Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | per01 | other | FLYB:FBal0013649 | Obtained from Jaga Giebultowicz |
| Genetic reagent (D. melanogaster) | UAS-sgRNA-acp98AB4x | this paper | Available upon request, will be deposited at BDSC | |
| Genetic reagent (D. melanogaster) | UAS-sgRNA-per4x | this paper | Available upon request, will be deposited at BDSC | |
| Genetic reagent (D. melanogaster) | UAS-sgRNA-tim3x | this paper | Available upon request, will be deposited at BDSC | |
| Genetic reagent (D. melanogaster) | UAS-Cas9.2 | Bloomington Drosophila Stock Center | BDSC:58986 FLYB:FBti0166500 | |
| Genetic reagent (D. melanogaster) | UAS-myr-GFP | Bloomington Drosophila Stock Center | BDSC:32198 FLYB:FBti0131964 | |
| Genetic reagent (D. melanogaster) | UAS-myr-GFP | Bloomington Drosophila Stock Center | BDSC:32197 FLYB:FBti0131941 | |
| Genetic reagent (D. melanogaster) | tim-Gal4 | Bloomington Drosophila Stock Center | BDSC:7126 FLYB:FBti0017922 | |
| Genetic reagent (D. melanogaster) | repo-Gal4 | Bloomington Drosophila Stock Center | BDSC:7415 FLYB:FBti0018692 | |
| Genetic reagent (D. melanogaster) | Mai179-Gal4 | other | FLYB:FBti0017959 | Obtained from Charlotte Helfrich-Förster |
| Genetic reagent (D. melanogaster) | Pdf-Gal4 | Bloomington Drosophila Stock Center | BDSC:6900 | |
| Genetic reagent (D. melanogaster) | Pdf-Gal80 | other | FLYB:FBtp0019042 | Obtained from Michael Rosbash |
| Recombinant DNA reagent | pCFD6 | Addgene | Cat#73915 | |
| Software, algorithm | Clocklab | Actimetrics | ||
| Software, algorithm | FIJI | PMID: 22743772 | Open source program | |
| Software, algorithm | Prism 8 | GraphPad | ||
| Antibody | Polyclonal Chicken anti-GFP | Abcam | Cat#ab13970 | (1:1000) |
| Antibody | Polyclonal Rabbit anti-Per | PMID: 1613555 | (1:1000) Obtained from Michael Rosbash |
|
| Antibody | Polyclonal Rat anti-Tim | PMID: 8625406 | (1:1000) Obtained from Amtia Sehgal and Michael Young |
|
| Antibody | Polyclonal Chicken anti-RFP | Rockland Immunochemicals | Cat#600-901-379 | (1:200) |
| Antibody | Monoclonal Mouse anti-PDF | Developmental Studies Hybridoma Bank PMID: 15930393 | Cat#PDF C7 | (1:10) |
| Antibody | Monoclonal Mouse anti-Repo | Developmental Studies Hybridoma Bank PMID: 12167411 | Cat#8D12 anti-Repo | (1:20) |
| Antibody | AlexaFluor 488-conjugated Donkey anti-Chicken | Jackson Immunoresearch | Cat#703-545-155 | (1:200) |
| Antibody | AlexaFluor 594-conjugated Donkey anti-Rabbit | Jackson Immunoresearch | Cat#711-585-152 | (1:200) |
| Antibody | AlexaFluor 647-conjugated Donkey anti-Rat | Jackson Immunoresearch | Cat#712-605-153 | (1:200) |
| Antibody | Cy3-conjugated Donkey anti-Chicken | Jackson Immunoresearch | Cat#703-165-155 | (1:200) |
| Antibody | AlexaFluor 647-conjugated Donkey anti-Mouse | Jackson Immunoresearch | Cat#715-605-151 | (1:200) |
| Sequence-based reagent | clock-fwd | This paper | qPCR primer GGATAAGTCCACGGTCCTGA | |
| Sequence-based reagent | clock-rev | This paper | qPCR primer CTCCAGCATGAGGTGAGTGT | |
| Sequence-based reagent | period-fwd | This paper | qPCR primer CGAGTCCACGGAGTCCACACACAACA | |
| Sequence-based reagent | period-rev | This paper | qPCR primer AGGGTCTGCGCCTGCCC | |
| Sequence-based reagent | timeless-fwd | This paper | qPCR primer CCGTGGACGTGATGTACCGCAC | |
| Sequence-based reagent | timeless-rev | This paper | qPCR primer CGCAATGGGCATGCGTCTCTG | |
| Sequence-based reagent | Actin5C-fwd | This paper | qPCR primer TTGTCTGGGCAAGAGGATCAG | |
| Sequence-based reagent | Actin5C-rev | This paper | qPCR primer ACCACTCGCACTTGCACTTTC |