Skip to main content
PeerJ logoLink to PeerJ
. 2019 Oct 1;7:e7676. doi: 10.7717/peerj.7676

Detection and identification of Xanthomonas pathotypes associated with citrus diseases using comparative genomics and multiplex PCR

Natasha P Fonseca 1, Érica B Felestrino 1, Washington L Caneschi 1, Angélica B Sanchez 1, Isabella F Cordeiro 1, Camila GC Lemes 1, Renata AB Assis 1, Flávia MS Carvalho 2, Jesus A Ferro 2, Alessandro M Varani 2, José Belasque 3, Joao C Setubal 4, Guilherme P Telles 5, Deiviston S Aguena 6, Nalvo F Almeida 6,✉, Leandro M Moreira 1,7,✉
Editor: Maria del Carmen Portillo
PMCID: PMC6777491  PMID: 31592342

Abstract

Background

In Citrus cultures, three species of Xanthomonas are known to cause distinct diseases. X. citri subsp. citri patothype A, X. fuscans subsp. aurantifolii pathotypes B and C, and X. alfalfae subsp. citrumelonis, are the causative agents of cancrosis A, B, C, and citrus bacterial spots, respectively. Although these species exhibit different levels of virulence and aggressiveness, only limited alternatives are currently available for proper and early detection of these diseases in the fields. The present study aimed to develop a new molecular diagnostic method based on genomic sequences derived from the four species of Xanthomonas.

Results

Using comparative genomics approaches, primers were synthesized for the identification of the four causative agents of citrus diseases. These primers were validated for their specificity to their target DNA by both conventional and multiplex PCR. Upon evaluation, their sensitivity was found to be 0.02 ng/µl in vitro and 1.5 × 104 CFU ml−1 in infected leaves. Additionally, none of the primers were able to generate amplicons in 19 other genomes of Xanthomonas not associated with Citrus and one species of Xylella, the causal agent of citrus variegated chlorosis (CVC). This denotes strong specificity of the primers for the different species of Xanthomonas investigated in this study.

Conclusions

We demonstrated that these markers can be used as potential candidates for performing in vivo molecular diagnosis exclusively for citrus-associated Xanthomonas. The bioinformatics pipeline developed in this study to design specific genomic regions is capable of generating specific primers. It is freely available and can be utilized for any other model organism.

Keywords: Citrus canker, Molecular diagnostic, Xanthomonas, Multiplex PCR, Comparative genomics analysis

Introduction

Xanthomonas is a genus of phytopathogenic Gram-negative bacteria that cause a variety of diseases in several agricultural commodities, including citrus (Vauterin et al., 1995). These diseases cause huge economic losses to the agricultural sector. Consequently, bacteria from this genus have been targeted as an essential model of study in different pathosystems; for instance, X. oryzae in Oryza spp. (rice), X. campestris in Brassica spp. (cabbage), X. vesicatoria in Solanum spp. (potato), and X. citri in Citrus spp. (orange) (Ferreira-Tonin et al., 2012; Huang et al., 2017; Mansfield et al., 2012; Ryan et al., 2011; Vauterin et al., 1990). Since Xanthomonas are quarantine pests in all these pathosystems and controlling them with agrochemicals is very expensive, early detection is of paramount importance for the control and management of the diseases caused by these bacteria.

The Xanthomonas and citrus pathosystem is composed mainly of the following three species: X. citri subsp. citri pathotype A (XccA), X. fuscans subsp. aurantifolii (Xau), and X. alfalfae subsp. citrumelonis (Xacm). These bacteria damage crops and consequently cause losses (Schaad et al., 2005; Schaad et al., 2006) (Table 1). Although the pathosystem as here defined contains only three species, control and eradication efforts are complicated by the genetic diversity of the pathotypes, with varying degrees of aggressiveness and virulence  (Graham et al., 2004; Schubert et al., 2001). XccA, the causative agent of Asian citrus canker, is the most aggressive and virulent among the pathotypes. It infects all cultivated varieties of citrus hosts (Da Silva et al., 2002). In addition to the pathotype A, two other variants, A* (XccA*) and AW (XccAW) have been reported in previous studies  (Sun et al., 2004; Vernière et al., 1998). Although they are genetically close to type A, these variants are associated with a smaller set of compatible hosts (Table 1)  (Graham et al., 2004; Vernière et al., 1998). Xau is represented by two pathotypes known as B (XauB) and C (XauC). Pathotype B causes false citrus canker or cancrosis B, a less aggressive disease than citrus canker that affects sour lemons (Citrus limon) severely (Schubert et al., 2001; Goto, Takahashi & Messina, 1980). Pathotype C is the cause of cancrosis C, which is characterized by induction of hypersensitivity reaction in its hosts as described in ‘Galego’ acid lime (C. aurantifolia) (Schubert et al., 2001) and ‘Swingle’ citrumelo (Citrus paradisi × Poncirus trifoliata)  (Jaciani et al., 2009). Xacm, or pathotype E, is the causative agent of citrus bacterial spot. It is not classified as cancrosis since it does not cause typical corticosteroid lesions. However, citrus bacterial spot may be confused with cancrosis, and pathotype E is pathogenic in ‘Swingle’ citrumelo (Gottwald et al., 1991; Gottwald et al., 1988; Graham & Gottwald, 1990; Schoulties et al., 1987).

Table 1. Relation of compatible host and causal agents.

Host Pathogen
XccA XccAa XccAw XauB XauC Xacm
Citrus sinensis +++ – – + ± +
Citrus aurantium +++ – – + – +
Citrus limon ++ – – ++ + –
Citrus limonia +++ – – – + +
Citrus latifolia ++ – – – + +
Citrus aurantiifolia +++ + + + +++ +
Citrus macrophylla + – + – – –
Citrus paradisi× Poncirus trifoliata +++ – – – ++ +
Citrus reticulata (Tangerina ‘Ponkan’) + – – – + –
Citrus reticulata (Tangerina ‘Cravo’) ++ – – – + +
Citrus reshni + – – – + –
Citrus paradisi +++ – – – – +
Citrus maxima + – – + – –

Notes.

a

The results presented in this table are means of several reports of the disease in plantations and studies of pathogenicity tests (Schubert et al., 2001; Sun et al., 2004; Vernière et al., 1998; Gottwald et al., 1991; Gottwald et al., 1988; Graham & Gottwald, 1990; Schoulties et al., 1987; Jaciani et al., 2012).

+++ very pathogenic to host.

++ moderately pathogenic to host.

+ little pathogenic to the host.

Due to this considerable diversity in the characteristics of infection and disease spread, these bacteria are one of the main phytosanitary problems that affect and decimate Brazilian orange orchards. As they are cosmopolitan pathogens, they not only harm the economy of Brazil, a major citrus producer, but also the world (Jaciani et al., 2012). Since the management of the plants during cultivation and export are different for each infecting strain, correct diagnosis of the pathogen may reduce damages  (Graham et al., 2004).

Molecular diagnosis is a cost-effective option for identifying pathogens with great genetic proximity. Molecular biology techniques have been extensively used for identifying various species of the genus Xanthomonas (Adikini et al., 2011; Coletta-Filho et al., 2006; Mavrodieva, Levy & Gabriel, 2004; Munhoz et al., 2011; Ngoc et al., 2009; Park et al., 2006; Rigano et al., 2010; Trindade et al., 2007; Waite et al., 2016; Zhao et al., 2016). The genetic diversity of the Xanthomonas pathotypes that infect citus makes their correct identification a challenging task. The low sensitivity and false negative cases of serological tests (Vernière et al., 1998; Gottwald et al., 2009), and false positive amplifications of the molecular tests, demonstrate the need for new detection tests that are specific and that discriminate the different variants of this class of plant pathogens (Delcourt et al., 2013). Thus, this study aimed to develop a molecular detection method from unique genomic sequences, identified by comparative genomics, which can distinguish different Xanthomonas pathotypes infecting Citrus spp. These sequences are intended to be used only for detecting Xanthomonas isolates obtained from Citrus spp.

Materials and Methods

For a better understanding of the methodological steps involved in this study, a flowchart of actions was established (Fig. 1).

Figure 1. Experimental design.

Figure 1

Stages and procedures from the development of the in silico stages to the validation of the molecular results of the plant diagnosis.

Comparative Genomics for identification of pathotype-specific regions

In order to identify the pathotype-specific regions, we have built a very simple 4-step pipeline. The input for the method is the set of nucleotide FASTA sequences from the four genomes of the genus Xanthomonas, belonging to each of the disease-causing-pathotypes in citrus obtained from NCBI (Table 2). The first step is to pre-process sequences, to concatenate all contigs of each genome, in case of being in a draft condition, and also to concatenate all FASTA genome files in a unique one. This file is the input for the second step, where mauveAligner, from the Mauve package (Darling et al., 2004), is used to build a multiple sequence alignment. MauveAligner outputs unique regions defined as regions that are present in one genome but absent from at least one of the other genomes. We call these unique regions ‘Mauve islands’, and they are the input to a custom Perl script to pick out specific regions from each genome. The third step is to post-process data just to separate all specific regions in distinct FASTA files. The candidate regions found at this point are double-checked in the fourth step, using BLASTn (Altschul et al., 1997). BLASTn is then performed on each candidate region from genome G against the set of all genomes except G. The final output of this workflow consists of the list of all unique regions with no hits in this BLASTn run. This comparative genomics pipeline is freely available at https://git.facom.ufms.br/bioinfo/specific-primers, including a short and simple tutorial for installation and using, and can be used for any set of genomes in a regular Linux system.

Table 2. General characteristics of the reference genomes.

Organism WDCMa(Accession number) Abbreviations Genome NCBI reference sequence CDSs Ref
X. citri subsp. citri pathotype A strain 306 IBSBFb (1594) XccA306 Complete NC_003919.1 4,687 Da Silva et al. (2002)
Xanthomonas citri subsp. aurantifolii pathotype B strain 1561 IBSBF (409) XauB1561 Complete CP011250.1 4,397 AM Varani et al. (2017, unpublished data)
Xanthomonas citri subsp. aurantifolii pathotype C strain 1559 IBSBF (381) XauC1559 Complete CP011160.1 4,733 AM Varani et al. (2017, unpublished data)
X. alfalfae subsp. citrumelonis strain 1510 IBSBF (1925) Xacm1510 Draft GCF_005059785.1c 4,017 AM Varani et al. (2019, unpublished data)

Notes.

a

WDCM (World Data Centre for Microorganisms).

b

IBSBF—Instituto Biológico de São Paulo.

c

Xanthomonas euvesicatoria pv. citrumelonis strain 1,510 is the same as X. alfalfae subsp. citrumelonis strain 1,510 (https://www.ncbi.nlm.nih.gov/nuccore/NZ_LAUO00000000.1).

Other specific regions finders are available in the literature, for instance Insignia (Phillippy et al., 2009). Insignia is a web application where the user can find specific regions from a genomic sequence, but only against sequences available currently in the previously populated database by the authors. On the other hand, our tool is a very easy-to-install and easy-to-use stand-alone tool where the user can find specific regions against any set of genomes (available in databases or not), even draft ones.

Selection of specific sequences and production of primers

The sets of unique regions determined for each genome were used as a reference for the selection of the primers using Primer-BLAST tool  (Ye et al., 2012). To verify the specificity of each primer to their target DNA, each generated primer was subjected to local alignment against Xanthomonas pathotypes that infect citrus using BLASTn. Primers that demonstrated specificity and ability to form amplicons of different sizes among the analyzed pathotype were selected for in vitro empirical verification.

In silico evaluation of possible false positive amplifications

To verify false positive amplifications from other Xanthomonas species or other plant-associated microorganisms whose DNA could be extracted from infected plant tissue, the primers were compared against all sequences available at GenBank (using BLASTn against NT database).

Bacterial strain and growth conditions

For the biological assays, 16 strains belonging to the pathotype XccA (7 strains), XauB (2 strains), XauC (5 strains), and Xacm (2 strains) were selected. These strains came from culture collections maintained by the Agronomy School of the University of São Paulo (ESALQ) and by the Faculty of Agrarian and Veterinary Sciences of the State University of São Paulo (Campus Jaboticabal), both in the state of São Paulo, Brazil. The isolates were reactivated in nutrient agar medium—NA (5 g/l peptone, 3 g/l beef extract, 15 g/l agar, pH 6.8–7.0) and incubated at 28 °C for 48 h for XccA and Xacm strains and 96 h for XauB and XauC strains. Then, a colony was grown in nutrient broth medium (NB; NA without agar) under agitation at 250 rpm at 28 °C for 12 h.

In addition to the citrus-pathogenic Xanthomonas isolates, the markers have also been tested against other Xanthomonas strains that are not known to infect citrus: X. axonopodis pv. vignicola FDC 1701 (IBSBF 1739), X. axonopodis pv. vesicatoria 1387 (IBSBF 1387), X. axonopodis pv. vesicatoria FDC 1689 (IBSBF 331), X. axonopodis pv. allii 1770 (IBSBF 1770), X. axonopodis pv. phaseoli IAC 11280, X. alfafae subsp. alfalfae FDC 1711 (IBSBF 3174), X. axonopodis pv. passiflorae M89, X. axonopodis pv. patelli FDC 1727 (IBSBF 3181), X. axonopodis pv. coracanae FDC 1729 (IBSBF 3187), X. axonopodis pv. manihotis 1954 (IBSBF 1954), X. axonopodis pv. phaseoli var. fuscans IAC13755, X. citri pv. rhynchosiae FDC 1721 (IBSBF 3184), X. axonopodis vasculorum 2008 (IBSBF 2008), X. axonopodis pv. axonopodis FDC 1696 (IBSBF 1444), X. axonopodis pv. dieffenbachiae 1478 (IBSBF 1478), X. axonopodis pv. glycines FDC 1694 (IBSBF 333), X. citri pv. cajani FDC 1718 (IBSBF 3180), X. citri pv. sesbaniae FDC 1719 (IBSBF 3179), and against Xylella fastidiosa strain 9a5c (Simpson et al., 2000), a phytopathogenic bacterium that is disseminated by insects among citrus.

Extraction of DNA from isolates

The DNA of the isolates was extracted with the Spin Tissue™ Core Kit (Qiagen Biosciences, MD, USA) following the manufacturer’s recommendations.

Inoculation of the isolates in the leaves and genomic DNA extraction from bacterial cells in exudate

The bacteria were inoculated into Hamlin-type orange leaves with a needleless syringe. The syringe was pressed lightly into the abaxial part of the leaf to allow entry of the phytopathogen into the intercellular space of the leaf. A leaf from the same plant was inoculated likewise with ultrapure water as a negative control. Immediately after the inoculation, the inoculated area was cut into small pieces, and bacterial exudation was carried out.

To mimic the condition of naturally infected plants, spray inoculation methods were also used. Spray inoculation was perform in ‘Pera-rio’ orange leaves according to the methods described by Yan and Wang (Yan & Wang, 2011). After 30 days of inoculation, leaves containing lesions were detached from the plants and each lesion was cut into small pieces to get the exudate with bacteria. The inoculated area/lesions were submerged in 1 mL of ultrapure water for 30 min and agitated for 5 min to facilitate bacterial exudation from the leaf. After agitation, genomic DNA extraction from bacterial cells in the exudate was performed with a rapid manual DNA extraction protocol. The exudate was centrifuged at 16,000 × g for 4 min at 4 °C and washed twice with an isotonic solution (33 mM KH2PO4, 60 mM K2HPO4, 7.6 mM (NH4)2SO4, 3.3 mM sodium citrate, and 4.0 mM MgSO4). The pellet was resuspended in lysis buffer (10 mM Tris–HCl 1 M, pH 8.0; 100 mM EDTA 0.5 M, pH 8.0; 10 mM NaCl 5 M; 0.5% of 10% SDS), and isotonic solution with subsequent extraction with phenol and incubation with RNAse (5 mg/ml) for 1 h at 37 °C. After further extraction with phenol, the DNA was precipitated with ethanol and sodium acetate (7.5 M, pH 7.4) and then diluted in Tris–EDTA buffer 10:0.1.

PCR conditions

PCR amplifications were carried out in a final volume of 25µl. The final concentrations of the reagents in the reaction were: 2 mM MgCl2, 200 µM dNTPs, 0.2 µM of each primer (Foward and Reverse), 1 unit of Taq DNA polymerase™ (CellCo, SP, Brazil) and 0.4 ng of the DNA sample from the isolates grown in medium or 1 µl of the total DNA extracted from the exudates. The initial denaturation temperature was 94 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 59 °C for 45 s and extension at 72 °C for 45 s, followed by a final extension at 72 °C for 5 min. Verification of PCR amplicons was established by applying 10 µl of the PCR product in 3.0% (w/v) agarose gel.

Multiplex PCR

Multiplex PCR amplifications (mPCR) were also performed in final volumes of 25 µl. The final concentration of the reagents in the reaction was the same as on the conventional PCR, except for increasing the concentration of dNTPs to 400 µM and using 0.2 µM of each primer (Forward and Reverse) of all four primer pairs (XccAm, XauBm, XauCm, and Xacmm) in the same reaction.

Sensitivity of PCR

To verify the sensitivity of the PCR reaction in vitro, progressive dilutions of DNA from the isolates were performed until the amplification checked the minimal DNA concentration detectable by PCR. The isolates used in this test were XccA strain 306 (XccA 306), XauB strain FDC 1561 (XauB 1561), XauC strain FDC 1559 (XauC 1559), and Xacm strain 1510 (Xacm 1510). For leaf testing, sensitivity was found from minimal inoculations of leaf bacteria (1.5 × 107, 1.5 × 106, 1.5 × 105, 1.5 × 104, 1.5 × 103 CFU ml−1) with consequent lower extraction of DNA from the exudate.

In-silico PCR

The in-silico PCR was performed using the tool ‘In silico PCR amplification’ (San Millán et al., 2013) available at http://insilico.ehu.eus/.

Results

Specific sequences and selection of primers

Mauve found 5,217 islands. From these, 173 candidates for specific regions of XccA 306, 59 of XauB 1561, 55 of XauC 1559 and 38 of Xacm 1510 were identified. After the BLAST refinement step, we found 135 specific regions of XccA 306, 23 of XauB 1561, 12 of XauC 1559, and 33 of Xacm 1510. From the sequences, a pair of primers were developed for each Xanthomonas pathotype. Each marker was developed using a different amplicon size, allowing its differentiation from the other pathotypes. The primer sequences and their respective amplicons are described in Table 3. Primer XccAm appears to amplify part of a hypothetical gene and a transcriptional activator FtrA, generating a 509bp amplicon. Primer XauBm amplifies an intergenic region (434 bp); primer XauCm amplifies part of a hypothetical gene (160 bp) and primer Xacmm amplifies part of a gene encoding a D-alanyl-D-alanine synthetase A (115 bp). Due to the intraspecific genetic proximity between Xanthomonas, a reference genome was used for each target pathotype.

Table 3. Molecular markers selected for the assays.

The oligonucleotides and amplicons generated by PCR are protected by the patent application registration under process number BR 10 2018 067332 7.

Pathotypes Markers Forward Reverse Amplicon size (bp) Tm (°C)
XccA XccAm ATGCTGAGCAAGCCTTCGAT AGCTGGGAACGATGATGGTG 509 59
XauB XauBm TCGATCGCACGGACTACTTG AAAATGCGGCTCTCCCTCTC 434 59
XauC XauCm CACTGGAGGCAGGAGTCGAG CCACCCTCAAGTTCAGCAACA 160 59
Xacm Xacmm ACCAACACCTTGTGGTCGTA TGTTCGTCAAACCGGCCA 115 59

BLASTn analysis of the primers against NCBI’s non-redundant sequence database NT revealed high sequence specificity (100% identity) for the citrus-associated Xanthomonas pathothypes in all cases, and also for other non-citrus-associated Xanthomonas species (80–100% identity). However, in silico analysis of the possible amplicons generated in the non-citrus-associated species indicated different sizes from those expected for the defined targets. Only one pair of primers (XauC) indicated possible amplification in the case of Stenotrophomonas maltophilia, a bacterium that lives in aqueous environments, soil, and plants. However, the coverage of the XauCm forward and reverse primers on the genome of Stenotrophomonas maltophilia is not complete and the size of in silico amplicon is not similar to that of previously predicted amplicon for XauC.

Specificity of molecular markers and sensitivity of PCR

The specificity for citrus-associated Xanthomonas verified in silico was confirmed as shown in Fig. 2. Primer XccAm generated an amplicon of size 509 bp, primer XauBm generated an amplicon of 434 bp, primer XauCm generated an amplicon of 160 bp, and primer Xacmm generated an amplicon of 115 bp for their corresponding pathotypes. All markers generated unique amplicons for their respective target DNAs without cross-amplifications for other investigated strains. Progressive dilutions of the target DNA verified the in vitro sensitivity. The minimum concentrations that allowed PCR amplification were 0.02 ng/µl for XccA (∼70 cells), 0.03 ng/µl for XauB (∼100 cells), 0.12 ng/µl for XauC (∼400 cells), and 0.07 ng/µl Xacm (∼200 cells) (Fig. 3).

Figure 2. Specificity of molecular markers in vitro.

Figure 2

Conventional PCR electrophoresis using Xcc-specific oligonucleotides for Xanthomonas citri subsp. citri pathotypes A (XacA) and A* (XacA*) with a 509 bp amplicon, (A) Xanthomonas fuscans subsp. aurantifolii pathotype B (XauB) with 434 bp amplicon, (B) Xanthomonas fuscans subsp. aurantifolii pathotype C (XauC) with 160 bp amplicon, (C) Xanthomonas alfalfae subsp. citrumelonis (Xacm) with an amplicon of 115 bp, and (D) MW, molecular weight (ladder 100 bp).

Figure 3. Progressive DNA dilutions demonstrating the sensitivity of PCR.

Figure 3

(A) XccA (0.02 ng/µl, ∼70 cells), (B) XauB (0.03 ng/µl, ∼100 cells), (C) XauC (0.12 ng/µl, ∼400 cells), and (D) Xacm (0.07 ng/µl, ∼200 cells). MW, molecular weight (ladder 100 bp).

These results were reproducible when the markers were subject to multiplex PCR with their respective target DNAs and with the DNAs of the four pathotypes (Fig. 4). Despite the findings in silico, when tested with the other 18 species of Xanthomonas that do not infect citrus, the markers developed for XccA, XauB, and XauC did not demonstrate amplification with any of these isolates (Fig. 5). In contrast, Xacmm amplified a weak fragment for five of the investigated strains (X. axonopodis pv. vesicatoria 1689, X. axonopodis pv. passiflorae M89, X. axonopodis pv. manihotis IBSBF1954, X. axonopodis pv. axonopodis 1696, and X. axonopodis pv. glycines 1694), but with a different amplicon size (∼125 bp) without correspondence to the established standards for citrus-associated xanthomonads. Although now empirically shown, this result does not affect detection since none of these strains with false positive amplification infects citrus. Finally, no amplicons were generated due to cross-amplification with DNA from Xylella, a plant pathogen that also infects citrus.

Figure 4. Multiplex PCR of Xanthomonas that infect citrus.

Figure 4

(A) Multiplex PCR electrophoresis containing the combination of the DNA of one species with all pairs of specific primers generating only their amplicon (lines 2–5). MP—Combination of DNAs of all pathotypes with all primers (line 6). MW, molecular weight (ladder 100 bp) and (B) Theoretical electrophoresis of multiplex PCR.

Figure 5. Multiplex PCR electrophoresis of Xanthomonas sp. that do not infect citrus.

Figure 5

(1701)—X. axonopodis pv. vignicola strain 1701; (1387)—X. axonopodis pv. vesicatoria strain IBSBF1387; (1689)—X. axonopodis pv. vesicatoria strain 1689; (1770)—X. axonopodis pv. allii strain IBSBF1770; (11280)—X. axonopodis pv. phaseoli strain IAC11280; (1711)—X. alfafae subsp. alfalfae strain 1711; (M89)—X. axonopodis pv. passiflorae strain M89; (1727)—X. axonopodis pv. patelli strain 1727; (1729)—X. axonopodis pv. coracanae strain strain 1729; (1954)—X. axonopodis pv. manihotis strain IBSBF 1954; (13755)—X. axonopodis pv. phaseoli var. fuscans strain IAC13755; (1721)—X. citri pv. rhynchosiae strain 1721; (2008)—X. axonopodis pv. vasculorum strain IBSBF 2008; (1696)—X. axonopodis pv. axonopodis strain 1696; (1478)—X. axonopodis pv. dieffenbachiae strain IBSBF 1478; (1694)—X. axonopodis pv. glycines strain 1694; (1718)—X. citri pv. cajani strain 1718; (1719)—X. citri pv. sesbaniae strain 1719; (Xf) Xylella fastidiosa strain 9a5c. MW, molecular weight (ladder 100 bp).

In vivo assays replicated the results obtained in vitro. The markers were specific for the inoculated bacterium (Fig. 6) and citrus canker lesions (Fig. 7) without cross-reaction with any other DNA that may have been extracted from exudate, including endophytic DNA. Additionally, the plants inoculated with water did not amplify with any marker tested, confirming the specificity for bacteria of the genus Xanthomonas (Fig. 6). For the exudate, the minimum concentrations that allowed PCR amplification were approximately 1.5 × 104 CFU mL−1 for XccA, 1.5 × 105 CFU mL−1 for XauB, 1.5 × 105 CFU mL−1 for XauC, and 1.5 × 104 CFU mL−1 for Xacm (Fig. 6).

Figure 6. Specificity and sensitivity of amplification by in vivo PCR.

Figure 6

Conventional PCR of bacterial exudate using the specific markers for XccA, XauB, XauC, and Xacm. The minimum concentration detected by PCR (A) for XccA was 1.5 × 104 CFU ml−1, (B) for XauB was 1.5 × 105 CFU ml−1, (C) for XauC was 1.5 × 105 CFU ml−1, and (D) for Xacm 1.5 × 104 CFU ml−1. PC, positive control. NC, negative control of leaves inoculated with water. MW, molecular weight (ladder 100 bp).

Figure 7. Specificity of the markers in exudate samples from leaves inoculated by spraying with XccA strain.

Figure 7

PC, Positive control in vitro DNA extraction; XccA, XauB, XauC, and Xacm PCR using XccAm, XauBm, XauCm, and Xacmm specific markers respectively, for exudate samples of citrus canker lesions induced by XacA 306. MW, molecular weight (ladder 100 bp).

Discussion

Currently, the citrus disease of greatest concern to citrus growers worldwide is greening, also known as Huanglongbin (HLB) (Gottwald, Graça & Bassanezi, 2007). However, citrus canker still is a problem for the citrus industry due to its virulence and rapid propagation characteristics (Ference et al., 2017). Coupled with deficiencies in maintaining legislation and inspecting contaminated orchards, citrus canker causes great losses to farmers worldwide (Behlau, Fonseca & Belasque, 2016). Thus, the correct identification of the pathogen is crucial to restrain this disease, given that the management of plants during cultivation and export may differ with each infecting strain (Graham et al., 2004).

Due to its high virulence and host range, the development of diagnostics is aimed towards the detection of XccA strains, the causative agent of Asian citrus canker. Currently, field detection is performed through rapid tests based on the immune-identification of its proteins as Xcc ImmunoStrip® Test, Agdia, Inc. (Catalog number: STX 92200), but there are several studies that have developed serological diagnoses for XccA  (Goto, Takahashi & Messina, 1980; Trindade et al., 2007; Afonso et al., 2013; Alvarez et al., 1991; Bach & Alba, 1993; Bach & Guzzo, 1994; Yano et al., 1979). However, these tests have low sensitivity, and in some cases, false negative results have already been reported in phenotypically different strains of XccA (Vernière et al., 1998; Gottwald et al., 2009). Additionally, its high cost per sample is a significant disadvantage when compared to methods based on molecular biology techniques.

Some studies have already demonstrated the potential of molecular diagnosis for Xanthomonas, more specifically for XccA strains, based on several techniques such as conventional PCR, multiplex PCR, real-time PCR (qPCR), nested-PCR, loop-mediated isothermal amplification (LAMP-PCR), droplet digital polymerase chain reaction (ddPCR), BOX-PCR, and FISH  (Coletta-Filho et al., 2006; Mavrodieva, Levy & Gabriel, 2004; Munhoz et al., 2011; Ngoc et al., 2009; Park et al., 2006; Rigano et al., 2010; Waite et al., 2016; Zhao et al., 2016; Golmohammadi et al., 2007; Hartung, Daniel & Pruvost, 1993; Kositcharoenkul, Chatchawankanphanich & Bhunchoth, 2011; Cubero & Graham, 2001; Cubero & Graham, 2002; Cubero & Graham, 2005). The wide variety of techniques used in the molecular diagnostics developed for citrus canker solved the problem of cost and low sensitivity presented by serological methods. However, the false-positive amplifications already highlighted among strains of genetically close variants, such as XccA and Xau, once again reveal the need for new detection methods that are specific and that distinguish the different pathotypes of these plant pathogens (Delcourt et al., 2013). Thus, to the best of our knowledge, this is the first study that presents a single method that simultaneously distinguishes the four pathotypes of Xanthomonas that infect citrus. In this method, each of these four pathotypes will have its own distinct amplicon.

It is important to emphasize that the method presented here is not a general method for identifying the Xanthomonas strains discussed here with respect to other bacterial isolates. The application setting for which the detection tool was designed is for strains isolated from citrus trees only.

The specificity verified in the results enables the adoption of individualized management for each pathotype, which could reduce cultivation losses. Although BLASTn analysis of primer sequences against genomes deposited in NCBI has shown that non-specific binding to other Xanthomonas genomes may occur, two factors must be considered with respect to false positives: (a) a possible PCR product generated for other species of Xanthomonas would likely have a different size from that observed for citrus pathotypes; (b) as far as we know, the only members of the Xanthomonas genus that infect citrus are the ones considered here. Therefore we think that the probability of amplification of false positives in samples from diseased trees is small, which is corroborated by the analyses presented in Fig. 5.

The sensitivity of the PCR in vivo tests shows the potential of its usage as a preventive detection tool since it can detect as little as 104 CFU of bacteria, allowing the pathogen to be screened during the colonization and survival phase of its life cycle, avoiding its later dissemination and infection of healthy plants. Remaining canker lesions under favorable conditions have a concentration of up to 107–108 CFU of viable bacteria for a new infection (Graham, Gerberich & Davis, 2016; Pruvost et al., 2002).

Another potential benefit of the correct detection of Xanthomonas strains presented here is its use on seedlings that will be distributed to rural producers, since the introduction of infected seedlings in orchards is one of the mechanisms of dissemination of the bacteria to healthy plants (Schubert et al., 2001; Schoulties et al., 1987; Das, 2003). Additionally, our method can be used for a biogeographic survey of the pathotypes, to trace the distribution profile among citrus orchards throughout the world. This becomes important for epidemiological surveillance of this phytopathogen, as this type of analysis is typically hampered by the lack of adequate molecular typing techniques for surveillance and outbreak investigation (Ngoc et al., 2009).

Our approach is based on conventional PCR because it is an accessible and inexpensive technique, without compromising the quality of the analysis. Furthermore, the present study has established the detection of all pathotypes in the same PCR reaction, as demonstrated in the results of multiplex PCR. This technique increases the importance of the detection method, since the same sample can be submitted to a PCR reaction with all the primers, reducing the time for obtaining the result. Another technique used in our study, which could enhance the speed of detection, was the extraction of total DNA from the exudate of the leaves. This extraction takes less than four hours to be carried out; thus, there is no need to wait for several days for bacterial growth from its lesion isolation.

Collectively, both experimental procedures make the methodology feasible on a large scale and at a reduced cost. It is important to highlight that the variable size of the PCR products for each pathotype was established to facilitate its identification, and the use of PCR-RFLP would only be justifiable to verify genetic diversity within species, which is not the objective of this study. Moreover, although we did not use the TaqMan system to verify the potential of these molecular markers in the identification of these pathogens, it is likely that the use of this system would only make detection sensitivity higher than that observed by conventional PCR, as described for other organisms (Ranjbar et al., 2014; Angelone-Alasaad et al., 2015; Zhou et al., 2017). However, the cost of analysis would be higher, which could significantly burden large-scale analyses.

Thus, our results not only allow the correct identification of the four pathotypes of Xanthomonas that infect citrus, but they also point to a possible bioinformatics pipeline for the production of species-specific molecular markers for any set of genomes defined by the user. The high specificity and sensitivity obtained demonstrated the effectiveness of our bioinformatics analysis.

Conclusions

In summary, the identification of unique sequences from different genomes, using comparative genomics, allowed the development of specific molecular markers. This is the first conventional or multiplex PCR-based method that discriminates four different citrus-associated Xanthomonas pathotypes. This study further describes an effective pipeline for the generation of species-specific molecular markers.

Acknowledgments

Thanks to all members of the Laboratory of Biochemistry and Molecular Biology (LBBM, Federal University of Ouro Preto, UFOP) and the Laboratory of Biochemistry and Molecular Biology of Faculty of Agrarian and Veterinary Sciences UNESP, Jaboticabal campus for their support. Thanks, Dr. Fabrício Jaciani, FUNDECITRUS researcher, for the critical help in finalizing this paper.

Funding Statement

The following agencies supported this work: the National Council of Technological and Scientific Development (CNPq Process 481226/2013-3), Foundation of Protection to Research of the State of Minas Gerais–FAPEMIG (process APQ-02387-14), Fundect-MS (007/2015 SIAFEM 025139) and Coordination for the Improvement of Higher Education Personnel (CAPES) (the BIGA Project, CFP 51/2013, process 3385/2013). Leandro Marcio Moreira, João Carlos Setubal, Nalvo Franco de Almeida, and Jesus Aparecido Ferro have a research fellowship from CNPq. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Contributor Information

Nalvo F. Almeida, Email: nalvo@facom.ufms.br.

Leandro M. Moreira, Email: lmmorei@gmail.com, lmmorei@ufop.edu.br.

Additional Information and Declarations

Competing Interests

João C. Setubal is an Academic Editor for PeerJ.

Commercial use of the oligonucleotides and amplicons generated by PCR in this work is protected by Brazillian patent application number BR 10 2018 067332 7.

Author Contributions

Natasha P. Fonseca conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft.

Érica B. Felestrino, Washington L. Caneschi, Angélica B. Sanchez and Deiviston S. Aguena performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper.

Isabella F. Cordeiro, Camila G.C. Lemes and Renata A.B. Assis performed the experiments, authored or reviewed drafts of the paper.

Flávia M.S. Carvalho performed the experiments, contributed reagents/materials/analysis tools, authored or reviewed drafts of the paper.

Jesus A. Ferro conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, authored or reviewed drafts of the paper.

Alessandro M. Varani and Joao C. Setubal conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft, revised the language.

José Belasque and Guilherme P. Telles conceived and designed the experiments, contributed reagents/materials/analysis tools, authored or reviewed drafts of the paper.

Nalvo F. Almeida and Leandro M. Moreira conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft.

Patent Disclosures

The following patent dependencies were disclosed by the authors:

The oligonucleotides and amplicons generated by PCR are protected by the patent application registration under process number BR 10 2018 067332 7. Updates on the patent status will be available at https://gru.inpi.gov.br/pePI/jsp/patentes/PatenteSearchBasico.jsp.

Data Availability

The following information was supplied regarding data availability:

The sequences are available on NCBI: NC_003919.1 (XccA306), CP011250.1 (XauB1561), CP011160.1 (XauC1559), and GCF_005059785.1 (Xacm1510).

References

  • Adikini et al. (2011).Adikini S, Tripathi L, Beed F, Tusiime G, Magembe EM, Kim DJ. Development of a specific molecular tool for detecting Xanthomonas campestris pv. musacearum. Plant Pathology. 2011;60:443–452. doi: 10.1111/j.1365-3059.2010.02419. [DOI] [Google Scholar]
  • Afonso et al. (2013).Afonso AS, Zanetti BF, Santiago AC, Henrique-Silva F, Mattoso LHC, Faria RC. QCM immunoassay for recombinant cysteine peptidase: a potential protein biomarker for diagnosis of citrus canker. Talanta. 2013;104:193–197. doi: 10.1016/j.talanta.2012.11.003. [DOI] [PubMed] [Google Scholar]
  • Altschul et al. (1997).Altschul S, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Alvarez et al. (1991).Alvarez AM, Benedict AA, Mizumoto CY, Pollard LW, Civerolo EL. Analysis of Xanthomonas campestris pv. citri and X. c. citrumelo with monoclonal antibodies. Phytopathology. 1991;81:857–865. doi: 10.1094/Phyto-81-857. [DOI] [Google Scholar]
  • Angelone-Alasaad et al. (2015).Angelone-Alasaad S, Molinar Min A, Pasquetti M, Alagaili AN, D’Amelio S, Berrilli F, Obanda V, Gebely MA, Soriguer RC, Rossi L. Universal conventional and real-time PCR diagnosis tools for Sarcoptes scabiei. Parasit Vectors. 2015;8 doi: 10.1186/s13071-015-1204-8. Article 587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bach & Alba (1993).Bach EE, Alba APC. Cross-reactive antigens between Xanthomonas campestris pv. citri pathotypes and citrus species. Journal of Phytopathology. 1993;138:84–89. doi: 10.1111/j.1439-0434.1993.tb01363. [DOI] [Google Scholar]
  • Bach & Guzzo (1994).Bach EE, Guzzo SD. Serological relationship and chemical composition of exopolysaccharides (EPS) from different pathotypes of Xanthomonas campestris pv. citri and Xanthomonas campestris pv. manihotis. Journal of Phytopathology. 1994;141:1–9. doi: 10.1111/j.1439-0434.1994.tb01440. [DOI] [Google Scholar]
  • Behlau, Fonseca & Belasque (2016).Behlau F, Fonseca AE, Belasque J. A comprehensive analysis of the asiatic citrus canker eradication programme in São Paulo state, Brazil, from 1999 to 2009. Plant Pathology. 2016;65:1390–1399. doi: 10.1111/ppa.12503. [DOI] [Google Scholar]
  • Coletta-Filho et al. (2006).Coletta-Filho HD, Takita MA, De Souza AA, Neto JR, Destéfano SAL, Hartung JS, Machado MA. Primers based on the rpf gene region provide improved detection of Xanthomonas axonopodis pv. citri in naturally and artificially infected citrus plants. Journal of Applied Microbiology. 2006;100:279–285. doi: 10.1111/j.1365-2672.2005.02787. [DOI] [PubMed] [Google Scholar]
  • Cubero & Graham (2001).Cubero J, Graham JH. Quantitative PCR method for diagnosis of citrus bacterial canker. Applied and Environmental Microbiology. 2001;67:2849–2852. doi: 10.1128/AEM.67.6.2849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cubero & Graham (2002).Cubero J, Graham JH. Genetic relationship among worldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their identification by PCR. Applied and Environmental Microbiology. 2002;68:1257–1264. doi: 10.1128/AEM.68.3.1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cubero & Graham (2005).Cubero J, Graham JH. Quantitative real-time polymerase chain reaction for bacterial enumeration and allelic discrimination to differentiate Xanthomonas strains on citrus. Phytopathology. 2005;95:1333–1340. doi: 10.1094/PHYTO-95-1333. [DOI] [PubMed] [Google Scholar]
  • Da Silva et al. (2002).Da Silva ACR, Ferro JA, Reinach FC, Farah CS, Furlan LR, Quaggio RB, Monteiro-Vitorello CB, Van Sluys MA, Almeida NF, Alves LMC, Amaral AM, Bertolini MC, Camargo LEA, Camarotte G, Cannavan F, Cardozo J, Chambergo F, Ciapina LP, Cicarelli RMB, Coutinho LL, Cursino-Santos JR, El-Dorry H, Faria JB, Ferreira AJS, Ferreira RCC, Ferro MIT, Formighieri EF, Franco MC, Greggio CC, Gruber A, Katsuyama AM, Kishi LT, Leite RP, Lemos EGM, Lemos MVF, Locali EC, Machado MA, Madeira AMBN, Martinez-Rossi NM, Martins EC, Meidanis J, Menck CFM, Miyaki CY, Moon DH, Moreira LM, Novo MTM, Okura VK, Oliveira MC, Oliveira VR, Pereira HA, Rossi A, Sena JAD, Silva C, Souza RF, Spinola LAF, Takita MA, Tamura RE, Teixeira EC, Tezza RID, Santos MT, Truffi D, Tsai SM, White FF, Setubal JC, Kitajima JP. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature. 2002;417:459–463. doi: 10.1038/417459. [DOI] [PubMed] [Google Scholar]
  • Darling et al. (2004).Darling ACE, Mau B, Blattner FR, Perna NT. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Research. 2004;14:1394–1403. doi: 10.1101/gr.2289704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Das (2003).Das AK. Citrus canker—a review. Journal of Applied Horticulture. 2003;5:52–60. [Google Scholar]
  • Delcourt et al. (2013).Delcourt S, Vernière C, Boyer C, Pruvost O, Hostachy B, Robène-Soustrade I. Revisiting the specificity of PCR primers for diagnostics of Xanthomonas citri pv. citri by experimental and in silico analyses. Plant Disease. 2013;97:373–378. doi: 10.1094/PDIS-04-12-0351. [DOI] [PubMed] [Google Scholar]
  • Ference et al. (2017).Ference CM, Gochez AM, Behlau F, Wang N, Graham JH, Jones JB. Recent advances in understanding Xanthomonas citri subsp. citri pathogenesis and citrus canker disease management. Molecular Plant Pathology. 2017;19:1302–1318. doi: 10.1111/mpp.12638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ferreira-Tonin et al. (2012).Ferreira-Tonin M, Rodrigues-Neto J, Harakava R, Lanza Destéfano SA. Phylogenetic analysis of Xanthomonas based on partial rpoB gene sequences and species differentiation by PCR-RFLP. International Journal of Systematic and Evolutionary Microbiology. 2012;62:1419–1424. doi: 10.1099/ijs.0.028977-0. [DOI] [PubMed] [Google Scholar]
  • Golmohammadi et al. (2007).Golmohammadi M, Cubero J, Peñalver J, Quesada JM, López MM, Llop P. Diagnosis of Xanthomonas axonopodis pv. citri, causal agent of citrus canker, in commercial fruits by isolation and PCR-based methods. Journal of Applied Microbiology. 2007;103:2309–2315. doi: 10.1111/j.1365-2672.2007.03484. [DOI] [PubMed] [Google Scholar]
  • Goto, Takahashi & Messina (1980).Goto M, Takahashi T, Messina MA. A Comparative study of the strains of Xanthomonas campestris pv. citri isolated from citrus canker in Japan and cancrosis B in Argentina. Annals of the Phytopathological Society of Japan. 1980;46:329–338. doi: 10.3186/jjphytopath.46.329. [DOI] [Google Scholar]
  • Gottwald et al. (1991).Gottwald TR, Alvarez AM, Hartung JS, Benedict AA. Diversity of Xanthomonas campestris pv. citrumelo strains associated with epidemics of citrus bacterial spot in Florida citrus nurseries: correlation of detached leaf, monoclonal antibody, and restriction fragment length polymorphism assay. Phytopathology. 1991;81:749–753. doi: 10.1094/Phyto-81-749. [DOI] [Google Scholar]
  • Gottwald et al. (1988).Gottwald TR, Civerolo EL, Garnsey SM, Brlansky RH, Graham JH, Gabriel DW. Dynamics and spatial distribution of Xanthomonas campestris pv. citri group E strains in simulated nursery and new grove situations. Plant Disease. 1988;72:781–787. doi: 10.1094/PD-72-0781. [DOI] [Google Scholar]
  • Gottwald, Graça & Bassanezi (2007).Gottwald TR, Graça JV, Bassanezi RB. Citrus Huanglongbing: the pathogen and its impact. Plant Health Progress. 2007;8:1–36. doi: 10.1094/PHP-2007-0906-01-RV. [DOI] [Google Scholar]
  • Gottwald et al. (2009).Gottwald TR, Graham J, Bock C, Bonn G, Civerolo E, Irey M, Leite R, McCollum G, Parker P, Ramallo J, Riley T, Schubert T, Stein B, Taylor E. The epidemiological significance of post-packinghouse survival of Xanthomonas citri subsp. citri for dissemination of asiatic citrus canker via infected fruit. Crop Protection. 2009;28:508–524. doi: 10.1016/j.cropro.2009.02.003. [DOI] [Google Scholar]
  • Graham, Gerberich & Davis (2016).Graham JH, Gerberich KM, Davis CL. Injection–infiltration of attached grapefruit with Xanthomonas citri subsp. citri to evaluate seasonal population dynamics in citrus canker lesions. Journal of Phytopathology. 2016;164:528–533. doi: 10.1111/jph.12478. [DOI] [Google Scholar]
  • Graham & Gottwald (1990).Graham JH, Gottwald TR. Variation in aggressiveness of Xanthomonas campestris pv. citrumelo associated with citrus bacterial spot in Florida citrus nurseries. Phytopathology. 1990;80:190–196. doi: 10.1094/Phyto-80-190. [DOI] [Google Scholar]
  • Graham et al. (2004).Graham JH, Gottwald DTR, Cubero J, Achor DS. Xanthomonas axonopodis pv. citri: factors affecting successful erradication of citrus canker. Molecular Plant Pathology. 2004;5:1–15. doi: 10.1046/J.1364-3703.2003.00197. [DOI] [PubMed] [Google Scholar]
  • Hartung, Daniel & Pruvost (1993).Hartung JS, Daniel JF, Pruvost OP. Detection of Xanthomonas campestnis pv. citri by the polymerase chain reaction method. Applied and Environmental Microbiology. 1993;59:1143–1148. doi: 10.1094/PHYTO-95-1333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Huang et al. (2017).Huang R, Hui S, Zhang M, Li P, Xiao J, Li X, Yuan M, Wang S. A conserved basal transcription factor is required for the function of diverse TAL effectors in multiple plant hosts. Frontiers in Plant Science. 2017;8:1–10. doi: 10.3389/fpls.2017.01919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Jaciani et al. (2009).Jaciani FJ, Destéfano SAL, Neto JR, Belasque J. Detection of a new bacterium related to Xanthomonas fuscans subsp. aurantifolii infecting swingle citrumelo in Brazil. Plant Disease. 2009;93:1074–1074. doi: 10.1094/PDIS-93-10-1074B. [DOI] [PubMed] [Google Scholar]
  • Jaciani et al. (2012).Jaciani FJ, Ferro JA, Ferro MIT, Vernière C, Pruvost O, Belasque J. Genetic Diversity of a brazilian strain collection of Xanthomonas citri subsp. citri based on the type III effector protein genes. Plant Disease. 2012;96:193–203. doi: 10.1094/PDIS-04-11-0357. [DOI] [PubMed] [Google Scholar]
  • Kositcharoenkul, Chatchawankanphanich & Bhunchoth (2011).Kositcharoenkul N, Chatchawankanphanich O, Bhunchoth A. Detection of Xanthomonas citri subsp. citri from field samples using single-tube nested PCR. Plant Pathology. 2011;60:436–442. doi: 10.1111/j.1365-3059.2010.02390. [DOI] [Google Scholar]
  • Mansfield et al. (2012).Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P, Dow M, Verdier V, Beer SV, Machado MA, Toth I, Salmond G, Foster GD. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular Plant Pathology. 2012;13:614–629. doi: 10.1111/j.1364-3703.2012.00804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Mavrodieva, Levy & Gabriel (2004).Mavrodieva V, Levy L, Gabriel DW. Improved sampling methods for real-time polymerase chain reaction diagnosis of citrus canker from field samples. Phytopathology. 2004;94:61–68. doi: 10.1094/PHYTO.2004.94.1.61. [DOI] [PubMed] [Google Scholar]
  • Munhoz et al. (2011).Munhoz CF, Weiss B, Hanai LR, Zucchi MI, Fungaro MHP, Oliveira AL, Monteiro-Vitorello CB, Vieira ML. Genetic diversity and a PCR-based method for Xanthomonas axonopodis detection in passion fruit. Phytopathology. 2011;101:416–424. doi: 10.1094/PHYTO-06-10-0169. [DOI] [PubMed] [Google Scholar]
  • Ngoc et al. (2009).Ngoc LBT, Vernière C, Jarne P, Brisse S, Guérin F, Boutry S, Gagnevin L, Pruvost O. From local surveys to global surveillance: three high-throughput genotyping methods for epidemiological monitoring of Xanthomonas citri pv. citri pathotypes. Applied and Environmental Microbiology. 2009;75:1173–1184. doi: 10.1128/AEM.02245-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Park et al. (2006).Park DS, Hyun JW, Park YJ, Kim JS, Kang HW, Hahn JH, Go SJ. Sensitive and specific detection of Xanthomonas axonopodis pv. citri by PCR using pathovar specific primers based on hrpW gene sequences. Microbiological Research. 2006;161:145–149. doi: 10.1016/j.micres.2005.07.005. [DOI] [PubMed] [Google Scholar]
  • Phillippy et al. (2009).Phillippy AM, Ayanbule K, Edwards NJ, Salzberg SL. Insignia: a DNA signature search web server for diagnostic assay development. Nucleic Acids Research. 2009;37:W229–W234. doi: 10.1093/nar/gkp286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Pruvost et al. (2002).Pruvost O, Boher B, Brocherieux C, Nicole M, Chiroleu F. Survival of Xanthomonas axonopodis pv. citri in leaf lesions under tropical environmental conditions and simulated splash dispersal of inoculum. Phytopathology. 2002;92:336–346. doi: 10.1094/PHYTO.2002.92.4.336. [DOI] [PubMed] [Google Scholar]
  • Ranjbar et al. (2014).Ranjbar R, Naghoni A, Farshad S, Lashini H, Najafi A, Sadeghifard N, Mammina C. Use of TaqMan® real-time PCR for rapid detection of Salmonella enterica serovar typhi. Acta Microbiologica et Immunologica Hungarica. 2014;61:121–130. doi: 10.1556/AMicr.61.2014.2.3. [DOI] [PubMed] [Google Scholar]
  • Rigano et al. (2010).Rigano LA, Marano MR, Castagnaro AP, Do Amaral A, Vojnov AA. Rapid and sensitive detection of citrus bacterial canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiology. 2010;10:176. doi: 10.1186/1471-2180-10-176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ryan et al. (2011).Ryan RP, Vorhölter FJ, Potnis N, Jones JB, Van Sluys MA, Bogdanove AJ, Dow JM. Pathogenomics of Xanthomonas: understanding bacterium-plant interactions. Nature Reviews Microbiology. 2011;9:344–355. doi: 10.1038/nrmicro2558. [DOI] [PubMed] [Google Scholar]
  • San Millán et al. (2013).San Millán RM, Martínez-Ballesteros I, Rementeria A, Garaizar J, Bikandi J. Online exercise for the design and simulation of PCR and PCR-RFLP experiments. BMC Research Notes. 2013;6:2–5. doi: 10.1186/1756-0500-6-513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Schaad et al. (2005).Schaad NW, Postnikova E, Lacy GH, Sechler A, Agarkova I, Stromberg PE, Stromberg VK, Vidaver AK. Reclassification of Xanthomonas campestris pv. citri (ex Hasse 1915) Dye 1978 forms A, B/C/D, and E as X. smithii subsp. citri (ex Hasse) sp. nov. nom. rev. comb. nov., X. fuscans subsp. aurantifolii (ex Gabriel 1989) sp. nov. nom. rev. comb. nov., and X. alfalfae subsp. citrumelo (ex Riker and Jones) Gabriel et al., 1989 sp. nov. nom. rev. comb. nov.; X. campestris pv. malvacearum (ex smith 1901) Dye 1978 as X. smithii subsp. smithii nov. comb. nov. nom. nov.; X. campestris pv. alfalfae (ex Riker and Jones, 1935) dye 1978 as X. alfalfae subsp. alfalfae (ex Riker et al., 1935) sp. nov. nom. rev.; and var. fuscans of X. campestris pv. phaseoli (ex Smith, 1987) Dye 1978 as X. fuscans subsp. fuscans sp. nov. Systematic and Applied Microbiology. 2005;28:494–518. doi: 10.1016/j.syapm.2005.03.017. [DOI] [PubMed] [Google Scholar]
  • Schaad et al. (2006).Schaad NW, Postnikova E, Lacy G, Sechler A, Agarkova I, Stromberg PE, Stromberg VK, Vidaver AK. Emended classification of xanthomonad pathogens on citrus. Systematic and Applied Microbiology. 2006;29:690–695. doi: 10.1016/j.syapm.2006.08.001. [DOI] [PubMed] [Google Scholar]
  • Schoulties et al. (1987).Schoulties CL, Civerolo EL, Miller JW, Stall RE, Krass CJ, Poe SR, DuCharme EP. Citrus canker in Florida. Plant Disease. 1987;71:388–395. doi: 10.1094/PD-71-0388. [DOI] [Google Scholar]
  • Schubert et al. (2001).Schubert TS, Gottwald TR, a RizviS, Graham JH, Sun X, Dixon WN. Meeting the challenge of eradicating citrus canker in Florida—again. Plant Disease. 2001;85:340–356. doi: 10.1094/PDIS.2001.85.4.340. [DOI] [PubMed] [Google Scholar]
  • Simpson et al. (2000).Simpson AJ, Reinach FC, Arruda P, Abreu FA, Acencio M, Alvarenga R, Alves LM, Araya JE, Baia GS, Baptista CS, Barros MH, Bonaccorsi ED, Bordin S, Bove JM, Briones MR, Bueno MR, Camargo AA, Camargo LE, Carraro DM, Carrer H, Colauto NB, Colombo C, Costa FF, Costa MC, Costa-Neto CM, Coutinho LL, Cristofani M, Dias-Neto E, Docena C, El-Dorry H, Facincani AP, Ferreira AJ, Ferreira VC, Ferro JA, Fraga JS, França SC, Franco MC, Frohme M, Furlan LR, Garnier M, Goldman GH, Goldman MH, Gomes SL, Gruber A, Ho PL, Hoheisel JD, Junqueira ML, Kemper EL, Kitajima JP, Krieger JE, Kuramae EE, Laigret F, Lambais MR, Leite LC, Lemos EG, Lemos MV, Lopes SA, Lopes CR, Machado JA, Machado MA, Madeira AM, Madeira HM, Marino CL, Marques MV, Martins EA, Martins EM, Matsukuma AY, Menck CF, Miracca EC, Miyaki CY, Monteriro-Vitorello CB, Moon DH, Nagai MA, Nascimento AL, Netto LE, Nhani A, Nobrega FG, Nunes LR, Oliveira MA, Oliveira MC, Oliveira RC, Palmieri DA, Paris A, Peixoto BR, Pereira GA, Pereira HA, Pesquero JB, Quaggio RB, Roberto PG, Rodrigues V, Rosa AJM, Rosa VE, Sá RG, Santelli RV, Sawasaki HE, Silva AC, Silva AM, Silva FR, Silva WA, Silveira JF, Silvestri ML, Siqueira WJ, Souza AA, Souza AP, Terenzi MF, Truffi D, Tsai SM, Tsuhako MH, Vallada H, Van Sluys MA, Verjovski-Almeida S, Vettore AL, Zago MA, Zatz M, Meidanis J, Setubal JC. The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa consortium of the organization for nucleotide sequencing and analysis. Nature. 2000;406:151–159. doi: 10.1038/35018003. [DOI] [PubMed] [Google Scholar]
  • Sun et al. (2004).Sun X, Stall RE, Jones JB, Cubero J, Gottwald TR, Graham JH, Dixon WN, Schubert TS, Chaloux PH, Stromberg VK, Lacy GH, Sutton BD. Detection and characterization of a new strain of citrus canker bacteria from key/mexican lime and alemow in South Florida. Plant Disease. 2004;88:1179–1188. doi: 10.1094/PDIS.2004.88.11.1179. [DOI] [PubMed] [Google Scholar]
  • Trindade et al. (2007).Trindade LC, Marques E, Lopes DB, Ferreira MASV. Development of a molecular method for detection and identification of Xanthomonas campestris pv. viticola. Summa Phytopathologica. 2007;33:16–23. doi: 10.1590/S0100-54052007000100002. [DOI] [Google Scholar]
  • Vauterin et al. (1995).Vauterin L, Hoste B, Kersters K, Swings J. Reclassification of Xanthomonas. International Journal of Systematic Bacteriology. 1995;45:472–489. doi: 10.1099/00207713-45-3-472. [DOI] [Google Scholar]
  • Vauterin et al. (1990).Vauterin L, Swings J, Kersters K, Gillis M, Mew TW, Schroth MN, Palleroni NJ, Hilderbrand DC, Stead DE, Civerolo EL, Hayward AC, Maraite H, Stall RE, Vidaver AK, Bradbury JF. Towards an improved taxonomy of Xanthomonas. International Journal of Systematic Bacteriology. 1990;40:312–316. doi: 10.1099/00207713-40-3-312. [DOI] [Google Scholar]
  • Vernière et al. (1998).Vernière C, Hartung JS, Pruvost OP, Civerolo EL, Alvarez AM, Maestri P, Luisetti J. Characterization of phenotypically distinct strains of Xanthomonas axonopodis pv. citri from Southwest Asia. European Journal of Plant Pathology. 1998;104:477–487. doi: 10.1023/A:1008676508688. [DOI] [Google Scholar]
  • Waite et al. (2016).Waite DW, Griffin R, Taylor R, George S. Rapid and accurate identification of Xanthomonas citri subspecies citri by fluorescence in situ hybridization. Letters in Applied Microbiology. 2016;63:315–321. doi: 10.1111/lam.12624. [DOI] [PubMed] [Google Scholar]
  • Yan & Wang (2011).Yan Q, Wang N. The colR/colS two-component system plays multiple roles in the pathogenicity of the citrus canker pathogen Xanthomonas citri subsp. citri. Journal of Bacteriology. 2011;193:1590–1599. doi: 10.1128/JB.01415-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yano et al. (1979).Yano T, Castro AFP, Lauritis JA, Namekata T. Serological differentiation of bacteria belonging to the Xanthomonas campestris group by indirect hemagglutination test. Annals of the Phytopathological Society of Japan. 1979;45:1–8. doi: 10.3186/jjphytopath.45.1. [DOI] [Google Scholar]
  • Ye et al. (2012).Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T. Primer-BLAST: a tool to design target-specific primers for polymerse chain reaction. BMC Bioinformatics. 2012;13(1):11. doi: 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zhao et al. (2016).Zhao Y, Xia Q, Yin Y, Wang Z. Comparison of droplet digital PCR and quantitative PCR assays for quantitative detection of Xanthomonas citri subsp. citri. PLOS ONE. 2016;11:1–18. doi: 10.1371/journal.pone.0159004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zhou et al. (2017).Zhou X, Zhang T, Song D, Huang T, Peng Q, Chen Y, Li A, Zhang F, Wu Q, Ye Y, Tang Y. Comparison and evaluation of conventional RT-PCR, SYBR green I and TaqMan real-time RT-PCR assays for the detection of porcine epidemic diarrhea virus. Molecular and Cellular Probes. 2017;33:36–41. doi: 10.1016/j.mcp.2017.02.002. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The following information was supplied regarding data availability:

The sequences are available on NCBI: NC_003919.1 (XccA306), CP011250.1 (XauB1561), CP011160.1 (XauC1559), and GCF_005059785.1 (Xacm1510).


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES