units of freeze-dried sodium heparin, immediately placed on ice, centrifuged (2,500 × g for 30 min; 4 °C) for plasma harvest, and stored at −80 °C on the same day of collection. During the calving season (days 474 to 537), offspring birth BW, birth date, sex, as well as heifer full BW and body condition score (BCS; Wagner et al., 1988) were recorded within 12 h after calving. Calving ease was recorded during parturition as described by Dematawena and Berger (1997) based on a 5-point scale, where 1 = no assistance, 2 = slight assistance, 3 = required assistance, 4 = considerable force required, 5 = cesarean section. Due to management scheme of the research station, male offspring were randomly selected to remain bulls or be banded at birth.

On day 539 of the experiment, milk production was estimated via weigh-suckle-weigh method (Aguiar et al., 2015) from a subset of heifers (n = 10 heifers/treatment) randomly selected within each treatment. Only heifers with days postpartum ≥45 and ≤60 were considered for selection. More specifically, calves were separated from their dams for 12 h, weighed, allowed to suckle for 30 min, and weighed again, then separated again for 8 h and the procedure repeated. Milk yield was calculated as the difference between pre- and post-suckling calf BW. Milk yield was adjusted to 24 h by dividing the observed difference in pre- and post-suckling calf BW by 20 h and multiplying by 24 h. Fresh milk samples were manually collected on day 540 from heifers assigned to weigh-suckle-weigh for composition analysis via infrared spectrometry (method 972.16; AOAC, 1999) by a commercial laboratory (Dairy One Forage Laboratory, Ithaca, NY), and for mRNA expression analysis of genes implicated in milk yield (Table 2). Briefly, each teat was disinfected and samples from each quarter were collected and pooled into 2 sterile RNase-free 50-mL tubes. The initial 5 milk ejections from each teat were discarded before sample collection. Both samples from each heifer were immediately cooled to 4 °C before being shipped overnight to the commercial laboratory, or processed for milk fat globule (MFG) RNA extraction within 2 h of collection (Brenaut et al., 2012). Heifer and offspring full BW were determined for 2 consecutive days upon weaning (days 718 and 719) and averaged to represent weaning values. Heifer BCS was also recorded at weaning. Hair samples were collected from bulls used for natural service at the end of the breeding season (day 253) and offspring at weaning (day 718) for DNA testing to determine calf paternity (SireTrace, Zoetis, Parsippany, NJ). The DNA information from AI bulls was directly provided to the DNA test by the semen company (Select Sires, Inc., Plain City, OH).

Table 2.

Primer sequences for all gene transcripts analyzed by quantitative reverse-transcriptase PCR

Target gene Primer sequence 5′ to 3′ Accession no. Reference
Glucose transporter 1
 Forward CCCCCAGAAGGTGATTGAAG NM_174602.2 Zhao and Keating (2007)
 Reverse GAACCAATCATGCCTCCCAC
Glucose transporter 8
 Forward TCGTGGCCCCGGTCTATAT NM_201528.1 Zhao and Keating (2007)
 Reverse GGCTAGGAGGATGCCTGTGAC
Ribosomal protein S9
 Forward CCTCGACCAAGAGCTGAAG NM_001101152.2 Bionaz and Loor (2007)
 Reverse CCTCCAGACCTCACGTTTGTTC
Ubiquitously expressed prefoldin-like chaperone
 Forward TGTGGCCCTTGGATATGGTT NM_001037471.2 Bionaz and Loor (2007)
 Reverse GGTTGTCGCTGAGCTCTGTG

Laboratory Analyses

All plasma samples were analyzed for plasma progesterone concentration to estimate the onset of puberty (Immulite 1000; Siemens Medical Solutions Diagnostics). Heifers were considered pubertal once plasma progesterone concentrations were ≥1.0 ng/mL for 2 consecutive weeks (Perry et al., 1991), and puberty attainment was declared at the first week of elevated progesterone followed by a cyclic pattern of plasma progesterone < and ≥ 1.0 ng/mL suggestive of normal cycles (Schubach et al., 2017). Heifer age and BW at puberty were calculated based on weekly BW measurements and heifer age at the week of puberty attainment. Samples from days 0, 70, 133, and 182 were analyzed for plasma insulin-like growth factor I (IGF-I) concentration (Immulite 1000; Siemens Medical Solutions Diagnostics) within a single assay. The intra- and inter-assay for progesterone CV were 2.9% and 2.1%, respectively. The intra-assay CV for IGF-I was 2.1%.

Milk samples collected for MFG extraction were centrifuged at 3,000 × g for 30 min at 4 °C to isolate milk fat. The supernatant fat layer was then transferred to a new tube using a sterile spatula. A 500-µL quantity of fat was placed in a 5-mL cryotube, and 1.5 mL of TRIzol solution (Invitrogen, Carlsbad, CA) was added. Samples were then stored at −80 °C until further processing. Total RNA was extracted from MFG using the TRIzol Plus RNA Purification Kit (Invitrogen). Quantity and quality of isolated RNA were assessed via UV absorbance (NanoDrop Lite; Thermo Fisher Scientific, Waltham, MA) at 260 nm and 260/280 nm ratio, respectively (Fleige and Pfaffl, 2006). Reverse transcription of extracted RNA and real-time reverse transcription-PCR using gene-specific primers (20 pM each; Table 2) were performed as described by Rodrigues et al. (2015). Responses from the genes of interest were quantified based on the threshold cycle (CT), the number of PCR cycles required for target amplification to reach a predetermined threshold. The CT responses from milk fat globule genes of interest were normalized to the geometrical mean of CT values of ubiquitously expressed prefoldin-like chaperon and ribosomal protein S9 (Vandesompele et al., 2002). The CV for the geometrical mean of reference genes across all milk fat globule samples was 3.8%. Results are expressed as relative fold change (2−ΔΔCT; Ocón-Grove et al., 2008).

Statistical Analysis

All data were analyzed using heifer as experimental unit, and heifer(treatment × pasture) and pasture as random variables. Quantitative data were analyzed using the MIXED procedure of SAS (SAS Inst. Inc., Cary, NC), whereas binary data were analyzed using the GLIMMIX procedure of SAS. All data were analyzed using the Satterthwaite approximation to determine the denominator degrees of freedom for tests of fixed effects. Model statements used for heifer ADG, initial and final BW, growth rate, BCS, pregnancy, calving variables, and BW and age at puberty contained the effects of treatment. Model statements used for offspring-related responses included the effects of treatment and calf sex as independent covariate. Model statements used for milk-related variables included the effects of treatment and days postpartum as independent covariate. Model statements for puberty attainment, weekly BW, plasma IGF-I, and calving distribution contained the effects of treatment, day, and the treatment × day interaction. Plasma IGF-I concentrations were analyzed using results from day 0 as independent covariate. The specified term used in the repeated statement was day, the subject was heifer (treatment × pasture), and the covariance structure utilized was autoregressive, which provided the best fit for these analyses according to the Akaike information criterion. Results are reported as least square means and were separated using PDIFF. Significance was set at P ≤ 0.05 and tendencies were determined if P > 0.05 and ≤ 0.10. Results are reported according to main treatment effects if no higher-order interactions containing the effect of treatment were significant, or according to highest-order interaction detected.

Results and Discussion

Growing Phase (days 0 to 182)

Heifer ADG during the growing phase was greater (P < 0.01) in HGAIN vs. LGAIN and MGAIN, and greater (P < 0.01) in MGAIN vs. LGAIN heifers (Table 3). A treatment × day interaction was detected (P < 0.01) for BW, which was greater (P ≤ 0.05) in HGAIN and MGAIN vs. LGAIN heifers from days 49 to 119 of the growing phase, and greater (P ≤ 0.05) in HGAIN vs. MGAIN heifers from days 126 to 182 (Figure 1; Table 3). Growth rate based on weekly BW values was also greater (P < 0.01) in HGAIN vs. LGAIN and MGAIN heifers, and greater (P < 0.01) in MGAIN vs. LGAIN heifers (Figure 1). As designed, both ADG and growth rate responses approached the expected values for each treatment. Mean plasma IGF-I concentrations during the growing phase were greater (P < 0.01) in HGAIN vs. LGAIN and MGAIN heifers, and greater (P < 0.01) in MGAIN vs. LGAIN heifers (Table 3). Feed intake, BW gain, and circulating IGF-I concentrations are positively associated in cattle (Armstrong et al., 2001). Hence, treatment effects on plasma IGF-I concentrations corroborate the experimental design, supplementation strategies, and ADG differences among treatments (Ellenberger et al., 1989).

Table 3.

Growth responses of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season1

Item LGAIN MGAIN HGAIN SEM P-value
Body weight2
 Initial, kg 236 233 233 3 0.84
 Breeding, kg 305c 347b 381a 4 < 0.01
  Average daily gain (initial to breeding), kg/d 0.37c 0.60b 0.78a 0.02 < 0.01
 Calving, kg 416b 433ab 439a 7 0.05
  Average daily gain (breeding to calving), kg/d 0.31a 0.23b 0.14c 0.01 < 0.01
 Weaning, kg 409b 433a 443a 8 0.01
  Average daily gain (calving to weaning), kg/d -0.03 0.00 0.01 0.03 0.56
Body condition score3
 Calving 4.87 4.80 4.65 0.10 0.26
 Weaning 4.55 4.67 4.71 0.10 0.53
Plasma IGF-I,4 ng/mL 131.8c 177.2b 200.2a 72 < 0.01

1Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. Within rows, treatment means with different superscripts differ (P ≤ 0.05).

2Heifer initial (day −6) and breeding (day 183) body weight were recorded after 16 h of feed and water withdrawal. Full heifer body weight was collected within 12 h of calving (calving season; days 474 to 537), and for two consecutive days upon weaning their first offspring (day 718 of the experiment).

3Heifer body condition score (Wagner et. al., 1988) was recorded upon calving (calving season; days 474 to 537) and upon weaning their first offspring (day 718 of the experiment).

4Blood samples were collected on d 0, 70, 133, and 182 of the experiment. Data were analyzed using results from day 0 as independent covariate.

Figure 1.

Figure 1.

Weekly body weight of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season. Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. A treatment × day interaction was detected (P ≤ 0.01). Within days, letters indicate (P ≤ 0.05); a = LGAIN vs. MGAIN, b = LGAIN vs. HGAIN, c = MGAIN vs. HGAIN. Growth rate of each animal was modeled by linear regression of body weight against sampling days, and each regression coefficient was used as individual response. Growth rate was greater (P < 0.01) in HGAIN vs. MGAIN and LGAIN (0.40, 0.63, and 0.85 kg/day, respectively; SEM = 0.02), and greater (P < 0.01) in MGAIN vs. LGAIN heifers.

A treatment × day interaction was detected (P < 0.01) for puberty attainment. Overall, puberty was delayed in LGAIN vs. MGAIN and HGAIN heifers (P ≤ 0.05), whereas final puberty attainment was greater (P ≤ 0.01) in HGAIN vs. MGAIN and LGAIN heifers (Figure 2; Table 4). Puberty onset is largely influenced by plane of nutrition (Schillo et al., 1992) including circulating concentrations of hormones associated with nutrient metabolism such as IGF-I (Yelich et al., 1995). Others have also documented that heifers fed to accelerate BW gain after weaning experienced hastened puberty attainment (Short and Bellows, 1971; Buskirk et al., 1995; Hall et al., 1995), and increased circulating concentrations of IGF-I (Cooke et al., 2007; Chelikani et al., 2009). Final puberty attainment, however, did not differ between (P = 0.68) MGAIN vs. LGAIN heifers (Figure 2; Table 4), despite differences in ADG and plasma IGF-I between these treatments. Nonetheless, age at puberty was less (P = 0.01) in MGAIN vs. LGAIN heifers and did not differ (P ≥ 0.14) among these treatments compared with HGAIN heifers (Table 4). Onset of puberty was likely limited by age in HGAIN and MGAIN heifers, given that BW at puberty attainment was greater (P ≤ 0.05) in HGAIN vs. MGAIN and LGAIN heifers, and greater (P = 0.03) in MGAIN vs. LGAIN heifers (Table 4). Previous research also reported increased BW at puberty in heifers developed on increased planes of nutrition (Short and Bellows, 1971; Yelich et al., 1995; Cardoso et al., 2014). Hence, HGAIN and MGAIN treatments may have accelerated heifer BW gain faster than their physiological maturity compared with LGAIN (Moseley et al., 1982).

Figure 2.

Figure 2.

Puberty attainment of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season. Heifers were weaned 23 d prior to the beginning of the experiment (d 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. A treatment × day interaction was detected (P ≤ 0.01). Within days, letters indicate (P ≤ 0.05); a = LGAIN vs. MGAIN, b = LGAIN vs. HGAIN, c = MGAIN vs. HGAIN.

Table 4.

Reproductive responses of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season1

Item LGAIN MGAIN HGAIN SEM P-value
Pubertal by breeding,2 % 56.5b 62.5b 87.5a 7.1 < 0.01
 Age at puberty, d 358a 327b 345ab 8 0.04
 Body weight at puberty, kg 295c 318b 340a 7 < 0.01
Pregnancy rate,3 % 100 (24/24) 87.5 (21/24) 100 (24/24) 7.0 0.39
Calving rate,4 % 100 (24/24) 87.5 (21/24) 100 (24/24) 7.0 0.39
 Sired by AI 58.3 (14/24) 50.0 (12/24) 54.2 (13/24) 1.5 0.84
 Sired by natural breeding 41.7 (10/24) 37.5 (9/24) 45.8 (11/24) 1.3 0.84
Dystocia,5 % 16.7 (4/24) 14.4 (3/21) 12.5 (3/24) 8.6 0.92

1Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. Heifers were assigned to an estrus synchronization + fixed-time artificial insemination (FTAI) protocol on d 183 (Larson et al., 2006). Heifers were exposed to mature bulls (1:36 bull to heifer ratio) for 48 h following prostaglandin F administration, and then for 60 d beginning 12 h after FTAI (Cooke et al., 2009). Within rows, treatment means with different superscripts differ (P ≤ 0.05). Values within parenthesis represent proportion of positive assessments divided by total assessments.

2Evaluated according to plasma progesterone concentrations in samples collected weekly from days 0 to 182 (Schubach et al. (2017).

3Pregnancy status was verified by detecting a fetus via transrectal ultrasonography (5.0-MHz transducer; 500V, Aloka, Wallingford, CT) 104 d after the end of the breeding season (day 349 of the experiment).

4According to number of heifers assigned to the experiment that calved. Calf paternity was determined according to SireTrace (Zoetis, Parsippany, NJ) using hair samples collected from sires and offspring.

5Heifers with calving ease score ≥ 2 (Dematawena and Berger, 1997; 1 = no assistance; 5 = cesarean section).

Gestation Phase (days 183 to 537)

No treatment effects were detected (P = 0.39) for overall pregnancy rates, despite differences noted for puberty attainment during the growing phase (Table 4). This outcome may be associated with the reproductive management utilized herein, given that exogenous GnRH, exogenous progesterone, and bull exposure likely stimulated prepubertal heifers to ovulate during the breeding season (Patterson et al., 2000; Cooke et al., 2013). No pregnancy loss was observed from pregnancy diagnosis on day 357 until term; hence, calving rate also did not differ (P = 0.39) among treatments (Table 4). Nonetheless, a treatment × day interaction was detected (P = 0.04) for calving distribution (Figure 3). Heifers receiving HGAIN calved earlier compared with MGAIN and LGAIN heifers, whereas calving was completed in HGAIN heifers within 5 wk of the breeding season (Figure 3). These results indicate that HGAIN heifers conceived earlier during the breeding season compared with LGAIN and MGAIN heifers, corroborating treatment differences noted for puberty attainment. Accordingly, heifers that experience at least 1 estrous cycle prior to the breeding season have greater pregnancy success compared with anestrous cohorts (Roberts et al., 2018). Based on this rationale, one could also expect HGAIN heifers to have more FTAI pregnancies compared with LGAIN and MGAIN. However, heifers were exposed to bulls before and shortly after insemination, and no treatment differences were noted (P = 0.84) for percentage of calves sired by FTAI or natural breeding (Table 4).

Figure 3.

Figure 3.

Calving distribution during their first calving season, compiled by week, of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season. Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. A treatment × day interaction was detected (P = 0.04). Within days, letters indicate (P ≤ 0.05); a = LGAIN vs. MGAIN, b = LGAIN vs. HGAIN, c = MGAIN vs. HGAIN.

During the gestation phase, ADG was greater (P < 0.01) in LGAIN vs. MGAIN and HGAIN heifers, and greater (P < 0.01) in MGAIN vs. HGAIN heifers (Table 3) despite all heifers being managed as a single group receiving the same dietary management. Heifers assigned to HGAIN and MGAIN heifers were heavier at breeding (Table 3); hence, LGAIN heifers had less nutritional requirements (NRC, 2000) contributing to differences noted for ADG between treatments from breeding to calving. The same rationale can be applied when comparing differences noted for ADG between MGAIN vs. HGAIN heifers. Nevertheless, BW at calving was still less (P ≤ 0.05) in LGAIN vs. HGAIN heifers and did not differ (P ≥ 0.26) between MGAIN compared with other treatments (Table 4). No treatment differences were noted (P ≥ 0.26) for heifer BCS at calving (Table 3), or incidence of dystocia (Table 4). Calf birth BW and proportion of male calves born also did not differ (P ≥ 0.87) between treatments (Table 5). Thus, treatment differences in heifer BW and ADG during the gestation phase were not sufficient to affect heifer BCS and incidence of dystocia at calving (Bellows et al., 1971; Schröder and Staufenbiel, 2006), as well as in utero calf growth (Spitzer et al., 1995; Winterholler et al., 2012)

Table 5.

Growth responses of offspring from replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season1

Item LGAIN MGAIN HGAIN SEM P-value
Birth body weight,2 kg 34.5 34.9 34.3 0.78 0.87
 Male calves born, % 41.7 (10/24) 47.6 (10/21) 41.7 (10/24) 10.6 0.90
Calf loss from birth to weaning,3 % 4.2 (1/24) 0.0 (0/24) 12.5 (3/24) 5.0 0.19
Weaning rate,4 % 95.8 (23/24) 87.5 (21/24) 87.5 (21/24) 8.6 0.54
 Bull calves weaned, % 21.6 (5/23) 14.1 (3/21) 23.6 (5/21) 9.9 0.72
 Steer calves weaned, % 21.9 (5/23) 33.5 (7/21) 14.5 (3/21) 11.4 0.33
 Heifer calves weaned, % 56.5 (13/23) 52.4 (11/21) 61.9 (13/21) 10.8 0.83
Weaning age, d 228b 231ab 234a 2 0.05
Weaning body weight, kg 207 213 217 6 0.44
 Average daily gain,5 kg/d 0.75 0.77 0.78 0.02 0.63

1Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. Within rows, treatment means with different superscripts differ (P ≤ 0.05). Values within parenthesis represent proportion of positive assessments divided by total assessments.

2Heifers calved from days 474 to 537 of the experiment, and calf body weight recorded within 12 h of calving.

3Calf mortality from birth to weaning.

4Calves were weaned from replacement heifers on day 718 of the experiment. Calf body weight was recorded at weaning and 24 h later and averaged to represent weaning body weight.

5Calculated using calf birth body weight, weaning body weight, and weaning age.

Lactation Phase (days 530 to 718)

By design, heifers from all treatments had similar (P = 0.66) days postpartum when assessed for milk production (57.9, 56.1, and 56.5 d for LGAIN, MGAIN, and HGAIN, respectively; SEM = 1.5). No treatment differences were detected (P ≥ 0.16) for milk yield and composition (Table 6), differing from Buskirk et al. (1995) and our main hypothesis. Yet, biological difference noted herein in milk yield between MGAIN and HGAIN vs. LGAIN heifers (25% increase; Table 6) was superior than those reported by Buskirk et al. (1995; 13% increase), suggesting that our weigh-suckle-weigh method was likely underpowered. Corroborating this rationale, mRNA expression of glucose transporter 1 (GLUT1) in MFG was greater (P ≤ 0.02) in HGAIN and MGAIN vs. LGAIN heifers, and did not differ (P = 0.74) between MGAIN and HGAIN heifers (Table 6). Expression of glucose transporter 8 (GLUT8) mRNA in MFG was also greater (P = 0.04) in HGAIN vs. LGAIN heifers, and did not differ (P ≥ 0.20) between MGAIN compared with the other treatments (Table 6). Mammary epithelial cells (MEC) are responsible for milk synthesis and secretion. During lactation, MEC release fat into milk along with a portion of its cytoplasm, resulting in the secretion of MFG containing cytoplasmic components of MEC (Cánovas et al., 2014; Yang et al., 2016). Therefore, RNA trapped within the MFG is representative of RNA from the MEC at the time of milk synthesis (Brenaut et al., 2012; Maningat et al., 2009), and has been suggested as the most representative of gene expression within the mammary gland (Cánovas et al., 2014). Glucose is the primary precursor for lactose synthesis in the mammary epithelial cell (Zhao and Keating, 2007), and lactose synthesis is a major factor regulating milk volume and epithelial cell secretory activity (Molenaar et al., 1992). Both GLUT1 and GLUT8 are active transporters of glucose into the mammary gland and their mRNA expression increases drastically in mammary tissues during lactation, suggesting modulatory roles in milk synthesis (Zhao and Keating, 2007). Therefore, increased expression of GLUT1 in HGAIN and MGAIN vs. LGAIN heifers concurs with the biological differences noted for milk yield between these treatments. Treatment differences noted for GLUT8 provides further evidence of improved lactation ability of heifers receiving HGAIN.

Table 6.

Milk production responses of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season1

Item LGAIN MGAIN HGAIN SEM P-value
Milk production, kg/d
 Milk yield 5.00 6.33 6.22 0.82 0.47
 Fat-corrected milk 3.56 4.84 4.83 0.73 0.36
 Energy-corrected milk 3.91 5.22 5.18 0.72 0.37
Milk composition2
 Fat, % 1.95 1.94 2.09 0.32 0.92
 Protein, % 3.02 3.09 2.99 0.08 0.35
 Lactose, % 4.71 4.82 4.74 0.04 0.16
 Total solids, % 10.8 11.0 10.9 0.3 0.92
 Casein, % 2.48 2.56 2.46 0.63 0.33
Milk fat globule,3 mRNA expression
GLUT1 2.72b 6.26a 6.70a 1.03 0.02
GLUT8 3.30b 5.81ab 7.25a 1.30 0.09

1Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. Heifers calves from days 474 to 537 of the experiment. Within rows, treatment means with different superscripts differ (P ≤ 0.05). On day 539 of the experiment, 10 heifers from each group were selected and assigned to a weigh-suckle-weight technique as described by Aguiar et al. (2015). Only heifers with days postpartum ≥ 45 and ≤ 60 were considered for selection, and average days postpartum did not differ (P = 0.66) among treatments (57.9, 56.1, and 56.5 d for LGAIN, MGAIN, and HGAIN, respectively; SEM = 1.5). On day 540 milk, samples were manually collected from these same heifers for milk composition and mRNA isolation.

2Analyzed via infrared spectrometry (method 972.16; AOAC, 1999) by a commercial laboratory (Dairy One Forage Laboratory, Ithaca, NY).

3Samples processed for mRNA expression as in Brenaut et al. (2012) and analyzed for mRNA expression as in Rodrigues et al. (2015). Values are expressed as relative fold change (Ocón-Grove et al., 2008).

In beef and dairy cattle, mammary growth is allometric and extensive growth of the duct network occurs between 3 and 9 mo of age (Sinha and Tucker, 1969). Nutritional manipulation during allometric growth can greatly affect mammary composition and future milk yield of heifers. As mentioned previously, Buskirk et al. (1996a) and Buskirk et al. (1996b) reported negative outcomes on heifer milk production when supplementation to promote BW gain began at 4 or 5 mo of age, respectively. Alternatively, allometric mammary growth is in the final stages when heifers are weaned at the traditional 7 mo of age (Sinha and Tucker, 1969; Whittier, 1995). Reproductive development and lactation performance were improved when BW gain was accelerated after heifers were weaned at 7 mo of age (Buskirk et al., 1995). Based on treatment differences observed for GLUT1 and GLUT8 mRNA expression in MFG, results from this experiment support these latter observations. The exact mechanisms by which increased postweaning ADG may benefit milk production ability requires further investigation, whereas IGF-I likely modulates these outcomes. Circulating IGF-I plays a significant role prepubertal mammary development (Akers et al., 2005), and treatment effects on plasma IGF-I concentration during the growing phase corroborate GLUT1 and GLUT8 results.

No treatment differences in heifer ADG from calving to weaning were detected (P = 0.56; Table 3). Hence, heifer BW at weaning remained less (P ≤ 0.03) in LGAIN vs. MGAIN and HGAIN heifers, and similar (P = 0.40) between MGAIN and HGAIN heifers (Table 3). No treatment differences in heifer BCS were noted (P = 0.53) at weaning (Table 3). Calf loss from birth to weaning, as well as weaning rate did not differ (P ≥ 0.19) between treatments (Table 5). No treatment differences were also detected (P ≥ 0.23) for proportion of bull, steer, or heifer calves weaned (Table 5). Concurring with treatment differences reported for calving rate, weaning age was greater (P = 0.02) in HGAIN vs. LGAIN heifers and did not differ (P ≥ 0.23) between MGAIN compared with the other treatments (Table 5). Considering indications for greater milk production ability of MGAIN and HGAIN heifers based on MFG mRNA expression of GLUT1 and GLUT8, LGAIN heifers was expected to wean lighter calves. However, no treatment differences were detected (P ≥ 0.44) for offspring ADG from birth to weaning and offspring weaning BW (Table 5), despite a 10-kg numerical difference between calves from HGAIN and LGAIN heifers. Similar outcomes (P = 0.61) were detected if offspring weaning BW is adjusted (BIF, 2010) to 205-d weaning weights (222, 219, and 215 kg for HGAIN, MGAIN, and LGAIN, respectively; SEM = 4). Buskirk et al. (1995) also failed to document improved weaning BW of the offspring from heifers supplemented postweaning, although calf BW were increased by 3 to 5 kg from 54 to 153 d of age. These authors suggested that offspring from heifers with less milk production may have increased forage consumption during late-lactation to compensate for their reduced milk intake, whereas offspring BW was not recorded prior to weaning herein to corroborate this rationale.

No treatment effects were detected (P ≥ 0.59) for heifer reproductive performance to their second breeding season. Considering all heifers that initiated the study, the same proportion of HGAIN, MGAIN, and LGAIN became pregnant to FTAI (62.5%, 58.3%, and 62.5% of pregnant heifers, respectively; SEM = 10.1, P = 0.94), bull breeding, (8.33%, 25.0%, and 12.5% of pregnant heifers, respectively; SEM = 11.3, P = 0.23), or both methods combined (70.8%, 83.3%, and 75.0% of pregnant heifers, respectively; SEM = 8.80, P = 0.59). Calving distribution also did not differ (P = 0.93) between treatments (Figure 4). Heifers that calve early during their first breeding season often have improved reproductive performance during their second breeding season (Lesmeister et al., 1973); hence, it would be expected greater pregnancy rates and earlier calving in HGAIN heifers. Lack of such outcomes can be associated with the estrus synchronization + FTAI adopted in both years (Summers et al., 2018). Estrus synchronization initiates cyclicity in anestrus females and hastens conception during the breeding season (Larson et al., 2006), and likely compensated for the later calving date of MGAIN and LGAIN during their first calving season.

Figure 4.

Figure 4.

Calving distribution during their second calving season, compiled by week, of replacement beef heifers receiving supplements designed to yield limited (LGAIN), moderate (MGAIN), or elevated body weight gain (HGAIN) from weaning until their first breeding season. Heifers were weaned 23 d prior to the beginning of the experiment (day 0) at 201 ± 1.6 d of age. Treatments were provided from days 0 to 182. During the remainder of the experimental period (days 183 to 718), heifers from all treatments were managed as a single group receiving the same nutritional and overall management. No treatment effects were detected (P = 0.93).

In summary, supplementing heifers to achieve HGAIN after weaning at 7 mo of age hastened puberty attainment and date of first-calving, without negatively impairing their milk yield and offspring weaning BW as primiparous cows. In turn, developing replacement heifers at LGAIN delayed puberty attainment and reduced MFG mRNA expression of GLUT1 and GLUT8, which are suggestive of lessened mammary epithelial cell activity and milk synthesis (Zhao and Keating, 2007). Given these novel biological evidences, research is warranted to further investigate the role of postweaning BW gain rate on mammary gland development in traditionally weaned heifers. Nonetheless, increasing postweaning ADG to 0.80 kg/d hastened reproductive development and was beneficial to mammary gland function of replacement beef heifers.

Literature Cited

  1. Aguiar A. D., Vendramini J. M., Arthington J. D., Sollenberger L. E., DiLorenzo N., and Hersom M. J.. . 2015. Performance of beef cows and calves fed different sources of rumen-degradable protein when grazing stockpiled limpograss pastures. J. Anim. Sci. 93:1923–1932. doi: 10.2527/jas.2014-8599 [DOI] [PubMed] [Google Scholar]
  2. Akers R. M., Ellis S. E., and Berry S. D.. . 2005. Ovarian and IGF-I axis control of mammary development in prepubertal heifers. Domest. Anim. Endocrinol. 29:259–267. doi: 10.1016/j.domaniend.2005.02.037 [DOI] [PubMed] [Google Scholar]
  3. AOAC 1999. Official methods of analysis. 16th ed Assoc. Off. Anal. Chem., Arlington, VA. [Google Scholar]
  4. AOAC 2006. Official methods of analysis. 18th ed Assoc. Off. Anal. Chem., Arlington, VA. [Google Scholar]
  5. Armstrong D. G., McEvoy T. G., Baxter G., Robinson J. J., Hogg C. O., Woad K. J., Webb R., and Sinclair K. D.. . 2001. Effect of dietary energy and protein on bovine follicular dynamics and embryo production in vitro: associations with the ovarian insulin-like growth factor system. Biol. Reprod. 64:1624–1632. doi: 10.1095/biolreprod64.6.1624 [DOI] [PubMed] [Google Scholar]
  6. Beef Improvement Federation (BIF) 2010. Guidelines for Uniform Beef Improvement Programs. 9th ed BIF, North Carolina State University, Raleigh, NC. [Google Scholar]
  7. Bellows R. A., Short R. E., Anderson D. C., Knapp B. W., and Pahnish O. F.. . 1971. Cause and effect relationships associated with calving difficulty and calf birth weight. J. Anim. Sci. 33:407–415. doi: 10.2527/jas1971.332407x [DOI] [PubMed] [Google Scholar]
  8. Bionaz M., and Loor J. J.. . 2007. Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle. Physiol. Genomics. 29:312–319. doi: 10.1152/physiolgenomics.00223.2006. [DOI] [PubMed] [Google Scholar]
  9. Brenaut P., Bangera R., Bevilacqua C., Rebours E., Cebo C., and Martin P.. . 2012. Validation of RNA isolated from milk fat globules to profile mammary epithelial cell expression during lactation and transcriptional response to a bacterial infection. J. Dairy Sci. 95:6130–6144. doi: 10.3168/jds.2012-5604 [DOI] [PubMed] [Google Scholar]
  10. Brown E. G., Vandehaar M. J., Daniels K. M., Liesman J. S., Chapin L. T., Forrest J. W., Akers R. M., Pearson R. E., and Nielsen M. S.. . 2005. Effect of increasing energy and protein intake on mammary development in heifer calves. J. Dairy Sci. 88:595–603. doi: 10.3168/jds.S0022-0302(05)72723-5 [DOI] [PubMed] [Google Scholar]
  11. Buskirk D D, Faulkner D. B., Hurley W. L., Kesler D. J., Ireland F. A., Nash T. G., Castree J. C., and Vicini J. L.. . 1996a. Growth, reproductive performance, mammary development, and milk production of beef heifers as influenced by prepubertal dietary energy and administration of bovine somatotropin. J. Anim. Sci. 74:2649. doi: 10.2527/1996.74112649x. [DOI] [PubMed] [Google Scholar]
  12. Buskirk D. D., Faulkner D. B., and Ireland F. A.. . 1995. Increased postweaning gain of beef heifers enhances fertility and milk production. J. Anim. Sci. 73:937–946. doi: 10.2527/1995.734937x [DOI] [PubMed] [Google Scholar]
  13. Buskirk D. D., Faulkner D. B., and Ireland F. A.. . 1996b. Subsequent productivity of beef heifers that received creep feed for 0, 28, 56, or 84 d before weaning. Prof Ani Sci. 12:37–43. doi:10.15232/S1080-7446(15)32480–3. [Google Scholar]
  14. Cánovas A., Rincón G., Bevilacqua C., Islas-Trejo A., Brenaut P., Hovey R. C., Boutinaud M., Morgenthaler C., VanKlompenberg M. K., Martin P., and Medrano J. F.. . 2014. Comparison of five different RNA sources to examine the lactating bovine mammary gland transcriptome using RNA-Sequencing. Sci. Rep. 4. doi: 10.1038/srep05297 http://www.nature.com/articles/srep05297 [DOI] [PMC free article] [PubMed]
  15. Cardoso R. C., Alves B. R., Prezotto L. D., Thorson J. F., Tedeschi L. O., Keisler D. H., Park C. S., Amstalden M., and Williams G. L.. . 2014. Use of a stair-step compensatory gain nutritional regimen to program the onset of puberty in beef heifers. J. Anim. Sci. 92:2942–2949. doi: 10.2527/jas.2014-7713 [DOI] [PubMed] [Google Scholar]
  16. Chelikani P. K., Ambrose D. J., Keisler D. H., and Kennelly J. J.. . 2009. Effects of dietary energy and protein density on plasma concentrations of leptin and metabolic hormones in dairy heifers. J. Dairy Sci. 92:1430–1441. doi: 10.3168/jds.2008-1385 [DOI] [PubMed] [Google Scholar]
  17. Cooke R. F., Arthington J. D., Araujo D. B., and Lamb G. C.. . 2009. Effects of acclimation to human interaction on performance, temperament, physiological responses, and pregnancy rates of Brahman-crossbred cows. J. Anim. Sci. 87:4125–4132. doi: 10.2527/jas.2009-2021 [DOI] [PubMed] [Google Scholar]
  18. Cooke R. F., Arthington J. D., Staples C. R., Thatcher W. W., and Lamb G. C.. . 2007. Effects of supplement type on performance, reproductive, and physiological responses of Brahman-crossbred females. J. Anim. Sci. 85:2564–2574. doi: 10.2527/jas.2006-684 [DOI] [PubMed] [Google Scholar]
  19. Cooke R. F., Bohnert D. W., Francisco C. L., Marques R. S., Mueller C. J., and Keisler D. H.. . 2013. Effects of bovine somatotropin administration on growth, physiological, and reproductive responses of replacement beef heifers. J. Anim. Sci. 91:2894–2901. doi: 10.2527/jas.2012-6082 [DOI] [PubMed] [Google Scholar]
  20. Dematawena C. M. B., and Berger P. J.. . 1997. Effect of dystocia on yield, fertility, and cow losses and an economic evaluation of dystocia scores for Holsteins. J. Dairy Sci. 80:754–761. doi: 10.3168/jds.S0022-0302(97)75995-2. [DOI] [PubMed] [Google Scholar]
  21. Ellenberger M. A., Johnson D. E., Carstens G. E., Hossner K. L., Holland M. D., Nett T. M., and Nockels C. F.. . 1989. Endocrine and metabolic changes during altered growth rates in beef cattle. J. Anim. Sci. 67:1446–1454. doi: 10.2527/jas1989.6761446x [DOI] [PubMed] [Google Scholar]
  22. Fleige S., and Pfaffl M. W.. . 2006. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Aspects Med. 27:126–139. doi: 10.1016/j.mam.2005.12.003 [DOI] [PubMed] [Google Scholar]
  23. Freking B. A., and Marshall D. M.. . 1992. Interrelationships of heifer milk production and other biological traits with production efficiency to weaning. J. Anim. Sci. 70:646–655. doi: 10.2527/1992.703646x [DOI] [PubMed] [Google Scholar]
  24. Funston R. N., Martin J. L., Larson D. M., and Roberts A. J.. . 2012. Physiology and endocrinology symposium: nutritional aspects of developing replacement heifers. J. Anim. Sci. 90:1166–1171. doi:10.2527/jas.2011–4569 [DOI] [PubMed] [Google Scholar]
  25. Hall J. B., Staigmiller R. B., Bellows R. A., Short R. E., Moseley W. M., and Bellows S. E.. . 1995. Body composition and metabolic profiles associated with puberty in beef heifers. J. Anim. Sci. 73:3409–3420. doi: 10.2527/1995.73113409x [DOI] [PubMed] [Google Scholar]
  26. Larson J. E., Lamb G. C., Stevenson J. S., Johnson S. K., Day M. L., Geary T. W., Kesler D. J., DeJarnette J. M., Schrick F. N., DiCostanzo A., . et al. 2006. Synchronization of estrus in suckled beef cows for detected estrus and artificial insemination and timed artificial insemination using gonadotropin-releasing hormone, prostaglandin F2alpha, and progesterone. J. Anim. Sci. 84:332–342. doi: 10.2527/2006.842332x [DOI] [PubMed] [Google Scholar]
  27. Lesmeister J. L., Burfening P. J., and Blackwell R. L.. . 1973. Date of first calving in beef cows and subsequent calf production. J. Anim. Sci. 36:1–6. doi: 10.2527/jas1973.3611. [DOI] [Google Scholar]
  28. Maningat P. D., Sen P., Rijnkels M., Sunehag A. L., Hadsell D. L., Bray M., and Haymond M. W.. . 2009. Gene expression in the human mammary epithelium during lactation: the milk fat globule transcriptome. Physiol. Genomics 37:12–22. doi: 10.1152/physiolgenomics.90341.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Marques R. S., Cooke R. F., Rodrigues M. C., Cappellozza B. I., Mills R. R., Larson C. K., Moriel P., and Bohnert D. W.. . 2016. Effects of organic or inorganic cobalt, copper, manganese, and zinc supplementation to late-gestating beef cows on productive and physiological responses of the offspring. J. Anim. Sci. 94:1215–1226. doi: 10.2527/jas.2015-0036 [DOI] [PubMed] [Google Scholar]
  30. Molenaar A. J., Davis S. R., and Wilkins R. J.. . 1992. Expression of alpha-lactalbumin, alpha-S1-casein, and lactoferrin genes is heterogeneous in sheep and cattle mammary tissue. J. Histochem. Cytochem. 40:611–618. doi: 10.1177/40.5.1374090 [DOI] [PubMed] [Google Scholar]
  31. Moseley W. M., Dunn T. G., Kaltenbach C. C., Short R. E., and Staigmiller R. B.. . 1982. Relationship of growth and puberty in beef heifers fed monensin. J. Anim. Sci. 55:357–362. doi: 10.2527/jas1982.552357x [DOI] [PubMed] [Google Scholar]
  32. National Academies of Sciences, Engineering, and Medicine (NASEM) 2016. Nutrient requirements of beef cattle. 8th rev. ed Natl. Acad. Press, Washington, DC [Google Scholar]
  33. NRC 2000. Nutrient requirements of beef cattle. 7th ed Natl. Acad. Press, Washington, DC. [Google Scholar]
  34. Ocón-Grove O. M., Cooke F. N. T., Alvarez I. M., Johnson S. E., Ott T. L., and Ealy A. D.. . 2008. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest. Anim. Endocrinol. 34:135–145. doi: 10.1016/j.domaniend.2006.12.002. [DOI] [PubMed] [Google Scholar]
  35. Patterson D. J., Perry R. C., Kiracofe G. H., Bellows R. A., Staigmiller R. B., and Corah L. R.. . 1992. Management considerations in heifer development and puberty. J. Anim. Sci. 70:4018–4035. doi: 10.2527/1992.70124018x [DOI] [PubMed] [Google Scholar]
  36. Patterson D. J., Wood S. L., and Randle R. F.. . 2000. Procedures that support reproductive management of replacement beef heifers. J. Anim. Sci. 77:1. doi: 10.2527/jas2000.00218812007700ES0005x [DOI] [Google Scholar]
  37. Perry R. C., Corah L. R., Cochran R. C., Brethour J. R., Olson K. C., and Higgins J. J.. . 1991. Effects of hay quality, breed, and ovarian development on onset of puberty and reproductive performance of beef heifers. J. Prod. Ag. 4:13–18. doi: 10.2134/jpa1991.0013 [DOI] [Google Scholar]
  38. Rawlings N. C., Evans A. C., Honaramooz A., and Bartlewski P. M.. . 2003. Antral follicle growth and endocrine changes in prepubertal cattle, sheep and goats. Anim. Reprod. Sci. 78:259–270. [DOI] [PubMed] [Google Scholar]
  39. Roberts A. J., Ketchum J. N., and Funston R. N.. . 2018. Developmental and reproductive characteristics of beef heifers classified by number of estrous cycles experienced by start of first breeding. Transl. Anim. Sci. 3:541–548. doi: 10.1093/tas/txy118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rodrigues M. C., Cooke R. F., Marques R. S., Arispe S. A., Keisler D. H., and Bohnert D. W.. . 2015. Effects of oral meloxicam administration to beef cattle receiving lipopolysaccharide administration or vaccination against respiratory pathogens. J. Anim. Sci. 93:5018–5027. doi: 10.2527/jas.2015-9424 [DOI] [PubMed] [Google Scholar]
  41. Schillo K. K., Hall J. B., and Hileman S. M.. . 1992. Effects of nutrition and season on the onset of puberty in the beef heifer. J. Anim. Sci. 70:3994–4005. doi: 10.2527/1992.70123994x [DOI] [PubMed] [Google Scholar]
  42. Schröder U. J., and Staufenbiel R.. . 2006. Invited review: methods to determine body fat reserves in the dairy cow with special regard to ultrasonographic measurement of backfat thickness. J. Dairy Sci. 89:1–14. doi: 10.3168/jds.S0022-0302(06)72064-1. [DOI] [PubMed] [Google Scholar]
  43. Schubach K. M., Cooke R. F., Brandão A. P., Lippolis K. D., Silva L. G. T., Marques R. S., and Bohnert D. W.. . 2017. Impacts of stocking density on development and puberty attainment of replacement beef heifers. Animal 11:2260–2267. doi: 10.1017/S1751731117001070 [DOI] [PubMed] [Google Scholar]
  44. Short R. E., and Bellows R. A.. . 1971. Relationships among weight gains, age at puberty and reproductive performance in heifers. J. Anim. Sci. 32:127–131. doi: 10.2527/jas1971.321127x. [DOI] [Google Scholar]
  45. Sinha Y. N., and Tucker H. A.. . 1969. Mammary development and pituitary prolactin level of heifers from birth through puberty and during the estrous cycle. J. Dairy Sci. 52:507–512. doi: 10.3168/jds.S0022-0302(69)86595-1 [DOI] [PubMed] [Google Scholar]
  46. Spitzer J. C., Morrison D. G., Wettemann R. P., and Faulkner L. C.. . 1995. Reproductive responses and calf birth and weaning weights as affected by body condition at parturition and postpartum weight gain in primiparous beef cows. J. Anim. Sci. 73:1251–1257. doi: 10.2527/1995.7351251x [DOI] [PubMed] [Google Scholar]
  47. Summers A. F., Rosasco S. L, and Scholljegerdes E. J., . 2018. Influence of management decisions during heifer development on enhancing reproductive success and cow longevity. J. Anim. Sci. 97:1407–1414. doi: 10.1093/jas/sky440 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Van Soest P. J., Robertson J. B., and Lewis B. A.. . 1991. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74:3583–3597. doi: 10.3168/jds.S0022-0302(91)78551-2 [DOI] [PubMed] [Google Scholar]
  49. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., and Speleman F.. . 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH0034. doi: 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wagner J. J., Lusby K. S., Oltjen J. W., Rakestraw J., Wettemann R. P., and Walters L. E.. . 1988. Carcass composition in mature Hereford cows: estimation and effect on daily metabolizable energy requirement during winter. J. Anim. Sci. 66:603–612. doi: 10.2527/jas1988.663603x [DOI] [PubMed] [Google Scholar]
  51. Weary D. M., Jasper J., and Hötzel M. J.. . 2008. Understanding weaning distress. Appl. Anim. Behav. Sci. 110:24–41. doi: 10.1016/j.applanim.2007.03.025 [DOI] [Google Scholar]
  52. Weiss W. P., Conrad H. R., and St. Pierre N. R.. . 1992. A theoretically-based model for predicting total digestible nutrient values of forages and concentrates. Anim. Feed Sci. Technol. 39:95–110. [Google Scholar]
  53. Whittier J. C. 1995. Time of weaning and cow condition. In: Proc., The Range Beef Cow Symposium XIV, Gering, NE: pp 92–104. [Google Scholar]
  54. Winterholler S. J., McMurphy C. P., Mourer G. L., Krehbiel C. R., Horn G. W., and Lalman D. L.. . 2012. Supplementation of dried distillers grains with solubles to beef cows consuming low-quality forage during late gestation and early lactation. J. Anim. Sci. 90:2014–2025. doi: 10.2527/jas.2011-4152 [DOI] [PubMed] [Google Scholar]
  55. Yang J., Jiang J., Liu X., Wang H., Guo G., Zhang Q., and Jiang L.. . 2016. Differential expression of genes in milk of dairy cattle during lactation. Anim. Genet. 47:174–180. doi: 10.1111/age.12394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yelich J. V., Wettemann R. P., Dolezal H. G., Lusby K. S., Bishop D. K., and Spicer L. J.. . 1995. Effects of growth rate on carcass composition and lipid partitioning at puberty and growth hormone, insulin-like growth factor I, insulin, and metabolites before puberty in beef heifers. J. Anim. Sci. 73:2390–2405. doi: 10.2527/1995.7382390x [DOI] [PubMed] [Google Scholar]
  57. Zhao F. Q., and Keating A. F.. . 2007. Expression and regulation of glucose transporters in the bovine mammary gland. J. Dairy Sci. 90(Suppl 1):E76–E86. doi: 10.3168/jds.2006-470 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES