Skip to main content
Journal of the Endocrine Society logoLink to Journal of the Endocrine Society
. 2019 Jul 15;3(11):2041–2050. doi: 10.1210/js.2019-00057

The −839(A/C) Polymorphism in the ECE1 Isoform b Promoter Associates With Osteoporosis and Fractures

Karen E Hansen 1,, Michael G Johnson 1, Tonia C Carter 2, John Mayer 3, Nicholas S Keuler 4, Robert D Blank 5,6
PMCID: PMC6795020  PMID: 31637345

Abstract

Context

We previously found that variation in a quantitative trait locus, including the gene-encoding endothelin-converting enzyme 1 (Ece1), accounted for 40% of the variance in bone biomechanics and bone mineral density (BMD) in an intercross of recombinant congenic mouse strains.

Objective

We hypothesized that single nucleotide polymorphisms (SNPs) within the human ECE1 isoform b promoters, at ECE1 b −338(G/T) and ECE1 b −839(A/C), would associate with osteoporosis in postmenopausal women.

Design

We genotyped DNA for the ECE1 −338(G/T) and −839(A/C) SNPs.

Setting

A community medical center.

Participants

Postmenopausal women (3564) with ≥1 dual-energy X-ray absorptiometry scan ≥60 years of age.

Main Outcome Measures

BMD, osteoporosis, and clinical fractures.

Results

In multivariate models controlling for age, weight, healthcare duration, and tobacco, the CC genotype reduced the odds of lifetime fracture (OR 0.33, 95% CI 0.12, 0.87) and fracture ≥50 years of age (OR 0.31, 95% CI 0.11, 0.87), whereas the AC genotype increased odds of osteoporosis (OR 1.34, 95% CI 1.02 1.78) relative to the AA genotype. However, when controlling the false-discovery rate, findings were no longer significant. We found no consistent relationship between the ECE1 b −338(G/T) and study outcomes.

Conclusions

The CC genotype was associated with fewer fractures, whereas the AC genotype was associated with osteoporosis. Our small sample size and few minorities are study limitations. Findings should be tested in another cohort to confirm a link between the ECE1 −839(A/C) SNPs and osteoporosis.

Keywords: DNA, endothelin-converting enzyme 1; osteoporosis; fractures; postmenopausal women


Approximately two-thirds of peak bone mass is genetically determined [1]. Endothelin 1 (ET1) is a 21-amino acid, endothelium-derived, secreted, vasoactive peptide linked to hypertension and ischemic events [2, 3]. ET1 is secreted as a 39-amino acid inactive precursor, big ET1, which must be activated by proteolytic cleavage. Endothelin-converting enzyme 1 (ECE1) is a membrane-bound extracellular protease that catalyzes this reaction. ET1 promotes Wnt signaling to increase uncontrolled bone growth in osteoblastic bone metastases [4].

We previously demonstrated that ECE1-dependent ET1 signaling affects bone physiology in in vitro, ex vivo, and in vivo studies. Addition of exogenous, big ET1 to the culture media of immortalized mouse osteoblasts increased mineralization and decreased sclerostin production via upregulation of microRNA 126-3p [5, 6]. Addition of big ET1 to the media of human bone cores cultured ex vivo mimicked the response of bone to mechanical loading [7]. Congenic mice, harboring identical alleles at all loci except for the region surrounding Ece1, demonstrated variation in bone size and strength [8]. Furthermore, ablation of the endothelin receptor A in germline osteoblasts decreased bone mineral density (BMD) in 12-week-old mice [9].

Hu et al. [10] found that addition of ET1 to bone marrow-derived mesenchymal stem cells increased osteogenesis in vitro and in vivo (calvarium defect experiment). In postmenopausal women, Mestek et al. [11] found an inverse relationship between spine BMD and the vasodilating response to endothelin A receptor blockade (r −0.44, P < 006). In human genome-wide association studies (GWASs) for BMD and fracture, the single nucleotide polymorphism (SNP) rs7521902, located close to ECE1 on chromosome 1p36.12, was significantly associated with lumbar spine and femoral neck BMD and fracture in women [12]. These lines of evidence support a role for ET1 signaling in skeletal health.

Based on prior studies, we hypothesized that ECE1 isoform b promoter polymorphisms at ECE1 b −338(G/T) and ECE1 b −839(A/C) would associate with BMD, osteoporosis diagnosis, and clinical fractures in postmenopausal women. These SNPs exist at rs213045 and rs213046, respectively (Table 1).We used banked DNA and medical records’ data from postmenopausal women participating in the Marshfield Clinical Personalized Medicine Research Project (PMRP) to test our hypothesis.

Table 1.

Reference SNP Cluster Identifying Number and Corresponding Primer Information

RSID Primer Name Length Sequence
rs213045 rs213045_G 42 GAAGGTGACCAAGTTCATGCTGTCTTGATTGCTCTGGGCCAC
rs213045_T 44 GAAGGTCGGAGTCAACGGATTCTGTCTTGATTGCTCTGGGCCAA
rs213045_C2 25 AAAGTATCAGGAAGGTGCCCTCGAT
rs213046 rs213046_A 45 GAAGGTGACCAAGTTCATGCTAAATCTGCTGGGTTAGACCTCTCT
rs213046_C 43 GAAGGTCGGAGTCAACGGATTATCTGCTGGGTTAGACCTCTCG
rs213046_C1 26 CTCTCTCGGATATGAGGTGTTCAGTT

Abbreviation: RSID, Reference SNP Identification.

1. Materials and Methods

We studied postmenopausal women, who are at the greatest risk of osteoporosis and therefore, often undergo dual-energy X-ray absorptiometry (DXA) tests to screen for the condition. We collected medical records’ data from all postmenopausal women with banked DNA in the Marshfield Clinical PMRP and at least one BMD test at age ≥60 years. The Marshfield Clinic began the PMRP in 2002, and it currently contains DNA samples from ∼20,000 patients, along with links to their electronic health records [13]. Participants provided written consent to participate in the PMRP repository, including consent to bank DNA for future studies.

BMD scans were obtained, using DXA on Lunar Prodigy (GE Healthcare, Madison, WI) densitometers. From 1986 to 2001, all scans were performed at Ministry St. Joseph’s Hospital in Marshfield, Wisconsin. From 2002 to 2015, all scans were performed at the Marshfield Clinic and satellite centers. BMD data for lumbar spine, femoral neck, and total hip were extracted from densitometer databases. The earliest available scans that met inclusion criteria and satisfied technical validity checks were used for each subject. Before 2002, four of the eight Marshfield Clinic radiology technicians were International Society for Clinical Densitometry (ISCD) certified. From 2002 onward, all technicians were ISCD certified. Likewise, all physicians interpreting the scans were ISCD certified. The accuracy of the densitometer measurements was monitored using daily quality-assurance tests and weekly phantom scans. Personnel repeated precision studies whenever there was a change in technician, a technician’s quality of work, or densitometer equipment.

Marshfield Clinic researchers de-identified all subjects’ data and then labeled samples and health records data with a unique identification number to preserve subject confidentiality. We recorded the duration of medical care at the Marshfield Clinic, because this could influence the number of observed clinical fractures per patient. We also recorded subjects’ age, race, ethnicity, body weight, height, spine, and hip BMD, T- and Z-score values, clinical fractures, diagnosis and treatment of osteoporosis, and use of tobacco and systemic glucocorticoid therapy.

Personnel shipped DNA samples from the Marshfield PMRP Biorepository to the University of Wisconsin-Madison Biotechnology Center for analysis. We genotyped all DNA samples for the ECE1 −338(G/T) (rs213045) and −839(A/C) (rs213046) SNPs by KASPar (KBiosciences, Hoddeston, United Kingdom) allele-specific amplification, using primer sets given in Table 1. Primer sets were validated before analysis of subjects’ DNA, using the Sigma Life Science Human Random Control DNA Panel. Subjects’ DNA concentration was verified using the Quant-iT™ PicoGreen® double-stranded DNA kit (Life Technologies, Grand Island, NY). For the KASPar PCR reaction, DNA samples were first standardized to 0.5 ng/μL using epMotion 5075 and pH 7.5 10 mM UltrapureTM Tris-HCl (Life Technologies Carlsbad, CA). Each reaction contained 2 μL of 0.5 ng/μL DNA and 2 μL of KASPar reaction mix following standard procedures, with an annealing temperature of 56°C. Samples were stored at 10°C until read. Reactions were warmed in the dark at room temperature, and genotypes were assessed by fluorometry using a Synergy 2 (BioTek, Winooski, VT) plate reader and Gen5 software. Based on the 1000 Genomes Project data for populations of European ancestry [14], the two SNPs are in low linkage disequilibrium with each other (r2 = 0.262). Additionally, the rs7521902 SNP is not in linkage disequilibrium with either ECE1 −338(G/T) (r2 = 0.000) or ECE1 −839(A/C) (r2 = 0.002). We evaluated the relationship between ECE1 polymorphisms and skeletal health, as reflected by BMD values and clinical fractures.

A. Statistical Analysis

The 1000 Genome Project data found that in individuals of European ancestry, the frequency of the −338(A) allele was 0.287. To calculate the potential power of the study, we estimated that at least 28% of postmenopausal women would have sustained a symptomatic fracture after age 50 years [15]. Assuming that we would identify 2880 eligible women with both a bone density test and banked DNA in the PMRP, we had 90% power to detect a 6% increase in fracture in the subset of 827 women with the −338(A) allele using the χ2 test.

We evaluated relationships between ECE1 isoform b promotor polymorphisms and osteoporosis, clinical fractures, spine, and hip T-scores. A radiographic diagnosis of osteoporosis was noted when the T-score at the spine, femoral neck, or total hip was less than or equal to −2.5. Race was unknown for 47 subjects and non-white for 37 others (n = 84). Given our study’s limited power to detect the impact of race on osteoporosis or fracture, we analyzed data with and without these subjects. Because genetic factors influence bone strength throughout life, we modeled fracture using two definitions: a clinical fracture at age ≥50 years and a clinical fracture at any age. As few women took systemic glucocorticoid therapy at the time of the bone density test (n = 3), we excluded this variable in our models. All models were performed with and without inclusion of two individuals with unusually high BMD values (one with a spine and hip T-score of +10.3 and +4.3 and the other with a spine and hip T-score of −1.5 and +5.6, respectively).

We modeled five separate study outcomes: spine T-score, lowest hip T-score, osteoporosis, clinical fracture ≥50 years of age, and lifetime clinical fracture. We fit single-variable models initially and then fit multiple-variable models, adjusting for covariates known to affect BMD and fracture risk, including age, weight, and tobacco use. We analyzed tobacco use as a three-level variable (current, prior, or never) and as a dichotomous variable (ever vs never). As rates of diagnosed clinical fracture would likely depend on duration of care at the Marshfield Clinic, we adjusted multiple-variable models for duration of care. For each modeled outcome, we explored the effects of the A/C polymorphism and of the G/T polymorphism. In the multiple-variable analyses, we fit models using both polymorphisms. In a sensitivity analysis, we reran models, including all subjects, regardless of race. Finally, we performed multiple-variable analyses in which we entered the two polymorphisms using an interaction term.

In a sensitivity analysis, we used the Benjamini-Hochberg procedure to control the false-discovery rate. The Benjamini-Hochberg procedure ranks the P values within a model from smallest to largest and then determines the largest P value that satisfies p_k ≤ (k/m) × α. The P value that equals this number and all smaller P values are considered significant. In this formula, k is each P value’s rank, m is the number of total P values or comparisons, and α is set at a false-discovery rate of 0.05.

2. Results

Subjects were 3564 postmenopausal and predominantly non-Hispanic Caucasian (98%) women with a mean age of 66 ± 10 years and body mass index (BMI) of 29.6 ± 6.2 kg/m2 (Table 2). Most women never smoked (63%) and more than one in five (22%) were deceased at the time of data collection. The entire cohort had a mean spine T-score of −0.6 ± 1.7 and lowest hip T-score of −1.5 ± 1.1. Nearly 49% sustained a fracture after age 50 years, and 20% had osteoporosis based on T-score values, yet only 10% had received osteoporosis treatment.

Table 2.

Demographic Characteristics and BMD, Osteoporosis, and Fracture Measures

All Subjects,a,b n = 3564 GG, n = 1839 GT, n = 1433 TT, n = 258 P Value AA, n = 2942 AC, n = 541 CC, n = 23 P Value
Demographic characteristics
 Age, y 66 ± 10 66 ± 10 66 ± 9 66 ± 10 0.521 66 ± 10 66 ± 9 67 ± 10 0.740
 Height, cm 160 ± 6 160 ± 6 160 ± 6 160 ± 6 0.704 160 ± 6 160 ± 6 160 ± 5 0.336
 Weight, kg 76.0 ± 16.4 75.9 ± 16.2 76.0 ± 16.5 76.0 ± 16.7 0.992 76.1 ± 16.4 75.5 ± 16.1 77.0 ± 18 0.769
 BMI, kg/m2 29.6 ± 6.2 29.6 ± 6.2 29.5 ± 6.3 29.5 ± 6.2 0.990 29.6 ± 6.3 29.5 ± 6.0 30.4 ± 6.7 0.739
 Deceased (%) 790 (22) 394 (21) 332 (23) 57 (22) 0.492 653 (22) 119 (22) 4 (17) 0.855
 Tobacco use
  Current (%) 271 (8) 154 (8) 103 (7) 14 (5) 0.504 228 (8) 38 (7) 1 (4) 0.964
  Prior (%) 954 (27) 479 (26) 402 (28) 66 (26) 785 (27) 149 (28) 5 (22)
  Never (%) 2234 (63) 1152 (63) 885 (62) 170 (66) 1844 (62) 337 (62) 16 (70)
  Unknown (%) 105 (3) 54 (3) 43 (3) 8 (3) 85 (3) 17 (3) 1 (4)
 Race
  White (%) 3480 (98) 1797 (99) 1397 (99) 252 (99) 0.343 2879 (99) 523 (98) 22 (96) <0.001
  Other (%) 37 (1) 17 (1) 17 (1) 3 (1) 23 (1) 11 (2) 1 (4)
  Unknown (%) 47 Subjects
 Ethnicity
  Not Hispanic/Latina (%) 3507 (98) 1810 (100) 1408 (100) 255 (100) 0.249 2897 (100) 530 (99) 23 (100) 0.025
  Hispanic/Latina (%) 9 (<1) 3 (<1) 6 (<1) 0 (0) 4 (<1) 4 (1) 0
  Unknown 48 Subjects
BMD characteristics
 Spine, g/cm2 1.107 ± 0.198 1.105 ± 0.199 1.108 ± 0.199 1.104 ± 0.182 0.904 1.108 ± 0.199 1.098 ± 0.194 1.081 ± 0.199 0.431
 Spine T-score −0.6 ± 1.7 −0.7 ± 1.7 −0.6 ± 1.7 −0.7 ± 1.5 0.913 −0.6 ± 1.7 −0.7 ± 1.6 −0.9 ± 1.6 0.411
 Spine Z-score 0.7 ± 1.7 0.7 ± 1.7 0.8 ± 1.7 0.7 ± 1.5 0.666 0.7 ± 1.7 0.7 ± 1.6 0.6 ± 1.6 0.639
 Lowest femoral neck BMD, g/cm2 0.869 ± 0.141 0.872 ± 0.138 0.866 ± 0.146 0.865 ± 0.133 0.491 0.872 ± 0.140 0.856 ± 0.147 0.852 ± 0.117 0.067
 Lowest femoral neck T-score −1.2 ± 1.0 −1.2 ± 1.0 −1.2 ± 1.1 −1.3 ± 1.0 0.489 −1.2 ± 1.0 −1.3 ± 1.1 −1.3 ± 0.9 0.067
 Lowest femoral neck Z-score 0.3 ± 1.0 0.3 ± 0.9 0.3 ± 1.0 0.2 ± 0.9 0.514 0.3 ± 0.9 0.2 ± 1.00 0.2 ± 0.8 0.074
 Lowest hip T-score −1.5 ± 1.1 −1.3 ± 1.0 −1.4 ± 1.0 −1.4 ± 0.9 0.534 −1.3 ± 1.0 −1.4 ± 1.1 −1.5 ± 0.8 0.073
Fractures and other characteristics
 Osteoporosis diagnosis (%) 696 (20) 353 (19) 287 (20) 48 (19) 0.781 561 (19) 121 (22) 3 (13) 0.152
 Fracture under 50 y old (%) 353 (10) 195 (11) 119 (8) 30 (12) 0.051 291 (10) 57 (11) 2 (9) 0.882
 Fracture over 50 y old (%) 1751 (49) 907 (49) 712 (50) 120 (47) 0.642 1444 (49) 277 (51) 5 (22) 0.020
 Care duration, d 7992 (7057, 8154) 7997 (7111, 8163) 7981 (6962, 8144) 7997 (7181, 8162) 0.168 7986 (7060, 8155) 8014 (7099, 8152) 8072 (6735, 8134) 0.973
 Osteoporosis treatment (%) 366 (10) 188 (10) 142 (10) 31 (12) 0.590 298 (10) 60 (11) 2 (9) 0.772

The P values within the table reflect comparisons across the homozygous and heterozygous genotypes, using parametric or nonparametric tests as appropriate to the distribution of data. Where data were skewed, the median (interquartile range) was reported, and data were analyzed using the Kruskal-Wallis test. Data with a normal distribution were summarized using means ± SD and analyzed using ANOVA. Statistically significant findings are highlighted in bold text.

a

DNA testing was unsuccessful in 34 subjects for the GT and in 58 subjects for the AC polymorphs. Height was not available for 1 woman, weight was not available for 35 women, and BMI was unknown for 36 women. All women had measures of hip BMD, but spine BMD was missing in 65 women.

bOnly three women were taking glucocorticoid therapy within 90 d of their bone density test.

DNA testing was unsuccessful in 34 subjects for the G/T polymorphism and in 58 subjects for the A/C polymorphism. Among 3530 subjects with G/T genotype results, the GG (n = 1839, 52%), GT (n = 1433, 41%), and TT (n = 258, 7%) genotype frequencies were consistent with the Hardy-Weinberg equilibrium (P = 0.35). Among 3506 subjects with A/C genotype results, the AA (n = 2942, 84%), AC (n = 541, 15%), and CC (n = 23, <1%) genotypes also followed the Hardy-Weinberg equilibrium (P = 0.72).

Women with the CC genotype had fewer fractures ≥50 years of age compared with women with the AA and AC genotypes (22%, 51%, and 49%, respectively, P < 0.001). We found no differences in BMD or other study outcomes when comparing women with the GG, GT, and TT genotypes (Table 2). As expected, age was inversely associated with the spine and lowest hip T-scores, whereas weight and duration of care at the Marshfield Clinic were positively associated with spine and lowest hip T-scores (Table 3).

Table 3.

Spearman Correlation Coefficients Between T-Scores and Predictors

Predictor Sample Size Correlation Coefficient P Value
Spine T-score
 Age, y 3454 −0.174 <0.001
 Care duration, d 3454 0.108 <0.001
 Weight, kg 3419 0.318 <0.001
 Smokinga 3359 0.004 0.812
Lowest hip T-score
 Age, years 3328 −0.371 <0.001
 Care duration, d 3328 0.195 <0.001
 Weight, kg 3323 0.389 <0.001
 Smokinga 3271 0.009 0.603
a

Smoking was analyzed using a scale, where 1 = current, 2 = prior, and 3 = never use. Statistically significant findings are highlighted in bold text.

In single-variable logistic-regression models, predicting osteoporosis and fracture (Table 4), age increased the odds of osteoporosis (OR 1.08, 95% CI 1.07, 1.09) and the odds of lifetime fracture (OR 1.03, 95% CI 1.03, 1.04). Weight (OR 0.95, 95% CI 0.94, 0.95) and duration of care (OR 0.90, 95% CI 0.89, 0.92) both reduced the odds of osteoporosis based on a T-score diagnosis. Compared with the AA genotype, the CC genotype reduced the odds of lifetime fracture (OR 0.32, 95% CI 0.13, 0.82) and the odds of fracture ≥50 years of age (OR 0.31, 95% CI 0.11, 0.83).

Table 4.

Single-Variable Logistic-Regression Models Predicting Odds of Osteoporosis and Fractures

Predictor n Osteoporosis Fracture ≥50 Years of Age Lifetime Fracture
Age, per y 3446 1.08 (1.07, 1.09) 1.05 (0.64, 1.72) 1.03 (1.03, 1.04)
Duration of care, per y 3424 0.90 (0.89, 0.92) 0.01 (0, 2.71) 4.29 (0.01, 4128)
Weight, per kilogram 3480 0.95 (0.94, 0.95) 1.00 (0.99, 1.000) 1.00 (1.00, 1.00)
Never, relative to ever, smoker 3445 1.05 (0.88, 1.26) 1.07 (0.92, 1.23) 0.98 (0.85, 1.13)
AC, relative to AA, genotype 3382 1.21 (0.97, 1.52) 1.03 (0.86, 1.24) 1.01 (0.88, 1.27)
CC, relative to AA, genotype 3382 0.66 (0.20, 2.25) 0.31 (0.11, 0.83) 0.32 (0.13, 0.82)
GT, relative to GG, genotype 3480 1.04 (0.87, 1.24) 1.01 (0.88, 1.16) 0.95 (0.83, 1.10)
TT, relative to GG, genotype 3480 0.98 (0.70, 1.36) 0.88 (0.67, 1.14) 0.91 (0.70, 1.18)

Numbers in the table are ORs, followed by their 95% CI in parentheses. Smoking was recorded as current, prior, or never. We also analyzed smoking as a three-level factor and again as a dichotomous variable (ever vs never); results were nearly identical to analyses where smoking was categorized as ever vs never. Because smoking affects fracture risk for years after smoking cessation, and the date of cessation was not recorded for prior smokers, we chose to report the odds of each outcome for never (vs ever) smokers. Here, we present the single-variable models when excluding non-Caucasian subjects and two outliers with very high hip T-scores (n = 3478). Statistically significant findings are highlighted in bold text.

We used multiple-variable logistic-regression models to explore the impact of the ECE1 b −839(A/C) and ECE1 −338(G/T) alleles on study outcomes. Our primary models excluded non-Caucasian women, women with an unknown racial background, and two outliers with high BMD (86 subjects). The model predicting osteoporosis found that age, care duration, weight, and the AC genotype of ECE1 b −839(A/C) were important predictors (Table 5). Age increased, whereas weight and duration of care reduced the odds of osteoporosis. Additionally, with the AA genotype as the referent, the AC genotype increased the odds of osteoporosis (OR 1.34, 95% CI 1.02, 1.78). The AC genotype was no longer significant when controlling analyses for the false-discovery rate.

Table 5.

Multiple-Variable Logistic-Regression Models Predicting Odds of Osteoporosis and Fracture Using the A/C Allele as a Three-Factor Variable

Osteoporosis Fracture ≥Age 50 Years Lifetime Fracture
Age, per y 1.08 (1.06, 1.09) P < 0.001 1.06 (1.05, 1.07) P < 0.001 1.04 (1.03, 1.05) P < 0.001
Care duration, per d 0.98 (0.95, 1.00) P = 0.049 1.04 (1.02, 1.06) P < 0.001 1.04 (1.02, 1.07) P < 0.001
Weight, per kg 0.95 (0.94, 0.95) P < 0.001 1.00 (0.99, 1.00) P = 0.373 1.01 (1.00, 1.01) P = 0.933
Never, relative to ever, smoker 0.95 (0.78, 1.16) P = 0.569 0.96 (0.83, 1.12) P = 0.575 0.90 (0.78, 1.04) P = 0.137
AC, relative to AA, allele 1.34 (1.02, 1.78) P = 0.038 1.10 (0.89, 1.38) P = 0.324 1.17 (0.94, 1.44) P = 0.139
CC, relative to AA, allele 0.64 (0.17, 2.47) P = 0.500 0.31 (0.11, 0.87) P = 0.026 0.33 (0.12, 0.87) P = 0.020
GT, relative to GG, allele 0.98 (0.79, 1.21) P = 0.858 0.97 (0.83, 1.13) P = 0.683 0.90 (0.77, 1.05) P = 0.180
TT, relative to GG, allele 0.88 (0.58, 1.33) P = 0.475 0.90 (0.67, 1.22) P = 0.539 0.93 (0.69, 1.25) P = 0.678

The table represents models, excluding non-Caucasian subjects and two individuals with unusually high BMD (n = 3478). Numbers in the table are ORs with 95% CIs. In multivariate models—including all subjects regardless of race, minus two outliers with high T-scores (n = 3562)—the AC genotype increased the odds of osteoporosis (OR 1.34, 95% CI 1.02, 1.77, P = 0.038), and the CC genotype reduced the odds of fracture over age 50 (OR 0.30, 95% CI 0.10, 0.84, P = 0.022) and the odds of fracture at any age (OR 0.32, 95% CI 0.12, 0.84, P = 0.020). In models, including subjects (n = 3564), the AC genotype increased the odds of osteoporosis (OR 1.34, 95% CI 1.02, 1.77, 1.526, P = 0.035), and the CC genotype reduced the odds of fracture over age 50 (OR 0.30, 95% CI 0.10, 0.84, P = 0.022) and the odds of lifetime fracture (OR 0.32, 95% CI 0.12, 0.84, P = 0.020), whereas the GT genotype reduced the risk of fracture over age 50 (OR 0.76, 95% CI 0.60, 0.97, P = 0.027). In multiple-variable analyses, where the ECE1 −338(G/T) and −839(A/C) SNPs were analyzed using an interaction term, neither allele was a significant predictor of study outcomes. The Benjamini-Hochberg method of controlling the false-positive discovery rate showed that age, weight, and care duration remained significant predictors of osteoporosis. The Benjamini-Hochberg method of controlling the false-positive discovery rate showed that age and care duration remained significant predictors of fracture ≥50 y of age and lifetime fracture. Statistically significant findings are highlighted in bold text.

We used multiple-variable logistic-regression models to evaluate the impact of variables on lifetime fractures and fractures ≥50 years of age. In these models, age and duration of care increased the odds of both fracture outcomes (Table 5). Additionally, the CC genotype reduced the odds of lifetime fracture (OR 0.33, 95% CI 0.12, 0.87) and fracture ≥50 years of age (OR 0.31, 95% CI 0.11, 0.87). The relationship between the CC genotype and fracture was similar when including all women regardless of race and when including two subjects with very high T-scores (Table 5). The CC genotype was no longer a significant predictor of lifetime fracture or fractures ≥50 years of age when controlling for the false-positive discovery rate. Only in models that included all subjects (n = 3564) did the GT genotype become significant, reducing the odds of fracture over age 50 (OR 0.76, 95% CI 0.60, 0.97).

In multiple linear-regression models predicting the lowest hip T-score (Table 6), significant covariates included age, duration of care, weight, and tobacco use. In multiple linear-regression models predicting the spine T-score, age and weight were significant covariates. Neither the ECE1 b −839(A/C) nor ECE1 b −338(G/T) was significant in models predicting the spine and lowest hip T-score. Findings were similar when we included all subjects regardless of race, with or without the two outliers with high T-scores. In multiple-variable models entering the A/C and G/T alleles with an interaction term, the alleles were not significant predictors of any study outcomes.

Table 6.

Multiple Linear-Regression Models Predicting Spine and Hip T-Scores, Using the A/C Allele as a Three-Factor Variable

Spine T-Score Lowest Hip T-Score
Β SE T Value P Value Β SE T Value P Value
Intercept −1.903 0.329 −5.781 <0.001 −1.097 0.187 −5.861 <0.001
Age, per y −0.0189 0.003 −6.197 <0.001 −0.034 0.002 −19.350 <0.001
Care duration, per d 0.011 0.008 1.307 0.191 0.017 0.005 3.669 <0.001
Weight, per kg 0.030 0.002 17.966 <0.001 0.021 0.001 22.529 <0.001
Never, relative to ever, smoker 0.040 0.057 0.697 0.486 0.074 0.032 2.291 0.022
AC, relative to AA, genotype −0.064 0.083 −0.772 0.440 −0.072 0.047 −1.525 0.127
CC, relative to AA, genotype −0.411 0.346 −1.186 0.235 −0.090 0.194 −0.463 0.643
GT, relative to GG, genotype 0.031 0.061 0.504 0.614 −0.017 0.034 −0.508 0.612
TT, relative to GG, genotype 0.024 0.115 0.205 0.838 −0.044 0.066 −0.668 0.504
R2 = 0.11 R2 = 0.26

The table represents models, excluding non-Caucasian subjects and two individuals with unusually high BMD (n = 3478). Findings were similar when including all subjects regardless of race and excluding two individuals with high T-scores (n = 3562), except that the AC genotype was borderline significant in models predicting the lowest hip T-score (Β −0.0845, P = 0.071). In multiple-variable analyses, where the ECE1 −338(G/T) and −839(A/C) SNPs were analyzed using an interaction term, neither allele was a significant predictor of spine or hip T-score. Statistically significant findings are highlighted in bold text.

We further explored the relationship between genotypes and spine and femoral neck BMD. In these analyses, subjects with the AC genotype had lower femoral neck BMD compared with subjects with the AA genotype (0.870 ± 0.147 vs 0.885 ± 0.142 g/cm2, P = 0.05). Subjects with the AC genotype had similar spine BMD to subjects with the AA genotype (1.099 ± 0.195 vs 1.108 ± 0.199 g/cm2, P = 0.321). We found no difference in spine or femoral neck BMD by the GG, GT, or TT genotype (data not shown).

3. Discussion

In the current study, we tested the hypothesis that ECE1 isoform b promoter polymorphisms at ECE1 b −338(G/T) and ECE1 b −839(A/C) on chromosome 1 were associated with BMD and clinical fractures in postmenopausal women. We used banked DNA and medical records’ data from postmenopausal women participating in the Marshfield Clinic PMRP to test our hypothesis. In multivariate models, the AC genotype increased the odds of osteoporosis, whereas the CC genotype reduced the odds of lifetime fracture and fracture ≥50 years of age. However, findings were no longer significant when controlling the false-discovery rate. We found no consistent association between the ECE1 b −338(G/T) allele and BMD, osteoporosis, or fracture.

Whereas our results might seem discrepant, with the AC allele associated with increased osteoporosis risk and CC associated with decreased fracture, such findings do not negate the potential importance of our study. Most GWAS analyses are conducted using simple additive models of genotype effects. However, it is well known that for individual loci, additive, dominance, and sometimes epistatic effects are potentially relevant to the biology [16]. A simple example is ABO blood types, where A and B alleles are dominant to O and co-dominant with each other. The situation of a heterozygous genotype having a more extreme phenotype than either homozygous genotype has also been well described in the past, and this condition is called overdominance or underdominance. Overdominance of global fitness in malarial regions is thought by some to be the mechanism underlying the persistence of the sickle hemoglobin allele in the human population. The example of sickle cell also points out the importance of potential gene–environment interactions, as the increased fitness of hemoglobin allele/sickle hemoglobin individuals is limited to regions where malaria is endemic. Other potential explanations for overdominance also exist, including the tested locus being in linkage disequilibrium with the biologically relevant allele and false-positive association arising as a result of a small sample size. Our data cannot distinguish among these alternatives, and any questions about our study results are best be addressed by replication in an independent study population.

In mice, we previously found that variation in the genomic region harboring the Ece1 allele affected bone size and accounted for 40% of the variance in bone biomechanics and BMD in an intercross of recombinant congenic strains HcB-8 and HcB-23 (5-7). We confirmed the effect in fully congenic strains [8]. We demonstrated that ECE1-dependent ET1 signaling affects bone physiology in in vitro, ex vivo, and in vivo studies. Addition of exogenous big ET1 to immortalized mouse osteoblast cultures increased mineralization and decreased sclerostin production by upregulating microRNA 1263-p [5, 6]. Addition of ET1 simulated mechanical loading, when added to human bone core cultures ex vivo [7]. Congenic mice, identical at all loci except for Ece1, demonstrated variation in bone size and strength [8]. Ablation of the endothelin receptor A in osteoblasts decreased BMD in 12-week-old mice [9]. In human GWASs, SNP rs7521902, located close to ECE1 on chromosome 1p36.12, was significantly associated with lumbar spine and femoral neck BMD and fracture in women [12]. Additionally, the University of Michigan PheWeb (http://pheweb.sph.umich.edu/) reported significant associations between the A/C allele and risk of rib (P = 0.022), femur (P = 0.023), and vertebral (P = 0.032) fractures. Whereas this database does not adjust for covariates known to increase fracture risk, its results support the findings of the current study.

Limited human phenotyping is a weakness of the current study. In our earlier mouse experiments, we were able to evaluate multiple phenotypes and perform destructive biomechanical testing [57]. Those experiments revealed that bone cross-sectional geometry was the feature most strongly associated with genotype and correlated strongly with mechanical performance. DXA-determined BMD is a composite measure that incorporates both true volumetric density and bone size. Another possible explanation for the BMD vs fracture discrepancy is the small number (n = 23, <1%) of individuals harboring the CC genotype.

Our study has multiple strengths. First, we identified the ET1 signaling axis as potentially affecting skeletal health from in vitro [5, 6], ex vivo [7], and in vivo studies [18] and then tested the hypothesis that ET1 signaling affects skeletal health in postmenopausal women. The study was population based and controlled for several factors known to affect bone health. Weaknesses include a focus on Caucasian women, analysis of clinical rather than all fractures or fragility fractures, extraction of data from medical records rather than prospectively, and limited power to detect weak associations between the genotypes and study outcomes. Indeed, a small sample size is potentially our greatest weakness, as GWASs typically recruit much larger groups of subjects.

Our data and previous studies demonstrate that the ET1 signaling axis, and specifically ECE1, affects BMD. ET1 signaling is responsive to mechanical load [7], and allelic differences in murine Ece1 lead to differences in bone size and strength [18, 19] at skeletal maturity. Thus, we hypothesize that determination of ECE1 b status at an early age might permit loading intervention to increase peak bone mass and decrease lifetime risk of osteoporosis and fracture. Confirmation of findings and extension to other groups are needed in other, larger cohorts.

Acknowledgments

Financial Support: We thank the University of Wisconsin Institute for Clinical and Translational Research for funding through a grant from the National Center for Advancing Translation Sciences (UL1TR00427) and the Marshfield Clinic for a grant supporting this work, called “Marshfield Clinical Research Foundation–UW Madison Collaborative Research Pilot Program.”

Author Contributions: K.E.H., M.G.J., and R.D.B. designed the study and interpreted data. K.E.H., T.C.C., and J.M. conducted the study. T.C.C., J.M., and M.G.J. collected data. K.E.H. and N.S.K. analyzed data. K.E.H. drafted the manuscript and takes responsibility for integrity of the data analysis. All authors revised the manuscript and approved the final version.

Additional Information

Disclosure Summary: K.E.H., M.J.G., T.C.C., J.M., and N.S.K. have nothing to disclose. R.D.B. is a consultant for Amgen, Novo-Nordisk, Radius Health, and Ultragenyx. He receives authorship royalties from UpToDate and McGraw-Hill. He has ownership interests in JangoBio, Abbott Laboratories, and Abbvie.

Data Availability: All data generated or analyzed during this study are included in this published article or in the data repositories listed in References and Notes.

Glossary

Abbreviations:

BMD

bone mineral density

BMI

body mass index

DXA

dual-energy X-ray absorptiometry

ECE1

endothelin-converting enzyme 1

ET1

endothelin 1

GWAS

genome-wide association study

ISCD

International Society for Clinical Densitometry

PMRP

Personalized Medicine Research Project

SNP

single nucleotide polymorphism

References and Notes

  • 1. Bogl LH, Latvala A, Kaprio J, Sovijärvi O, Rissanen A, Pietiläinen KH. An investigation into the relationship between soft tissue body composition and bone mineral density in a young adult twin sample. J Bone Miner Res. 2011;26(1):79–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Funalot B, Courbon D, Brousseau T, Poirier O, Berr C, Cambien F, Amouyel P, Schwartz JC, Ducimetière P, Study EVA; EVA Study. Genes encoding endothelin-converting enzyme-1 and endothelin-1 interact to influence blood pressure in women: the EVA study. J Hypertens. 2004;22(4):739–743. [DOI] [PubMed] [Google Scholar]
  • 3. Ahmed M, Rghigh A. Polymorphism in endothelin-1 gene: an overview. Curr Clin Pharmacol. 2016;11(3):191–210. [DOI] [PubMed] [Google Scholar]
  • 4. Sun P, Xiong H, Kim TH, Ren B, Zhang Z. Positive inter-regulation between beta-catenin/T cell factor-4 signaling and endothelin-1 signaling potentiates proliferation and survival of prostate cancer cells. Mol Pharmacol. 2006;69(2):520–531. [DOI] [PubMed] [Google Scholar]
  • 5. Johnson MG, Konicke K, Kristianto J, Gustavson A, Garbo R, Wang X, Yuan B, Blank RD. Endothelin signaling regulates mineralization and posttranscriptionally regulates SOST in TMOb cells via miR 126-3p. Physiol Rep. 2017;5(4):5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Johnson MG, Kristianto J, Yuan B, Konicke K, Blank R. Big endothelin changes the cellular miRNA environment in TMOb osteoblasts and increases mineralization. Connect Tissue Res. 2014;55(Suppl 1):113–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Meyer LA, Johnson MG, Cullen DM, Vivanco JF, Blank RD, Ploeg HL, Smith EL. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis. Bone. 2016;85:115–122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Wang Z, Kristianto J, Yen Ooi C, Johnson MG, Litscher SJ, Pugh TD, Sandhu G, Chesler NC, Blank RD. Blood pressure, artery size, and artery compliance parallel bone size and strength in mice with differing ece1 expression. J Biomech Eng. 2013;135(6):61003–61009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Clines GA, Mohammad KS, Grunda JM, Clines KL, Niewolna M, McKenna CR, McKibbin CR, Yanagisawa M, Suva LJ, Chirgwin JM, Guise TA. Regulation of postnatal trabecular bone formation by the osteoblast endothelin A receptor. J Bone Miner Res. 2011;26(10):2523–2536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hu LW, Wang X, Jiang XQ, Xu LQ, Pan HY. In vivo and in vitro study of osteogenic potency of endothelin-1 on bone marrow-derived mesenchymal stem cells. Exp Cell Res. 2017;357(1):25–32. [DOI] [PubMed] [Google Scholar]
  • 11. Mestek ML, Weil BR, Greiner JJ, Westby CM, DeSouza CA, Stauffer BL. Osteopenia and endothelin-1-mediated vasconstrictor tone in postmenopausal women. Bone. 2010;47(3):542–545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Estrada K, Styrkarsdottir U, Evangelou E, Hsu YH, Duncan EL, Ntzani EE, Oei L, Albagha OM, Amin N, Kemp JP, Koller DL, Li G, Liu CT, Minster RL, Moayyeri A, Vandenput L, Willner D, Xiao SM, Yerges-Armstrong LM, Zheng HF, Alonso N, Eriksson J, Kammerer CM, Kaptoge SK, Leo PJ, Thorleifsson G, Wilson SG, Wilson JF, Aalto V, Alen M, Aragaki AK, Aspelund T, Center JR, Dailiana Z, Duggan DJ, Garcia M, Garcia-Giralt N, Giroux S, Hallmans G, Hocking LJ, Husted LB, Jameson KA, Khusainova R, Kim GS, Kooperberg C, Koromila T, Kruk M, Laaksonen M, Lacroix AZ, Lee SH, Leung PC, Lewis JR, Masi L, Mencej-Bedrac S, Nguyen TV, Nogues X, Patel MS, Prezelj J, Rose LM, Scollen S, Siggeirsdottir K, Smith AV, Svensson O, Trompet S, Trummer O, van Schoor NM, Woo J, Zhu K, Balcells S, Brandi ML, Buckley BM, Cheng S, Christiansen C, Cooper C, Dedoussis G, Ford I, Frost M, Goltzman D, González-Macías J, Kähönen M, Karlsson M, Khusnutdinova E, Koh JM, Kollia P, Langdahl BL, Leslie WD, Lips P, Ljunggren Ö, Lorenc RS, Marc J, Mellström D, Obermayer-Pietsch B, Olmos JM, Pettersson-Kymmer U, Reid DM, Riancho JA, Ridker PM, Rousseau F, Slagboom PE, Tang NL, Urreizti R, Van Hul W, Viikari J, Zarrabeitia MT, Aulchenko YS, Castano-Betancourt M, Grundberg E, Herrera L, Ingvarsson T, Johannsdottir H, Kwan T, Li R, Luben R, Medina-Gómez C, Palsson ST, Reppe S, Rotter JI, Sigurdsson G, van Meurs JB, Verlaan D, Williams FM, Wood AR, Zhou Y, Gautvik KM, Pastinen T, Raychaudhuri S, Cauley JA, Chasman DI, Clark GR, Cummings SR, Danoy P, Dennison EM, Eastell R, Eisman JA, Gudnason V, Hofman A, Jackson RD, Jones G, Jukema JW, Khaw KT, Lehtimäki T, Liu Y, Lorentzon M, McCloskey E, Mitchell BD, Nandakumar K, Nicholson GC, Oostra BA, Peacock M, Pols HA, Prince RL, Raitakari O, Reid IR, Robbins J, Sambrook PN, Sham PC, Shuldiner AR, Tylavsky FA, van Duijn CM, Wareham NJ, Cupples LA, Econs MJ, Evans DM, Harris TB, Kung AW, Psaty BM, Reeve J, Spector TD, Streeten EA, Zillikens MC, Thorsteinsdottir U, Ohlsson C, Karasik D, Richards JB, Brown MA, Stefansson K, Uitterlinden AG, Ralston SH, Ioannidis JP, Kiel DP, Rivadeneira F. Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. Nat Genet. 2012;44(5):491–501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. McCarty CA, Wilke RA, Giampietro PF, Wesbrook SD, Caldwell MD. Marshfield Clinic Personalized Medicine Research Project (PMRP): design, methods and recruitment for a large population-based biobank. Per Med. 2005;2(1):49–79. [DOI] [PubMed] [Google Scholar]
  • 14. 1000 Genomes Project Consortium; Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, McCarthy S, McVean GA, Abecasis GR. A global reference for human genetic variation. Nature. 2015;526(7571):68–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Jones G, Nguyen T, Sambrook PN, Kelly PJ, Gilbert C, Eisman JA. Symptomatic fracture incidence in elderly men and women: the Dubbo Osteoporosis Epidemiology Study (DOES). Osteoporos Int. 1994;4(5):277–282. [DOI] [PubMed] [Google Scholar]
  • 16. Culverhouse R. The restricted partition method. Adv Genet. 2010;72:117–139. [DOI] [PubMed] [Google Scholar]
  • 17. Genetics Home Reference. Genes. Available at: https://ghr.nlm.nih.gov/gene.
  • 18. Kristianto J, Litscher SJ, Johnson MG, Patel F, Patel M, Fisher J, Zastrow RK, Radcliff AB, Blank RD. Congenic strains confirm the pleiotropic effect of chromosome 4 QTL on mouse femoral geometry and biomechanical performance. PLoS One. 2016;11(2):e0148571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Saless N, Litscher SJ, Vanderby R, Demant P, Blank RD. Linkage mapping of principal components for femoral biomechanical performance in a reciprocal HCB-8 × HCB-23 intercross. Bone. 2011;48(3):647–653. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of the Endocrine Society are provided here courtesy of The Endocrine Society

RESOURCES