MDM2 inhibitor RG7388 potently inhibits tumors by activating p53 pathway in nasopharyngeal carcinoma

ABSTRACT

Nasopharyngeal carcinoma (NPC) is a high-risk head and neck cancer with poor clinical outcomes and insufficient treatments. The mouse double minute 2 homolog (MDM2) is the main molecular target in the clinical treatment of cancer. Indeed, MDM2 negatively regulates p53 through ubiquitin-dependent degradation. Thus, inhibition of MDM2–p53 interaction is a potential strategy for treating NPC. The latest generation MDM2 inhibitor, RG7388, shows increased potency and improved bioavailability compared to previous treatments. In this study, we investigated the efficacy and specificity of this inhibitor in NPC cell lines, and tumor-bearing mice were used to examine the therapeutic efficacy and effects of RG7388 treatment. The results showed that RG7388 potently decreased cell proliferation and activated p53-dependent pathway, resulting in cell cycle arrest and apoptosis. RG7388 significantly inhibited tumors in tumor-bearing mice. Activation of the p53 pathway-inhibited cell proliferation, as observed by detecting Ki67-positive cells. Additionally, the activity of apoptotic caspase family proteins was induced in the cleaved caspase-3-positive cells in vivo. Our results demonstrate that the MDM2 small-molecule inhibitor RG7388 is effective for NPC tumors, supporting further clinical investigation as a potential therapy for NPC.

Introduction

Nasopharyngeal carcinoma (NPC) is a high-risk head and neck cancer with poor clinical outcomes and insufficient treatments in Southeast Asia and China.¹ NPC is closely associated with a variety of causes, such as Epstein Barr virus, environmental factors, and genetic predisposition.² In clinical practice, early-stage or locally advanced patients with NPC show improved overall survival following radiotherapy and/or chemotherapy, with 5-year overall survival rates of 60–70%.³ In fact, the recurrence, distant metastases, drug resistance, and adverse effects of treatments remain as major challenges in the clinic.⁴ In the last decade, various strategies have been developed to treat recurrent, metastatic, and resistant patients with NPC, including molecularly targeted therapies such as vascular endothelial growth factor (VEGF) and epidermal growth factor receptor (EGFR) inhibitors or antibodies.^5,6 However, these proteins represent possible targets in a small number of patients with NPC. Therefore, it is necessary to investigate the efficacy of new agents against other candidate proteins in NPC.

The murine double minute type 2 protein (MDM2) was first discovered in mouse 3T3 cells by screening of a cDNA library.⁷ The human MDM2 gene is encoded by an oncogene located on the acentromeric extra chromosomal nuclear bodies of chromosome 12q14.3-q15 and functional characterization revealed that MDM2 regulates protein accumulation and activity at the transcriptional level, translation level, and post-translation level.⁸ MDM2 is the main negative regulator of tumor suppressor p53. p53 inhibits MDM2 by binding to the N-terminal activation domain, and in turn, MDM2 regulates p53 through ubiquitin-mediated protein degradation.^9,10 In human cancers, studies have shown that MDM2 was frequently altered, and over-expressed by gene amplification in breast cancer, sarcomas, melanoma, and ovarian.^11–13 In head and neck cancer, there is a significant association of MDM2-positive status of head and neck cancer patients, including the NPC patients.¹² Thus, MDM2 is a potential therapeutic strategy for patients with NPC.

p53 is a well-known tumor suppressor gene defined as “guardian of the genome” or “coordinator of the underlying processes of the hallmarks of cancer”.¹⁴ It plays an important role in protecting against cancer development. The p53 protein is a multifunctional transcription factor that can be activated by several stress signals and which is able to prevent the accumulation of genetic damage by regulating DNA repair, the cell cycle, and apoptosis.¹⁵ In humans, the protein is inactivated in approximately 50% of human cancers by mutation or deletion, it remains wild-type in the remaining cases but its function is impaired by other mechanisms.¹⁶ However, in NPC, the mutation frequency of the p53 gene is less than 10%, and nearly 100% of the NPC cell lines contain wide-type-p53 protein.^17,18 Multiple molecules have been developed to reactive p53 via regulation of MDM2 to restore its anticancer activity.¹⁹

Given the tight link between MDM2 and p53, inhibition of the MDM2–p53 interaction is a potential strategy for treating NPC. The first selective and effective MDM2 inhibitors were reported by Vassilev and colleagues in 2004 and were defined as nutlins.¹⁸ In initial clinical and preclinical evaluations, the group of small-molecule MDM2 inhibitors showed powerful antitumor efficacy through p53 pathways both in vitro and in vivo in different types of tumor models.^20,21 However, during the clinical testing, there were tolerability challenges during prolonged daily oral administration of the first-generation MDM2 inhibitor. The pyrrolidine RG7388, the latest generation MDM2 inhibitor, uses the same mechanism of action as the first-generation inhibitors, with more potent p53 to MDM2 inhibition and bioavailability.²² Herein, we examined the effect of RG7388 on rescuing p53 and activating the downstream apoptotic pathway in NPC cell lines in vitro. Moreover, we demonstrated the effects of RG7388 on tumor growth using an orthotopical xenograft mouse model of NPC. Results of this study will contribute toward developing a promising treatment strategy for NPC.

Results

RG7388 inhibits cell proliferation in NPC cells

RG7388 is a second-generation MDM2 small-molecule inhibitor, with more potent and greater biological effects than the first-generation inhibitors.²² Thus, we choose RG7388 as the candidate drug for the subsequent experiments to evaluate the role of MDM2-p53 signaling in NPC. We analyzed the expression of MDM2 in NPC in Oncomine database. As showed in Supplement Figure 1a, MDM2 levels were significantly higher in NPC tissues than in normal tissues.²³ Then, we test the expression of MDM2 in the normal nasopharyngeal epithelial cell lines NP69 and nasopharyngeal carcinoma cell lines 6-10B, 5-8F. The data of Figure 1a,b showed that the expression of MDM2 was significantly higher in NPC cells than NP69. Meanwhile, we used the breast cancer cells including p53 wild-type cells MCF-7 and p53 mutant MDA-MB-231 cells as controls. As shown Supplement Figure 1b–e, the CCK8 assay results revealed that MCF-7 cells were more sensitive to RG7388, with an IC₅₀ of 3 μM, than were MDA-MB-231cells with an IC₅₀ of 10 μM.

Figure 1.

MDM2 inhibitor RG7388 reduces NPC cell proliferation. (a) The protein level expression of MDM2 was detected by WB in NP69 and NPC cells. (b) The RNA level expression of MDM2 was detected by Q-PCR in NP69 and NPC cells. (c) 5-8f cell proliferation was measured by CCK8 test after treatment with different concentrations of RG7388. (d) 6-10B cell proliferation was measured by CCK8 test after treatment with different concentrations of RG7388. (e) OD450 absorbance of 5-8F for 24 h after treatment with different concentrations of RG7388. (f) OD450 absorbance of 6-10B for 24 h after RG7388 treatment.

To evaluate the activity of RG7388 in NPC cells, we applied the concentration of RG7388 leading to 50% growth inhibition. The results showed that 5-8F NPC cells were the most significantly sensitive to RG7388 compared to other NPC cell lines. As shown in Figure 1c–f, the IC₅₀ of RG7388 was about 2 μM for 24 h treatment, which is more effective than in MDA-MB-231 cells even when used at 10 μM. The high efficacy against NPC lines indicated that RG7388 is a suitable candidate for treating NPC. Thus, we choose the NPC cell lines most and least sensitive to RG7388 (5-8F and 6-10B) for subsequent analysis. To mimic the apoptosis that occurs pathologically, we use RG7388 at doses of 0, 1, 2 and 3 μM in subsequent experiments.

RG7388 induces cell cycle resting and apoptosis in two NPC cells lines

To investigate the effect of RG7388 in NPC cells apoptosis and the cell cycle, we treated the cells with different doses of RG7388 (0, 1, 2 and 3 μM) for 24 h. As shown in Figure 2a, Flow cytometry assay revealed that apoptosis increased from 1.2% to 59% and from 1.1% to 25% in a dose-dependent manner of RG7388 in 5-8F and 6-10B cells, respectively. Additionally, cell cycle analysis (Figure 2b–c) showed that RG7388 treatment caused dose-dependent cell cycle arrest in the G0/G1 and S phases, with accumulation of cells in the G0/G1 phases increased from approximately 50% to 79% and 61% to 77%, respectively, whereas the population of cells in S-phase decreased from approximately 35% to 15% and 22% to 13%, respectively. These data suggest that RG7388 induced apoptosis by promoting cell cycle arrest and inhibiting entry into S phase.

Figure 2.

RG7388 affects apoptosis and cell cycle distribution. NPC cell lines 5-8F and 6-10B were treated for 24 h with different concentrations of RG7388. (a) The apoptosis of 5-8F and 6-10B were measured by flow cytometry after RG7388 (0, 1, 2, and 3 μM) treatment. RG7388 led to increased apoptosis with increasing concentrations for 24 h compared to dimethyl sulfoxide (DMSO). (b), (c)The cell cycle of 5-8F and 6-10B were measured by flow cytometry after RG7388 (0, 1, 2, and 3 μM) treatment. RG7388 led to an increased proportion of cells in G0/G1 phase with increasing concentrations for 24 h compared to Dimethylsulfoxide (DMSO).

RG7388 induces cell cycle arrest and apoptosis by activating the p53 pathway

Subsequently, we examined the mechanism by which RG7388 induced NPC cell cycle arrest and apoptosis. Western blotting and quantitative polymerase chain reaction (Q-PCR) were conducted to determine the protein and RNA levels of MDM2-p53 and related molecules in 5-8F and 6-10B cells following treatment with increasing concentrations of RG7388 (0, 1, 2 and 3 μM). As shown in Figure 3a–d, RG7388 significantly enhanced the protein and mRNA levels: p53, and p21, which are known transcriptional p53 cell cycle targets.²⁴ Apoptosis related caspase family proteins, such as cleaved caspase-3, were also up-regulated by RG7388.

Figure 3.

RG7388 up-regulates protein and mRNA expression of the MDM2-p53 pathway. (a),(b) MDM2 inhibitor RG7388 leads to increased p53 protein expression, a compensatory increase in MDM2 expression, and p53-mediated apoptosis with an increase in p21 and cleaved caspase-3 according to western blot analysis in 5-8F (up) and 6-10B (down). (c),(d) Q-PCR analysis to examine the mRNA expression of p53 transcription targets genes, such as p21 and caspase family proteins in 5-8F (up) and 6-10B (down).

To further investigate the function of p53 in the RG7388-treatment NPC cells, we knocked down the expression of p53 by transient transfection with siRNA-control and p53-siRNA in 5-8F and 6-10B cells. Then, the cells were detected by western blotting, Q-PCR, and flow cytometer. As shown in Figure 4a–d, the protein and mRNA levels of p53 were significantly decreased by transient transfection with p53-siRNA. Meanwhile, Figure 4e–f shown the cell apoptosis rates were also significantly decreased by transient transfection with p53-siRNA, compared to the siRNA-control group. These results indicated that p53 pathway was activated by the RG7388-induced apoptosis in NPC cells.

Figure 4.

RG7388 affects the apoptotic of 5-8F and 6-10B by activation of p53 pathway. (a), (b) Western blot analysis was used to detect the interfering effects of p53-siRNA in 5-8F (up) and 6-10B cells (down). (c),(d) Q-PCR was used to detect the interfering effects of p53-siRNA in 5-8F (up) and 6-10B cells (down). (e), (f) Flow analysis was used to detect the rate of apoptosis in 5-8F (up) and 6-10B (down) cells after transfecting with p53-siRNA combined with RG7388 (0, 1, 2 and 3 μM) treatment.

RG7388 inhibition NPC tumor growth in xenograft mouse model

To determine the pharmacodynamic effects of RG7388 in vivo, we performed xenograft studies in nude mice with 5-8F cells. To mimic the solid tumor environment, the mice were treated at 9 days after tumor transplantation. Twelve mice were divided into two groups: RG7388 group and control group. In the RG7388 group, the mice were orally administered RG7388 (25 mg/kg) by gavage every other day, while the vehicle was used in the control group.²² The tumor volumes were measured by vernier caliper every other day, and final tumor weights were measured at the time of sacrifice. As shown in Figure 5a,b, the group treated with RG7388 for 12 days showed significantly suppressed tumor growth from 0.17 to 1.88 cm³, whereas the group treated with vehicle grew from 0.16 to 1.28 cm³. The tumor weights in the RG7388 group were approximately 40% less than those in the vehicle group.

Figure 5.

RG7388 inhibits NPC growth and progression. (a) Effect of RG7388 treatment on tumor growth of 5-8F in nude mice at 25 mg/kg (n = 6). (b) Final tumor weights at time of sacrifice compared to control tumors. (c) HE staining detection of nuclear fission in tumors. (d) Representative histologic sections of xenografts from 5-8F tumors were immunostained with Ki-67, and the percentage of positive Ki-67 cells was quantified by six tumors in each group and three slides for each tumor. (e) Representative histologic sections of xenografts from 5-8F tumors were immunostained with cleaved caspase-3, and the percentage of positive cleaved caspase-3 cells was quantified by six tumors in each group and three slides for each tumor.

The HE staining of tumor tissue sections was revealed a clear difference of proliferating tumor cells in vivo. The data (Figure 5c) showed that the number of nuclear fission tumor cells in RG7388 group was decreased significantly than the control group. We next examined the ability of RG7388 to induce cellular arrest or apoptosis. The levels of the cell proliferation marker Ki-67 and apoptotic marker cleaved caspase-3 were measured in 5-8F tumors after dosing with a single 25 mg/kg dose and compared to the results following vehicle treatment alone. The results (Figure 5d,e) revealed significantly reduced numbers of Ki-67⁺-positive tumor cells and cleaved caspase-3⁺- stained cells were significantly increased in RG7388-treated tumors compareing in the controls.

RG7388 inhibition NPC tumor growth by activation of p53 pathway

We next focused on intermediate signaling molecules involved in the mediation of tumor growth. Western blotting and Q-PCR were conducted to evaluate the protein and RNA level of MDM2-p53 pathway molecules in xenografted 5-8F tumors after RG7388 treatment. As shown in Figure 6a,b, RG7388 significantly enhanced the protein and mRNA levels of MDM2, p53, p53(p-S15), p21, and cleaved caspase-3, compared to the control group.

Figure 6.

Antitumor activity of RG7388 in xenografted mice through the MDM2-p53 pathway. (a) Western blot analysis to examine the protein expression of p53, p53(p-S15), p21, and cleaved caspase 3 in xenografts from 5-8F tumors. (b) Q-PCR analysis to examine the mRNA expression of p53 transcription targets genes, such as p53 and p21 in xenografts from 5-8F tumors. (c) Schematic model. RG7388 inhibits the interaction between MDM2 and p53, which in turn activates p53-pathway, with an increase of p21 protein which mediates cell cycle arrest and caspase family proteins such as caspase 3, eventually leading to anti-tumor effects in NPC.

Discussion

The oncogene MDM2, which is the major negative regulator of p53, is overexpressed in neuroblastoma and other malignant solid tumors.^9,25 In NPC, we found that MDM2 expression in tumors was higher than normal nasopharynx tissues based on oncomine data. Meanwhile, the similar results were also observed in vitro cell experiment. This suggests that the MDM2–p53 interaction can be blocked with small molecules. The first generations of small-molecular MDM2 inhibitors, defined as nutlins, were reported by Vassiev et al., but these molecules showed poor bioavailability because of the large and hydrophobic protein–protein interaction interface of MDM2¹⁸. However, the second generations of optimizing MDM2 inhibitor, defined as RG7388, were designed by Novo et al., with bioavailability, potential pharmacokinetics.²² RG7388 with a novel core scaffold I has a different stereochemical configuration of pyrrolidine and has highly potent pyrrolidine compound. The efficacy of RG7388 was evaluated by several preclinical studies supporting its progression into clinical development in various cancers including ovarian cancer, osteosarcoma, and hepatocellular carcinoma.^12,26,27 In this study, to our knowlege given the MDM2 status in NPC cells, we first evaluated the efficacy of RG7388 in a panel of NPC cells and xenograft mouse tumor model. We expected that the growth inhibition and cytotoxic effects of RG7388 would be dependent on the MDM2 status. Indeed, the results showed that RG7388 potently and selectively inhibited the growth of NPC cells.

Inhibition of the MDM2–p53 interaction and p53 accumulation results in up-regulation of downstream transcriptional targets such as p21 or caspase family proteins as well as induces cell cycle arrest and apoptosis in multiple tumor cells.^27,28 Our results showed that 5-8F and 6-10B undergo cell cycle block at the G0/G1 phase after RG7388 treatment in a dose-dependent manner. Then, the rates of apoptosis of 5-8F and 6-10B cells were detected by transient p53-siRNA combined with flow assay, and the results showed that the p53 pathway was activated in RG7388-induced apoptosis. The mechanism of p53 regulation involves up-regulation of cell cycle gene p21 and apoptotic marker cleaved caspase-3. Additionally, we demonstrated the in vivo efficacy of RG7388 in NPC xenograft models. The results showed that oral administration of RG7388 in 5-8F bearing mice significantly inhibited tumor growth. The antitumor effects resulted from decreased cell proliferation by reducing Ki67⁺-positive proliferative cells and up-regulating the cell cycle gene p21 and apoptotic marker cleaved caspase-3 in treated tumor sections compared to in the vehicle group. Therefore, RG7388 may also induce caspase family protein-dependent mechanisms of cell death.

In conclusion, we demonstrated that blocking the MDM2–p53 interaction using the small-molecule MDM2 inhibitor RG7388 reactivated p53 in NPC cells, resulting in a strong cell cycle arrest and apoptotic effects. Treatment of mice bearing NPC tumors with RG7388 led to significant inhibition of tumor growth by activating the p53 pathway. These results support that a single oral dose of RG7388 is highly effective for treating NPC tumors. These results are consistent with those of previous studies of RG7388 in other tumor models and support the use of RG7388 for NPC tumors.²⁹

Materials and methods

Cell lines and reagents

The human normal nasopharyngeal epithelial cell line NP69 was granted from the professor Tsao of The University of Hong Kong. The cells were cultured in Keratinocyte-SFM (KSFM) supplemented with EGF1-53 and Bovine Pituitary Extract. The human NPC cell lines 5-8F, 6-10B were provided by Professor Li of the Second People’s Hospital of Shenzhen. The cells were grown in RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin solution at 37°C in a humidified incubator with 5% CO₂. Reagents were sourced commercially as follows: antibodies against p53, phospho-p53(p-S15), MDM2, p21, and p53 siRNA kit were purchased form Protein-tech, while cleaved-caspase3 and GAPDH were purchased from Cell Signaling Technology. CCK8 was purchased from Life Technologies. RG7388 was purchased from MCE.

Cell RNA interferences experiment

For siRNA experiments, 6-10B and 5-8F cells were transfected by using p53 siRNA kit. Briefly, 2 × 10⁵ cells were seeded in a 6-well plate and cultured. 200 μl opti-MEM plus 5 μl transfection reagent and incubated for 10 min at RT, then added in a six-well plate and cultured about 4 h, then changed by a complete medium. For an effective effect of p53 knockdown, the concentration of siRNA was 100 nM.

Animal experiments

Six-week-old female nude mice were purchased from the mode animal research center of Guangdong, China and housed under pathogen-free conditions. The experimental procedures were approved by the Animal Ethics Committee at the Second People’s Hospital of Shenzhen. For the animal model, 5-8F cells were harvested, rinsed twice with ice-cold phosphate-buffered saline (PBS), and then resuspended in normal saline to obtain cell suspensions with a concentration of 2 × 10⁶/mL in 200 µL of ice-cold PBS, which were injected in each mouse to establish xenograft tumors. The mice were randomized into groups of six mice each with similar mean tumor volumes after 9 days. RG7388 was administered by oral gavage at nontoxic doses 25 mg/kg every other day and the tumor size was measured. The tumor volume was calculated using the following formula (length × width²)×0.52. Mice were sacrificed at on day 21. At the time of sacrifice, tumors were weighed, and tumor tissues were frozen for western blot or Q-PCR analyses and fixed in 4% paraformaldehyde (PFA) for routine histopathologic processing.

Cell proliferation assay

The growth and viability of 5-8F and 6-10B cells treated with RG7388 were evaluated in 96-well plates. Briefly, 4000 cells per well were seeded into the 96-well plates in normal medium and incubated at 37°C overnight. On the next day, the media were replaced with 100 µL of fresh media, and then untreated or treated with RG7388 (0-10 μM). Following 24 h incubation, 10 µL of CCK8 reagent was added to each well, and the plate was further incubated for 2–4 h in the dark at 37°C. Optical density was determined using a 96-well plate reader at an absorbance of 450 nm and the data were analyzed with Prism 7 software (GraphPad, Inc., La Jolla, CA, USA).

Western blotting

Protein was extracted from the cells or tumor tissues with 1 × EBC buffer (150 mM Tris-HCl, 500 mM NaCl, 1% TritonX-100) containing protease inhibitors (Roche Diagnostics, Basel, Switzerland). After centrifugation at 12,000 rpm for 30 min at 4°C, equal amounts of total protein were resolved by 10% SDS-PAGE, followed by transfer onto 0.2-μm polyvinylidene fluoride membranes. The membranes were blocked with 5% skim milk in TBST for 1 h and then probed with primary antibodies diluted in 5% milk in TBST overnight at 4°C. The membranes were washed three times with TBST and then incubated with secondary antibodies at room temperature for 1 h. Specific protein bands were then visualized by chemiluminescence using ECL kit and detected with an AI600 Imager (GE Healthcare, Little Chalfont, UK).

Q-PCR analysis

Total RNA was extracted from the indicated cell lines or mouse tumor tissues using an RNA isolation kit according to the manufacturer’s instructions and cDNA was synthesized using a first strand synthesis system (Roche) with SYBR and the following primer pairs:

human-MDM2 Forward: GAATCATCGGACTCAGGTACATC;

human-MDM2 Reverse: TCTGTCTCACTAATTGCTCTCCT;

mouse-MDM2 Forward: TGTCTGTGTCTACCGAGGGTG;

mouse-MDM2 Reverse: TCCAACGGACTTTAACAACTTCA;

human-p53 Forward: GAGGTTGGCTCTGACTGTACC

human-p53 Reverse: TCCGTCCCAGTAGATTACCAC;

mouse-p53 Forward: GCGTAAACGCTTCGAGATGTT

mouse-p53 Reverse: TTTTTATGGCGGGAAGTAGACTG;

human-p21 Forward: TGTCCGTCAGAACCCATGC;

human-p21 Reverse: AAAGTCGAAGTTCCATCGCTC;

mouse-p21 Forward: CCTGGTGATGTCCGACCTG;

mouse-p21 Reverse: CCATGAGCGCATCGCAATC;

human-GAPDH Forward: GGAGCGAGATCCCTCCAAAAT;

human-GAPDH Reverse: GGCTGTTGTCATACTTCTCATGG;

mouse-GAPDH Forward: AGGTCGGTGTGAACGGATTTG;

mouse-GAPDH Reverse: TGTAGACCATGTAGTTGAGGTCA.

Cell cycle and apoptosis analysis

Cell cycle and apoptosis were evaluated in 5-8F and 6-10B cells. The cell cycle was analyzed using the propidium iodide (PI) assay, and apoptosis was evaluated using the Annexin V-FITC and PI assay. The cells were resuspended at 6 × 10⁵ cells/mL, and seeded into six-well cell culture plates and treated with RG7388 (0, 1, 2, 3 μM) for 24 h. Next, 5-8F and 6-10B cells were harvested, centrifuged, and washed twice with PBS. The collected cells were stained with Annexin V-FITC and/or PI as per the manufacturer’s protocol. Annexin V-FITC and PI binding were analyzed by flow cytometry on Beckman Cell Quest (Brea, CA, USA) in total population (1 × 10⁴ cells), and the data were analyzed with Flow Jo software (Ashland, OR, USA).

Immunohistochemical analysis

For immunohistochemical analysis, tumor tissue blocks were cut into 5-μm-thick sections, deparaffinized in xylene, and rehydrated in a graded alcohol series. The sections were permeabilized in 0.5% Triton-X/PBS and boiled in 10 mM sodium citrate for 10 min in a pressure cooker for antigen retrieval. Samples were blocked in blocking buffer. Primary antibodies were diluted in blocking buffer as follows: Ki67 and cleaved caspase-3 antibodies were used at 1:200 dilution at 4°C overnight. Next, the slides were washed 3 times with PBS and incubated with fluorescent-labeled secondary antibodies including: Alexa Fluor-labeled-555 goat anti-rat antibody and Alexa Fluor-labeled 488 donkey anti-rabbit antibody at 1:500 dilution. The sections were mounted with DAPI and images were captured fluorescence microscope.

Statistical analysis

GraphpadPrism 7.0 was used for the statistical analyses. Values represent the mean ± SD for the three separate experiments. The significance of differences between experimental variables was determined using the Student’s t-test. Values were considered statistically significant at P< .05.

Funding Statement

This work was supported by the China Postdoctoral Science Foundation under Grant [number 2018M633229]; Natural Science Foundation of Guangdong Province under Grant [number 2018A0303130295, 2018A030310665]; Shenzhen Science and Technology Innovation Committee under Grant [number JCYJ20170302165727389, JCYJ20170306091452714, JCYJ20170413162242627, JCYJ20170306091657539, GJHZ20170313172439851, ZDSYS201707281114196].

Disclosure of potential conflicts of interest

The authors do not have any conflicts of interest to disclose.

Supplementary material

Supplemental data for this article can be accessed on the publisher’s website.