The α Subunit of G_q Contributes to Muscarinic Inhibition of the M-Type Potassium Current in Sympathetic Neurons

Abstract

Rat superior cervical ganglion (SCG) neurons express low-threshold noninactivating M-type potassium channels (I_K(M)), which can be inhibited by activation of M1 muscarinic receptors. This inhibition occurs via pertussis toxin-insensitive G-proteins belonging to the Gα_q family (Caulfield et al., 1994). We have used DNA plasmids encoding antisense sequences against the 3′ untranslated regions of Gα subunits (antisense plasmids) to investigate the specific G-protein subunits involved in muscarinic inhibition of I_K(M). These antisense plasmids specifically reduced levels of the target G-protein 48 hr after intranuclear injection. In cells depleted of Gα_q, muscarinic inhibition of I_K(M) was attenuated compared both with uninjected neurons and with neurons injected with an inappropriate Gα_oAantisense plasmid. In contrast, depletion of Gα₁₁ protein did not alter I_K(M) inhibition. To determine whether the α or βγ subunits of the G-protein mediated this inhibition, we have overexpressed the C terminus of β adrenergic receptor kinase 1 (βARK1), which binds free βγ subunits. βARK1 did not reduce muscarinic inhibition of I_K(M) at a concentration of plasmid that can reduce βγ-mediated inhibition of calcium current (Delmas et al., 1998a). Also, expression of β₁γ₂ dimers did not alter the I_K(M) density in SCG neurons. In contrast, I_K(M) was virtually abolished in cells expressing GTPase-deficient, constitutively active forms of Gα_q and Gα₁₁. These data suggest that Gα_q is the principal mediator of muscarinic I_K(M) inhibition in rat SCG neurons and that this more likely results from an effect of the α subunit than the βγ subunits of the G_qheterotrimer.

The M-type potassium current (I_K(M)) is a noninactivating, voltage-gated potassium current found in various peripheral and central neurons, including rat superior cervical ganglion (SCG) neurons, and in some cell lines (for review, see Brown, 1988). It is activated in the subthreshold voltage range for action potentials and increases with membrane depolarization. Thus, cells remain clamped around rest, display spike adaptation, and have limited excitability. Inhibition of I_K(M) results in depolarization with increased action potential discharge (Brown and Selyanko, 1985) and provides a switch between phasic and tonic firing properties (Wang and McKinnon, 1995). I_K(M) in rat SCG neurons can be inhibited after activation of various receptors, including M₁ muscarinic receptors [M₁ mAChR (Marrion et al., 1989; Bernheim et al., 1992)] and bradykinin B₂ receptors (Jones et al., 1995), coupled through Bordetella pertussis toxin-insensitive GTP-binding proteins (G-proteins) (Brown et al., 1989; Caulfield et al., 1994;Jones et al., 1995).

Using antibodies raised against the C-terminal domain of different Gα subunits, we have previously obtained evidence to suggest that the G-protein α subunits involved in M₁ mAChR-mediated inhibition of I_K(M) in rat SCG neurons include Gα_q or Gα₁₁ or both (Caulfield et al., 1994). However, the antibodies that were used could not distinguish between G_q and G₁₁ because they have identical C-terminal sequences (Strathmann and Simon, 1990). Because the C terminus is thought to be a locus of G-protein GDP-bound α subunit/receptor and GTP-bound α subunit/phospholipase C-β1 (PLC-β1) interactions (Conklin and Bourne, 1993; Conklin et al., 1993; Arkinstall et al., 1995), Gα_q and Gα₁₁ can couple to the same receptors (Aragay et al., 1992; Wu et al., 1992b; Nakamura et al., 1995; Dippel et al., 1996), and the cloned subunits stimulate the different PLC-β isoforms to a similar degree (Taylor et al., 1991; Hepler et al., 1993; Jhon et al., 1993). However, they are not invariably equivalent, because in rat portal vein myocytes, Gα_q and Gα₁₁ elevate intracellular calcium levels after α₁-adrenoceptor activation by coupling to very different mechanisms (Macrez-Leprêtre et al., 1997).

In the present experiments, we have therefore tried to find out whether either or both of these two G-proteins (G_q and G₁₁) were involved in muscarinic inhibition of I_K(M) in rat SCG neurons by using Gα antisense-generating plasmids to deplete cells of specific subunits. We have also sought evidence to determine whether the α subunit or the βγ dimer of the activated dissociated heterotrimer acted as the primary intermediary (Wickman and Clapham, 1995; Clapham and Neer, 1997) by selectively overexpressing βγ subunits or GTPase-deficient forms of the α subunits and by testing whether a βγ-sequestering agent [C-terminal peptide of β adrenergic receptor kinase 1 (βARK1)] modified the effect of mAChR stimulation.

Our results suggest that Gα_q, but not Gα₁₁, couples the M1 mAChR to I_K(M)inhibition in SCG neurons and that α, rather than βγ, subunits are the mediators of this response.

MATERIALS AND METHODS

Cell culture. Sympathetic neurons were isolated from SCG of 15- to 19-d-old Sprague Dawley rats and cultured using standard procedures as described previously (Delmas et al., 1998a).

DNA plasmids. The constructs used in this study were made by PCR-cloning using standard molecular techniques (Abogadie et al., 1997). These were designed antisense to sequences in the 3′ untranslated (3′UT) regions of the rat target genes and subcloned into pCR3 or pCR3.1 (Invitrogen, San Diego, CA) unless stated otherwise. The cloned 3′UT sequences share no significant homology with any other rat G-protein α subunits. The nucleotide sequences reported in this paper have been submitted to the GenBank/EMBL Data Bank with accession numbers Y17161, Y17162, Y17163, and Y17164. The clones are as follows, in 5′ to 3′ orientation [nucleotide (nt); coding region (CR); numbers indicate position relative to stop or start codon]: Gα_oA(clone 207–8) 3′UT nt 2–169: CTCTTGTCCTGTATAGCAACCTATTTGACTGCTTCATGGACTCTTTGCTGTTGATGTTGATCTCCTGGTAGCATGACCTTTGGCCTTTGTAAGACACACAGCCTTTCTGTACCAAGCCCCTGTCTAACCTACGACCCCAGAGTGACTGACGGCTGTGTATTTCTGTA; Gα_{q/11 common} (clone 107–6 in pBK-CMV, Stratagene, La Jolla, CA) CR nt 484–741: ATGACTTGGACCGTGTAGCCGACCCTTCCTATCTGCCTACACAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATTGAGTACCCCTTCGACTTACAGAGTGTCATCTTCAGAATGGTCGATGTAGGAGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAACGTCACCTCGATCATGTTTCTGGTAGCGCTTAGCGAATACGATCAAGTTCTTGTGGAGTCAGACAATGAGAACCGCA; Gα₁₁ antisense clones: 243–7, 3′UT nt 4–104; C97–4, 3′UT nt 82–123. Gα_q antisense clones: C23–24, 3′UT nt 6–289; C6–6, 3′UT nt 6–129; C23-D7, 3′UT nt 193–289; C23–16, 3′UT nt 29–129. Targeted sequences are shown in Figure1.

Fig. 1.

DNA Sequences of Gα_q and Gα₁₁ 3′ untranslated regions. Sequences of rat Gα_q and Gα₁₁ in the 3′ untranslated region immediately after the stop codon. Homology between the two proteins is very low in this region, with only 19% identity, although this rises to 31% when the two sequences are aligned for maximum homology. Theunderlined areas represent the sequences targeted by the Gα₁₁ antisense plasmids; the closed arrowheads correspond to clone 243–7 and the open arrowheads to clone C97–4.

The constitutively active, GTPase-deficient form of hamster Gα_q (Q209L) (Wu et al., 1992a) was subcloned into the pCMV5 vector, the GTPase-deficient Gα₁₁ (Q209L, also known as 11QL) (Wu et al., 1992a; from S. Offermanns) was provided in the pCIS vector, and the GTPase-deficient Gα_oA (Q205L) (Wong et al., 1992; from B. R. Conklin) was provided in the pCDNA1 vector. Bovine β₁ and γ₂ subunits were subcloned into pCDNA3 (Invitrogen). The C-terminal Gly495 to Leu689 of human βARK1 (also called GRK2) (Koch et al., 1994; from C. Scorer and C. Harris) was supplied in the vector pCIN1 engineered with newNotI and EcoRI sites. All plasmids were propagated in either XL-1 blue or DH5α Escherichia coliand purified using maxiprep columns (Qiagen, Hilden, Germany). All clones were verified by sequencing. RNA synthesis was driven by a strong viral promoter (cytomegalovirus) to ensure sustained high intracellular levels of transcripts after delivery of plasmids.

In situ hybridization. In situ hybridization was performed on 12 μm cryostat sections of 17-d-old rat SCGs using digoxigenin-labeled riboprobes, essentially as described previously (Schaeren-Wiemers and Gerfin-Moser, 1993). Sense and antisense cRNAs were transcribed from the same clones used in the electrophysiological experiments using SP6 and T7 polymerase according to standard protocols.

Microinjection. DNA plasmids were diluted to 400 μg/ml in calcium- and glucose-free Krebs’ solution (290 mOsm/l, pH 7.3) containing 0.5% FITC-dextran and pressure-injected into the nucleus of SCG neurons 2 d in culture, either as described previously (Abogadie et al., 1997) or with a microinjector (Eppendorf, Hamburg, Germany). Cells were maintained in culture for an additional 2 d, and a survival rate of 75–85% was obtained.

Electrophysiology. M-currents were measured from SCG neurons cultured for 4 d, using the amphotericin-B perforated-patch technique (Horn and Marty, 1988; Rae et al., 1991). Patch electrodes (2–4 MΩ) were filled by dipping the tip for 40 sec into a filtered internal solution containing (in mm): potassium acetate 80, KCl 30, HEPES 40, MgCl₂ 3 (adjusted to pH 7.3–7.4 with KOH and to 280 mOsm/l with potassium acetate). The pipette was then back-filled with the above solution containing 0.1 mg/ml amphotericin-B. High-resistance seals (>2 GΩ) were initially achieved, and after amphotericin-B permeabilization, access resistances were <25 MΩ. SCG neurons were perfused at 5–10 ml/min at 32°C with an external solution consisting of (in mm): NaCl 120, KCl 3, HEPES 5, NaHCO₃ 23, glucose 11, MgCl₂1.2, CaCl₂ 2.5, tetrodotoxin (TTX) 0.0005, pH 7.4. Cells were voltage-clamped at approximately −25 mV using either an Axopatch 200A amplifier (data sampling rate 4–10 kHz, filter 1 kHz) or a switching amplifier (Axoclamp-2A, switching frequencies 3–5 kHz, filter 0.1 kHz), both from Axon instruments (Foster City, CA). I_K(M) was measured as a slowly developing inward deactivation relaxation after a 1 sec jump to a command potential of approximately −55 mV (Caulfield et. al., 1994). Inhibition was measured as the fractional reduction in the amplitude of the I_K(M) deactivation relaxation in response to cumulative increases in concentrations of oxotremorine methiodide (Oxo-M) (Research Biochemicals International, Natick, MA) (see Fig. 4). Steady-state current–voltage relationships were obtained by applying slow (3.3 mV/sec) voltage ramps from −20 mV to −100 mV. For experiments with Bordetella pertussis toxin (PTX) (Speywood, Maidenhead, Berkshire, UK), SCG neurons were incubated with 1 μg/ml PTX in the culture medium for at least 24 hr before recording.

Fig. 4.

Time course of cumulative Oxo-M application; effect on I_K(M) amplitude. A, I_K(M) deactivation relaxation elicited by a −30 mV step for 1 sec from a holding potential of approximately −25 mV. Waveforms (average of 3 traces) are from cells injected with Gα₁₁(C97–4) or Gα_q (C23–16) antisense plasmids and whose time courses are shown in B. I_K(M)relaxations are shown in the absence and presence of 1 μmand 10 μm Oxo-M. Dotted lines represent 0 pA. B, Time course of normalized I_K(M)amplitude during application of increasing concentrations of Oxo-M, as indicated, for neurons injected with Gα_oA, Gα_q, and Gα₁₁ antisense plasmids. I_K(M) was recorded every 10 sec, and each Oxo-M concentration was applied for 1 min.

Data were collected and analyzed using PClamp6 software (Axon Instruments) and expressed as mean ± SEM. An estimate of the mean log IC₅₀ for each antisense plasmid treatment was obtained by fitting the data from each individual cell with a best-fit dose–response curve and determining the log IC₅₀ for each cell. I_K(M) deactivation relaxations were best-fit by a double exponential with fast (τ1) and slow (τ2) components. Statistics used the two-way ANOVA comparing plasmid treatments across four agonist concentrations for all antisense samples (including uninjected groups). If a significant effect of plasmid treatment was found overall, further analysis was performed using the two-way ANOVA to determine which treatments contributed to this significance. The constitutively active Gα_oA*, Gα_q*, Gα_11*, and β₁γ₂ expression data were analyzed with one-way ANOVA, as was the log IC₅₀ data, and if an overall significant effect of plasmid treatment was found, this was followed by Bonferroni’s multiple comparison test. p values < 0.05 were considered significant.

Immunocytochemistry. SCG cells, cultured and injected as described above, were fixed in acetone and stained for Gα_oA+B, Gα_q, Gα₁₁, and C terminus of βARK1 using selective antibodies and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indoxyl phosphate and nitro blue tetrazolium chloride (BCIP/NBT) (Dako, Carpinteria, CA), as described by Abogadie et al., (1997). The polyclonal antibodies anti-Gα_oA+B(sc-387), anti-Gα₁₁ (sc-394), and anti-βARK1 C terminus (sc-562) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and the anti-Gβ antibody (3B-200) was from Gramsch Laboratories (Schwabhausen, Germany). The specific polyclonal antibody anti-Gα_q (IQB2) was raised against a synthetic peptide fragment of Gα_q (Milligan et al., 1993). Specificity of the antibodies was determined by competing out the staining by preabsorbing the antibody with the relevant immunogenic peptide. All dishes of SCG neurons recorded in the electrophysiology experiments were subsequently fixed and stained. The BCIP/NBT purple/blue product was too dark to quantitate photometrically, so we assessed whether there was an overall qualitative reduction in staining by comparing each injected cell with its nearest uninjected neighbor and determining (by eye) whether the level of staining was equal to or less than that of the uninjected cell. Using this method we have therefore estimated the proportion of cells with a visible reduction in staining (regardless of the magnitude of this reduction) 48 hr after injection of the antisense plasmid.

RESULTS

Gα_q and Gα₁₁ expression in SCG neurons

Both in situ hybridization and RT-PCR clearly showed the presence of Gα_q and Gα₁₁ mRNAs in rat SCG tissue where they were expressed mainly in neurons (Fig.2). The specificity of the hybridization probes was confirmed when no signal was seen after competition with unlabeled probes (data not shown) or after use of sense, rather than antisense, probes (Fig. 2). Staining with specific antibodies against Gα_q and Gα₁₁ demonstrated the presence of Gα_q and Gα₁₁ protein in most cultured SCG neurons (see below). We have constructed plasmids encoding for RNA antisense (antisense plasmids) directed against the 3′ untranslated region of these G-proteins to specifically deplete cells of each of the α-subunits. Gα_q and Gα₁₁ share 81% homology in coding region sequence (based on mouse sequence), and this drops to a maximum of 31% (when rat sequences are aligned for maximum homology) in the first 200 bases of the 3′ untranslated region in rat (Fig. 1).

Fig. 2.

In situ hybridization and RT-PCR demonstrate the presence of Gα_q and Gα₁₁mRNA in rat SCG. In situ hybridization (ISH) and RT-PCR demonstrate the presence of Gα_q and Gα₁₁ in rat SCG. ISH of Gα_q (B) and Gα₁₁ (C) shows neuronal staining. Gα_oA ISH (A) was used as a positive control. All probes used were against the 3′ untranslated region (3′ UTR) of the gene. The black arrows indicate representative individual SCG neurons expressing the relevant mRNA.D, RT-PCR using rat SCG DNA as a template.m, Marker lane; o, Gα_o with primers 266s/849a; q, Gα_q with primers Gα_q u6s/u111a, where “u” denotes sequence in the 3′ UTR; 11, Gα₁₁ with primers Gα₁₁ 488s/u103a; bp, base pair.

Direct intranuclear injection of SCG neurons with various antisense plasmids (Gα_q, Gα₁₁, and Gα_oA) resulted in a marked reduction in the respective Gα subunit staining 48–72 hr later (Fig.3). This protein depletion was specific, with Gα_oA antisense not altering Gα_q or Gα₁₁ staining, Gα_{q/11 common} antisense not touching Gα_oA+B staining, Gα_q not altering Gα_oA+B or Gα₁₁ staining, and Gα₁₁ antisense leaving Gα_oA+B and Gα_q staining intact. The two Gα₁₁ antisense plasmids, however, were not equally effective. Thus, clone C97–4 reduced visible Gα₁₁ protein staining in 9 of 19 cells (47%; n = 7 dishes of cells) (see Materials and Methods) (Fig. 3C), whereas 243–7 reduced Gα₁₁ staining in only 18 of 63 cells (29%;n = 17 dishes). Similarly, the specific Gα_q antisense plasmids were not all effective. C6–6 and C23–24 reduced staining in 23 of 71 cells (32%; n = 8 dishes) and 8 of 32 cells (25%; n = 6 dishes), respectively (Fig. 3B), whereas C23-D7 and C23–16 were more effective, reducing staining in 31 of 65 cells (48%; n= 10 dishes) and 55 of 109 cells (50%; n = 21 dishes), respectively (Fig. 3B). The antisense plasmids were maximally effective in reducing Gα subunit staining 2 d after injection, and their effects on I_K(M) modulation were therefore assessed 2 d after injection.

Fig. 3.

Reduction of G-protein α subunit staining in cells expressing antisense. Complementary fluorescence and Gα immunostaining photographs of cells intranuclearly injected with antisense plasmids and a fluorescent marker. A, Cells immunostained with Gα_oA+B antibody and injected with (i) Gα_oA antisense plasmid and (ii) Gα_q antisense plasmid (clone C23-D7).B, Cells immunostained with Gα_q antibody and neurons injected with (i) Gα_qantisense plasmid (C23-D7), (ii) Gα_oAantisense plasmid, (iii) Gα_q antisense plasmid (C23–24), and (iv) Gα₁₁ antisense plasmid (C97–4). C, Cells immunostained with Gα₁₁ antibody and neurons injected with (i) Gα₁₁ antisense plasmid (C97–4) and (ii) Gα_q antisense plasmid (C23-D7).

Effect of antisense plasmids on I_K(M) modulation by a muscarinic agonist

Injection of DNA plasmids encoding antisense to Gα_oAslightly reduced inhibition of I_K(M) by the muscarinic agonist Oxo-M. Thus, the inhibition of I_K(M) by 300 nm Oxo-M was 24.6 ± 5.0% (n = 6) in Gα_oA antisense-treated cells compared with 34.2 ± 2.6% (n = 7) in uninjected cells (p = 0.007 across all Oxo-M concentrations) (see Fig. 5B). To investigate further this effect of Gα_oA antisense, we pretreated several dishes of SCG neurons with 1 μg/ml PTX, which ADP-ribosylates and inactivates members of the Gα_o/i G-protein family. There was no significant difference in Oxo-M inhibition of I_K(M) between the treated and untreated cells (see Fig. 5D), confirming previous findings with other mAChR agonists (Brown et al., 1989). A comparable treatment strongly attenuated the G_o-mediated inhibition of the Ca²⁺ current by noradrenaline (Caulfield et al., 1994) and Oxo-M (Delmas et al., 1998b). Furthermore, overexpression of a constitutively active, GTPase-deficient form of Gα_oA (Wong et al., 1992) did not alter I_K(M)density (see Fig. 8 and below). It seems unlikely, therefore, that the Gα_oA antisense-induced reduction in I_K(M)inhibition results directly from the loss of Gα_oA or that Gα_oA participates in I_K(M) inhibition, a conclusion supported by previous studies using specific antibodies (Caulfield et al., 1994). This reduction is also unlikely to be caused by the plasmid injection per se, because cells injected with antisense constructs that were ineffective in reducing protein had no effect on the Oxo-M dose–response curves (see Fig. 5B,C and below). Hence, we do not yet understand why the Gα_oA antisense plasmid reduced I_K(M) inhibition. Nevertheless, because the most suitable control group for comparison with the Gα_qand Gα₁₁ antisense plasmids is the expression of an inappropriate antisense, we have taken the effect of the Gα_oA antisense as our baseline for assessing the effect of the Gα_q and Gα₁₁ antisense plasmids, because at the very least this would mitigate against any “nonspecific” effects of antisense plasmid injection. Thus, allp values quoted are compared against Gα_oAantisense-expressing neurons unless stated otherwise (in practice, the same outcome of the experiments below would be obtained if the comparison were with uninjected cells).

Fig. 5.

Dose–response curves for Oxo-M inhibition of I_K(M) in antisense plasmid-injected SCG neurons.A, Schematic diagram demonstrating length [in base pairs (bp)] and relative positions of the four antisense sequences targeted at the 3′ untranslated region of rat Gα_q. Only C23-D7 and C23–16 consistently reduced Gα_q protein levels in immunocytochemical staining with a Gα_qantibody. B, Dose–response curves (mean ± SEM, plus best-fit curve) for uninjected neurons compared with Gα_oA antisense, Gα₁₁ antisense, and Gα_q/11 antisense plasmid-injected cells. The dose–response curve for Gα_oA (n = 6) antisense is significantly different from the uninjected dose–response curve (n = 6; p = 0.007) but not the Gα₁₁ antisense plasmid curve (n = 9). The dose–response curve for cells injected with the Gα_{q/11 common} antisense plasmid (n = 6) is significantly different from those of cells injected with Gα_oA and Gα₁₁ antisense plasmids (p = 0.005 andp < 0.0001, respectively). C, Oxo-M dose–response curves for neurons injected with Gα₁₁ antisense plasmid and four different antisense plasmids against Gα_q. The dose–response curves for C6–6 (n = 8) and C23–24 (n = 5) are not significantly different from the dose–response curves for Gα_oA antisense-expressing (B) or Gα₁₁ antisense-expressing neurons. C23-D7 (n = 6) and C23–16 (n = 9) dose–response curves are both significantly different from Gα_oA antisense-expressing neurons (p = 0.004 and p= 0.001, respectively) and from Gα₁₁ antisense-expressing neurons (p < 0.0001 andp < 0.0001, respectively). D, Oxo-M inhibition of I_K(M) is not altered by pretreatment with 1 μg/ml PTX (n = 6; n = 4 for untreated neurons).

Fig. 8.

Expression of GTPase-deficient forms of Gα_q and Gα₁₁ tonically inhibits I_K(M), whereas β₁γ₂dimers have no effect. A, Representative waveforms from cells in C. Neurons expressing constitutively active Gα_q* or Gα_11* have very little holding current at −20 mV and no I_K(M) deactivation relaxation in response to a −30 mV voltage step (bottom trace). I_K(M) is normal in cells expressing β₁γ₂ dimers compared with injected neurons (e.g., Gα_oA antisense-expressing cells). Waveforms are the average of three traces, and the dotted linerepresents 0 pA. B, Current–voltage curves in response to a voltage ramp from −20 to −100 mV at 3.3 mV/sec (displayed ininsert) in Gα_oA antisense-expressing cells and neurons expressing Gα_q* or Gα_11*.I–V plot is in reverse direction from the ramp applied, and the dotted line represents 0 pA. These traces have not been leak-subtracted; leak current in the Gα_q* and Gα_11* cells is less than in the Gα_oA antisense-expressing neurons. C, Scatter-plot of I_K(M) densities in Gα_oAantisense-expressing cells and cells expressing Gα_oA*, Gα_q*, Gα_11*, and β₁γ₂dimers. Horizontal lines represent means of each group. Gα_q* (n = 13) and Gα_11*(n = 8) are significantly different from Gα_oA antisense-expressing neurons (n= 7) (p < 0.001 and p< 0.001, respectively), Gα_oA*-expressing neurons (n = 6) (p < 0.001 andp < 0.001, respectively), and β₁γ₂ dimer-expressing neurons (n = 6) (p < 0.01 andp < 0.01, respectively).

Injection of SCG neurons with the Gα_{q/11 common} antisense plasmid significantly reduced Oxo-M inhibition of I_K(M)when compared with Gα_oA antisense-expressing cells (Gα_oA antisense: 24.6 ± 5.0% inhibition with 300 nm Oxo-M, n = 6; Gα_q/11antisense: 13.9 ± 2.2%, n = 6; p= 0.005 across all Oxo-M concentrations) (see Fig. 5B). This confirms previous observations, using functionally inactivating antibodies, that either Gα_q or Gα₁₁ or both mediate muscarinic inhibition of I_K(M) (Caulfield et al., 1994). To determine which (or whether both) of these G-protein α subunits is responsible for mediating this response, cells were injected with antisense plasmids that specifically reduced Gα_q and Gα₁₁ levels (see above). Four plasmids encoding different Gα_q antisense sequences were investigated (see Fig. 5A). Of these, two significantly reduced muscarinic inhibition of I_K(M) (C23-D7 and C23–16) (percentage inhibition with 300 nm Oxo-M: C23-D7: 15.5 ± 4.7%, n = 6, p = 0.004 compared with Gα_oA dose–response curve; C23–16: 15.7 ± 3.7%, n = 9, p = 0.001) (Figs.4,5C). This is in agreement with the immunocytochemical data where the clones C23-D7 and C23–16 selectively reduced immunocytochemical staining of Gα_q. The other two clones, C6–6 and C23–24, however, were less effective at reducing either Gα_q staining or muscarinic inhibition of I_K(M) (percentage inhibition of I_K(M) with 300 nm Oxo-M: C6–6: 24.3 ± 5.0%, n= 8; C23–24: 24.3 ± 3.0%, n = 5) (Fig.5C). The attenuation of I_K(M) inhibition by the Gα_q antisense plasmids C23-D7 and C23–16 was reflected in an increase in the log IC₅₀ for these groups. Although the log IC₅₀ values for neurons injected with C6–6 (−6.14 ± 0.09; n = 8) and C23–24 (−6.07 ± 0.11; n = 5) were close to that for uninjected neurons (−6.31 ± 0.06; n = 6), those for SCG neurons injected with the Gα_q antisense plasmids C23-D7 (−5.64 ± 0.23; n = 6) and C23–16 (−5.16 ± 0.37; n = 7; p < 0.05 compared with Gα₁₁ antisense-expressing neurons) were greater (Fig.6). Gα_q depletion did not significantly change the maximum response or Hill slope. In contrast with the Gα_q antisense plasmids, I_K(M)inhibition in cells depleted of Gα₁₁ with C97–4 antisense plasmid (29.7 ± 4.1% inhibition at 300 nmOxo-M; log IC₅₀ = −6.13 ± 0.09; n = 9) was no different from that seen in Gα_oAantisense-expressing neurons (Figs. 4, 5B, 6). In agreement with the time course of Gα subunit depletion, the reduction of Oxo-M inhibition was maximal at 48 hr for the concentration of the plasmid injected (400 μg/ml), because no further reduction was seen 72 hr after injection [e.g., at 72 hr, 300 nm Oxo-M produced 17.4 ± 2.7% (n = 9) inhibition of I_K(M) in Gα_q antisense (C23–16)-expressing cells)]. The resting membrane potential was not altered in neurons injected with the Gα_q or Gα₁₁ antisenses compared with Gα_oA antisense constructs (e.g., Gα_oA antisense: −63.5 ± 2.6 mV, n= 6; Gα_q antisense, C23-D7: −63.8 ± 1.1 mV,n = 5; Gα₁₁ antisense, C97–4: −62.0 ± 4.0 mV, n = 4).

Fig. 6.

Gα_q antisense plasmids increase the log IC₅₀ for Oxo-M inhibition of I_K(M). Scatter-plot is shown of the log IC₅₀for each neuron included in the mean dose–response curves in Figure 5. Log IC₅₀ was calculated from the best-fit curve for Oxo-M inhibition of I_K(M) for every neuron recorded with the injected antisense sequences indicated. Horizontal linesrepresent the mean of each group. The Gα_q antisense plasmid C23–16 significantly increased the log IC₅₀compared with uninjected neurons (p < 0.01), Gα₁₁ antisense plasmid injected cells (p < 0.05), and cells injected with the Gα_q antisense plasmid C6–6 (p< 0.05).

Expression of the C-terminal βARK1 peptide in SCG neurons

The above results suggest that Gα_q is primarily responsible for M1 mAChR-induced inhibition of I_K(M), but they do not indicate which subunit(s) of the heterotrimer mediates the inhibition. To determine the role of endogenous Gα_q-linked βγ dimers, we overexpressed the C-terminal domain of βARK1, which has been shown to sequester free βγ subunits (Koch et al., 1994). Expression of the peptide was routinely detected 24–48 hr after injection as a strong increase in βARK1 peptide immunoreactivity. Injection of the βARK1 construct at 200 μg/ml, a concentration that has been found to be effective at attenuating noradrenergic inhibition of the calcium current (Delmas et al., 1998a), a presumed βγ-mediated pathway (Herlitze et al., 1996;Ikeda, 1996), did not alter inhibition of I_K(M) (300 nm Oxo-M produced 21.8 ± 3.2% inhibition in βARK1-expressing cells; n = 8) (Fig.7). Increasing the plasmid concentration to 400 μg/ml, however, resulted in a reduction of M1 mAChR inhibition of I_K(M) (300 nm Oxo-M resulted in 17.7 ± 2.4% inhibition, n = 7, p = 0.0002, compared with Gα_oA antisense plasmid cells, across all concentrations of Oxo-M) (Fig. 7). This effect was not a result of a use-dependent sequestration of βγ subunits by βARK1 peptide, because repetitive application of 1 μm Oxo-M did not result in an accumulated loss of inhibition in neurons injected with 400 μg/ml βARK1-encoding plasmid (first application, 40.5 ± 4.0% inhibition; fourth application, 37.7 ± 4.1%;n = 3). Furthermore, neither I_K(M) current density (Gα_oA antisense: 2.8 ± 0.4 pA/pF,n = 7; 400 μg/ml βARK1: 4.7 ± 1.1 pA/pF,n = 7) nor I_K(M) deactivation relaxation (Gα_oA antisense: τ₁ 40.3 ± 2.3 msec, τ₂ 263 ± 21 msec, n = 9; 400 μg/ml βARK1: τ₁ 37.2 ± 2.2 msec, τ₂ 248 ± 30 msec, n = 10) was significantly altered by the βARK1-encoding plasmid.

Fig. 7.

βARK1-injected cells show some attenuation of I_K(M) inhibition by Oxo-M. Dose–response curves for Oxo-M inhibition of I_K(M) in cells injected with either Gα_oA antisense plasmid (n = 6) or C-terminal βARK1 plasmid at 200 μg/ml (n = 8) or 400 μg/ml (n = 7) are shown. Only the βARK1 400 μg/ml dose–response curve is significantly different from the Gα_oA antisense dose–response curve (p = 0.0002).

Expression of GTPase-deficient forms of Gα_q and Gα₁₁ subunits, but not β₁γ₂dimers, inhibits I_K(M)

The above experiments with βARK1 peptide expression suggest that α, rather than βγ, subunits mediate M1 mAChR inhibition of I_K(M). To test this further, we overexpressed GTPase-deficient, constitutively active forms of Gα_oA(Gα_oA*, Q205L), Gα_q(Gα_q*, Q209L), Gα₁₁(Gα_11*, Q209L), and β₁γ₂ dimers. Overexpression of Gα_q* and Gα_11* resulted in a dramatic decrease in I_K(M) current density 24–48 hr after injection, compared with cells injected with Gα_oAantisense plasmid or Gα_oA* (Fig.8A,C) (Gα_oA antisense: 2.8 ± 0.4 pA/pF, n = 7; Gα_oA*: 4.0 ± 0.6 pA/pF, n = 6; Gα_q*: 0.2 ± 0.02 pA/pF, n = 13,p < 0.001, compared with either Gα_oAantisense or Gα_oA*; Gα_11*: 0.1 ± 0.02 pA/pF, n = 8, p < 0.001, compared with either Gα_oA antisense or Gα_oA*). This loss of I_K(M) was also clear in the steady-state current–voltage relationships by the absence of outward rectification positive to −60 mV in Gα_q*- and Gα_11*-expressing cells (Fig. 8B). Consistent with the suppression of I_K(M), the resting membrane potential of these cells was more depolarized than in cells injected with Gα_oA antisense and Gα_oA* plasmids (Gα_oA antisense: −63.5 ± 2.6 mV, n = 6; Gα_oA*: −62.7 ± 0.7 mV, n = 6; Gα_q*: −48.4 ± 1.7 mV, n = 13, p < 0.001, compared with either Gα_oA antisense or Gα_oA*; Gα_11*: −50.3 ± 2.7 mV, n = 8,p < 0.01, compared with Gα_oA antisense or Gα_oA*). In contrast, overexpression of free βγ subunits, by coexpressing β₁ and γ₂subunits, had no significant effect on either I_K(M) current density (2.03 ± 0.4 pA/pF, n = 6;p > 0.05 compared with Gα_oA antisense) (Fig. 8C) or resting membrane potential (−59.2 ± 1.8,n = 6; p > 0.05, compared with Gα_oA antisense).

DISCUSSION

Our data clearly demonstrate that direct intranuclear injection of antisense-generating plasmids is an effective method for reducing levels of G-protein subunits in neurons (Fig. 3). These antisense sequences, designed against the 3′ UTR for increased specificity, are thought to bind to their target regions and destabilize the whole mRNA (Phillips and Gyurko, 1997), resulting in a reduced level of expression of the target protein. It is interesting to note that not all Gα 3′ UTR antisense sequences were effective in reducing protein expression. Of four Gα_q antisense sequences tested, only two were effective (C23-D7 and C23–16). Similarly, of two Gα₁₁antisense sequences tested, only one (C97–4) consistently reduced Gα₁₁ protein levels. This difference in effectiveness of the antisense sequences could perhaps arise from some unknown secondary structure in the target mRNA transcript (Phillips and Gyurko, 1997). Such structures may determine how accessible the target region is for binding by antisense transcripts. The two less effective Gα_q antisenses include a short region between nt 6 and 28 in the 3′ UTR not covered by the other antisense sequences (Fig. 5). It is therefore tempting to speculate that this particular region or sequence might not be amenable to antisense action.

Using these specific antisense plasmids, we have shown that depletion of Gα_q, but not Gα₁₁, subunits significantly reduced muscarinic inhibition of I_K(M) (Figs. 4, 5). Indeed, although both in situ hybridization and immunocytochemical experiments clearly demonstrated the presence of Gα₁₁ in SCG neurons (Figs.2, 3), muscarinic inhibition of I_K(M) was not altered in cells specifically depleted of Gα₁₁ by the antisense plasmid (Figs. 3-6). This suggests that Gα_q rather than Gα₁₁ preferentially mediates M1 mAChR inhibition of I_K(M). This idea is supported by the finding that the common Gα_q/11 antisense plasmid produced no greater reduction in I_K(M) inhibition than the specific Gα_q antisense plasmids. Although Gα_qantisense plasmids clearly shifted the dose–response curve for Oxo-M inhibition of I_K(M), they did not completely prevent inhibition by this mAChR agonist. This partly results from the variable response between neurons expressing the Gα_q antisense: some cells display very little inhibition when Oxo-M is applied, whereas others resemble uninjected neurons and robust inhibitions are observed (Fig. 6). This finding mirrors the results obtained when antibodies directed against Gα_q/11 were directly injected into SCG neurons. In these neurons there was an overall reduction in mean inhibition but a wide range of responses, from no reduction to total suppression in individual cells (Caulfield et al., 1994; Brown et al., 1995). The variability seen with the Gα_q antisense plasmids may most reasonably be attributed to a variable reduction in endogenous Gα_q protein. Although the participation of additional G-proteins cannot be totally excluded, this seems less likely because one would then have to postulate that the component of inhibition mediated by G_q varied greatly from one cell to another in an apparently arbitrary manner. Certainly, if another G-protein is involved, it must be insensitive to PTX (Fig.5D), and it cannot be G₁₁ because (1) Gα₁₁ antisense plasmids were unable to alter I_K(M) inhibition and (2) the Gα_{q/11 common}antisense had no more effect than the specific Gα_qantisense plasmids (Figs. 5B,C, 6).

The inequality between Gα_q and Gα₁₁function in these cells is somewhat surprising, because the bulk of evidence implies that Gα_q and Gα₁₁ are indistinguishable in both receptor-coupling and effector-coupling preference. These studies have been based mainly on purified protein in cell-free systems (Taylor et al., 1991) or cloned wild-type and constitutively active proteins expressed in cell lines (Aragay et al., 1992; Wu et al., 1992a,b; Hepler et al., 1993). Studies using antisense oligonucleotides, however, have implicated (1) both Gα_qand Gα₁₁ in M1 mAChR activation of PLC-β in RBL-2H3 cells (Dippel et al., 1996) but( 2) neuromedin B receptor activation of PLC occurring via Gα_q, and not Gα₁₁, in Xenopus oocytes (Shapira et al., 1994). Furthermore, in both rat myocytes and Xenopusoocytes, endogenous Gα_q and Gα₁₁ appear to have distinctly different functions after thyrotropin-releasing hormone or α₁-adrenergic receptor activation (Lipinsky et al., 1992; Macrez-Leprêtre et al., 1997). These studies, and our results, suggest that the coupling preferences suggested by in vitro and overexpression studies may not reflect those found in native cells.

The lack of involvement of Gα₁₁ in mediating I_K(M) inhibition does not seem to arise from an inability of the subunit to couple to appropriate effector systems, because both Gα_11* and Gα_q* virtually abolished I_K(M). It is more likely, therefore, that the M1 muscarinic receptor preferentially links to Gα_q, rather than Gα₁₁, in these neurons. Because studies with recombinant Gα_q and Gα₁₁ have demonstrated that both of these subunits are capable of coupling to M1 receptors (Nakamura et al., 1995), differential receptor coupling might arise from a greater abundance of Gα_q relative to Gα₁₁. Lower levels of Gα₁₁, relative to Gα_q, have been observed in most cell lines (Milligan et al., 1993) and all regions of brain examined (Milligan, 1993), and Western blots from whole ganglia indicate that these proteins may not be equally expressed in SCG (Caulfield et al., 1994). Alternatively, differences in membrane compartmentalization of Gα_q and Gα₁₁ could result in differential access to the receptor, as has been suggested for Gα_i and Gα_o (Neubig, 1994; Gudermann et al., 1996). Membrane association of Gα_q and Gα₁₁ is primarily determined by their N-terminal regions where the palmitoylation sites and the regions essential for βγ subunit interaction are situated (Conklin and Bourne, 1993; Milligan et al., 1995; Hepler et al., 1996). Because this region also contains the greatest amino acid diversity between Gα_q and Gα₁₁ (Strathmann and Simon, 1990), it is possible that they may differ in their membrane association or distribution. Recent work by Umemori et al. (1997)indicates that Gα_q and Gα₁₁ can undergo phosphorylation by tyrosine kinase after M1 mAChR activation and that this is required for activation of the subunits and leads to disassociation of the receptor–G-protein complex. A final possibility, therefore, could be that the phosphorylation states of Gα_q and Gα₁₁ in SCGs may differ, thereby altering their ability to interact with the receptor. Nevertheless, the effectiveness with which the GTPase-resistant Gα₁₁inhibits I_K(M) leaves open the possibility that Gα₁₁ may mediate PTX-insensitive inhibition of I_K(M) via other receptors such as angiotensin II (Shapiro et al., 1994) or bradykinin (the effect of which is also inhibited by the Gα_q/11 antibody) (Jones et al., 1995).

The strong suppression of I_K(M) after overexpression of GTPase-resistant α_q (and α₁₁), but not α_oA, suggests that inhibition might well be mediated by dissociated GTP-bound α_q subunits but does not, of itself, exclude the possibility that βγ subunits released from the endogenous αβγ heterotrimer might be the physiological mediator of inhibition. However, this possibility seems unlikely for two reasons. First, co-overexpression of β₁ with γ₂ subunits did not significantly reduce I_K(M) (Fig. 8). In parallel experiments, this procedure effectively inhibited the N-type voltage-gated Ca²⁺current in these neurons (Delmas et al., 1998a), an inhibitory process considered from previous work to be driven by free βγ subunits (Ikeda, 1996; Herlitze et al., 1996). Second, muscarinic inhibition of I_K(M) was unaffected in neurons injected with 200 μg/ml of a construct expressing the C-terminal sequence of βARK1 (also known as GRK2), which binds and sequesters free βγ subunits (Koch et al., 1994) (Fig. 7). Again, in parallel experiments, this concentration of the βARK1 construct reduced I_Cainhibition by noradrenaline and Oxo-M (Delmas et al., 1998a,b). Although increasing the plasmid concentration (to 400 μg/ml) did attenuate I_K(M), this might be a nonspecific effect. We cannot exclude the possibility that the βγ dimer associated with Gα_q might have a low affinity for the βARK1 βγ-binding domain [for instance, β₃ subunits cannot interact with βARK1 (Daaka et al., 1997)]. However, Gα_q and Gα₁₁ can form heterotrimers with β₁γ₂ dimers (Nakamura et al., 1995), and βARK1 abolishes muscarinic-activated calcium release inXenopus oocytes, a response involving both Gα_qand Gα₁₁ (Stehno-Bittel et al., 1995).

Hence, and in conclusion, our results suggest that the pathway involved in muscarinic inhibition of I_K(M) in rat SCG neurons requires Gα_q but not Gα₁₁ and that it is the α subunit of the heterotrimer G_q, rather than the βγ dimer, that acts as the primary transducer. To this extent, they also provide further evidence that coupling between receptors and G-proteins in neurons is highly specific and more subtle than experiments with reconstituted subunits might indicate.