Abstract
Background
α-Linolenic acid (ALA) is a plant-derived omega-3 unsaturated fatty acid that is rich in flaxseed oil (FO). The effect of FO on bone health is controversial. This study aims to evaluate the effect of FO on bone damage induced by a high-fat diet (HFD) and to explore the possible mechanism.
Methods
Male Sprague-Dawley rats were fed a normal control diet (NC, 10% fat), FO diet (NY, 10% fat), HFD (60% fat), or HFD containing 10% FO (HY, 60% fat) for 22 weeks. Micro CT and three-point bending tests were conducted to evaluate bone microstructure and biomechanics. Serum was collected for the detection of ALP, P1NP, and CTX-1. Rat primary osteoblasts (OBs) were treated with different concentrations of ALA with or without palmitic acid (PA) treatment. The ALP activity, osteogenic-related gene and protein expression were measured.
Results
Rats in the HFD group displayed decreased biomechanical properties, such as maximum load, maximum fracture load, ultimate tensile strength, stiffness, energy absorption, and elastic modulus, compared with the NC group (p < 0.05). However, HY attenuated the HFD-induced decreases in bone biomechanical properties, including maximum load, maximum fracture load, and ultimate tensile strength (p < 0.05). Trabecular bone markers such as trabecular volume bone mineral density (Tb. vBMD), trabecular bone volume/total volume (Tb. BV/TV), trabecular number (Tb. N), trabecular thickness (Tb. Th) were decreased, trabecular separation (Tb. Sp) and the structure model index (SMI) were increased in the HFD group compared with the NC group, and all parameters were remarkably improved in the HY group compared to the HFD group (p < 0.05). However, cortical bone markers such as cortical volume bone mineral density (Ct. vBMD), cortical bone volume/total volume (Ct. BV/TV) and cortical bone thickness (Ct. Th) were not significantly different among all groups. Moreover, the serum bone formation markers ALP and P1NP were higher and the bone resorption marker CTX-1 was lower in the HY group compared with levels in the HFD group. Compared with the NC group, the NY group had no difference in the above indicators. In rat primary OBs, PA treatment significantly decreased ALP activity and osteogenic gene and protein (β-catenin, RUNX2, and osterix) expression, and ALA dose-dependently restored the inhibition induced by PA.
Conclusions
FO might be a potential therapeutic agent for HFD-induced bone loss, most likely by promoting osteogenesis.
Keywords: Flaxseed oil, α-Linolenic acid, Osteoporosis, Primary osteoblasts, High-fat diet
Background
With the development of the economy, saturated fats are generally enriched in modern diets. Diet is one of the risk factors for osteoporosis in addition to heredity, age, oestrogen deficiency, and calcium and phosphorus metabolism [1]. Several studies have indicated that a high-fat diet (HFD) had a negative impact on bone health [2]. One middle-to-older-aged population study indicated that a high body fat percentage was a risk factor for osteoporosis with ageing [3]. Two animal studies have reported that HFD consumption was associated with bone strength reduction and that adverse microstructure changes occurred in the cancellous bone compartment [4, 5]. In addition, Ahmad Alsahli et al. noted that elevated levels of palmitic acid (PA) reduced osteoblast (OB) function in vitro and bone formation markers in vivo [6].
As diet is modifiable, the study of nutrition on bone health may provide an approach for osteoporosis prevention. Omega-3 unsaturated fatty acids (ω-3 FA) included eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA) and a-linolenic acid (ALA), which can lower lipid disorders, reduce inflammatory factors, resist arteriosclerosis [7, 8]. Recent studies have shown that ω-3 FA has protective effects on bone metabolism [9–11]. Studies have shown that bone loss induced by aging, oestrogen deficiency, ovariectomized (OVX) animals and inflammation can be abrogated by DHA and EPA [12–14]. However, the effect of ALA on bone health is controversial. Flaxseed oil (FO) contains approximately 60% ALA and represents a plant-derived ω-3 FA. A clinical study indicated that daily consumption of 6 g/d of FO may reduce bone resorption in haemodialysis patients [15]. An animal study showed that ALA associated with calcium and protein provided by flaxseed flour contributed to bone quality in the post-partum period of dam rats [16]. Longo et al. suggested that providing FO, possibly through its high ALA content, provided protection against OVX-induced alveolar bone loss in rats [17]. However, Cohen et al. noted that feeding a 10% FO diet did not have effects on bone mass and bone strength compared with a 10% corn oil diet in growing mice [18]. However, another animal study showed that lifelong intake of FO or menhaden oil modulated bone microarchitecture during growth but did not affect OVX-induced bone loss in Sprague-Dawley (SD) rats [19]. Considering these contradictory reports in the scientific literature, the effectiveness of FO is not completely proven.
Whether FO has a protective effect on HFD-induced bone damage has not been clarified, and the specific mechanism of bone protection is unclear. Therefore, this study aimed to evaluate whether totally replacing soybean oil and partly replacing lard with FO in HFD can improve high-fat-induced bone damage in vivo. We treated rat primary OBs with ALA in vitro to observe the effect of ALA on osteoblastic function, osteogenic-related gene and protein expression and tried to explore the mechanism of ALA on bone protection.
Material and methods
Animal experiments
Forty 4-week-old male SD rats weighing 100–120 g were obtained from Vital River Laboratory Animal Technology Co Ltd. (Beijing, China). Animals were housed 2 per cage, maintained in constant temperature-controlled rooms (22–25 °C) with a 12-h light/dark cycle, and had free access to food and water. After being acclimated to the housing conditions for 1 week, they were randomly assigned to one of the four diets: (1) (NC group, n = 10): normal control diet, fat provides 10% of energy; (2) (NY group, n = 10): FO substitutes for all of the soybean oil and lard in the normal control diet, fat provides 10% of energy; (3) (HFD group, n = 10): fat provides 60% of energy; and (4) (HY group, n = 10): FO replaces all of the soybean oil and part of the lard in the HFD, fat provides 60% of energy. The rats were fed the specified diet for 22 weeks before they were sacrificed. The composition of the experimental diets was assayed by the Beijing Research Institute for Nutritional Resources, and details are shown in Table 1. To avoid potential oxidation, each diet was repackaged into weekly portions, vacuum-sealed, and stored at 4 °C in the dark until use.
Table 1.
Composition of experimental diets (4057 kcal per serving)
Raw material Configuration(g) |
NC (D12450B) |
NY | HFD (D12492) | HY |
---|---|---|---|---|
Casein lactic | 200 | 200 | 200 | 200 |
L-Cystine | 3 | 3 | 3 | 3 |
Corn Starch | 315 | 315 | 0 | 0 |
Maltodextrin | 35 | 35 | 125 | 125 |
Sucrose | 350 | 350 | 68.8 | 68.8 |
Cellulose BW | 50 | 50 | 50 | 50 |
Soybean Oil | 25 | 0 | 25 | 0 |
Flaxseed Oil | 0 | 45 | 0 | 45 |
Lard | 20 | 0 | 245 | 225 |
Mineral Mix S10026 | 10 | 10 | 10 | 10 |
DiCalcium Phosphate | 13 | 13 | 13 | 13 |
Calcium Carbonate | 5.5 | 5.5 | 5.5 | 5.5 |
Potassium Citrate | 16.5 | 16.5 | 16.5 | 16.5 |
Vitamin Mix V10001 | 10 | 10 | 10 | 10 |
Choline Bitartrate | 2 | 2 | 2 | 2 |
Summation(g) | 1055 | 1055 | 773.8 | 773.8 |
Energy (kcal) | 4057 | 4057 | 4057 | 4057 |
Serum sample and bone tissues acquisition
All rats were fasted for 12 h and anaesthetized with 1% pentobarbital sodium after feeding the specified diet for 22 weeks. Serum was collected after centrifuging at 3000 rpm for 10 min and stored at −80 °C for subsequent analyses. After removing the soft tissue, the right femurs and left tibias were removed and stored in 4% paraformaldehyde for micro-computed tomography (microCT) analysis and bone histology analysis. Left femurs were wrapped in saline gauze and frozen at −30 °C for the three-point bending test.
Bone biomechanical analysis
To assess bone strength, the three-point bending test was performed on a universal testing machine (BoseElectroForce®3230, Bose Corporation, USA) by placing the bones, anterior face up, on two supports that were equidistant from the ends and 16 mm apart. The load was applied at a constant deformation rate of 2 mm/min. The diaphysis of the femur was loaded until a fracture occurred to determine the yield and fracture parameters. The yield represents the point at which bone ceases to behave elastically. The data were automatically recorded in a computer interfaced to the testing machine, and a typical load-deformation curve was created. A saline solution was used to keep specimens moist during testing. The material properties of the bones were calculated as described in previous studies [20]. The maximum load, maximum fracture load, energy absorption, stiffness, ultimate tensile strength and elastic modulus were measured.
Bone microCT analysis
The trabecular and cortical microarchitectures of the right femurs were scanned using microCT (SkyScan-1176 μCT, Brook Corporation, Belgium), and the images were reconstructed to an isotropic voxel size of 12 μm. The volume of interest (VOI), which was located 1 mm from the metaphyseal line to the 100 continuous slices above, was selected for data analysis. All 3D image manipulations and analyses were performed using system software (MicroView, v.2.1, GE Healthcare).
Bone histology analysis
Left tibias were fixed in 4% paraformaldehyde (Sigma-Aldrich), decalcified in 10% ethylenediaminetetraacetic acid (Sigma-Aldrich) at pH 7.0, and then embedded in paraffin. Longitudinal sections (5-μm thick) were stained with haematoxylin and eosin to observe the number of trabecular and bone marrow adipocytes. All pathological images were observed using a light microscope from several visual fields per slice (Axiovert 100 M Zeiss, Zeppelinstrasse, Germany) at 100× magnification. The number of trabecular and adipocyte analyses was determined by a pathologist who was blind to the grouping situation according to the results of the images.
Biochemical analysis
Serum levels of alkaline phosphatase (ALP) were measured using an Olympus AU5400 automatic biochemical analyser (Olympus Co, Ltd., Tokyo, Japan). Serum levels of procollagen type 1 N-terminal propeptide (P1NP) were measured using an ELISA kit (Cusabio, Wuhan, China). C-Telopeptide of type 1 collagen (CTX-1) was also measured using an ELISA kit (Cusabio, Wuhan, China). All measurements were conducted according to the manufacturer’s instructions.
Primay OBs isolation and cell culture
Primary OBs were isolated from the skulls of newly born (72 h) SD rats. The standardized extraction procedure of primary OBs was carried as previously described [21, 22]. The cells were collected and dissolved in DME/F-12 1:1 culture medium (HyClone) supplemented with 10% foetal bovine serum (Excel), penicillin-streptomycin mixed liquor (Solarbio) and incubated in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. The third-generation OBs were used in follow-up studies.
ALP staining assay
Primary OBs were cultured in 24-well plates at a density of 1*104 cells per well. After an initial 24 h period in growth medium (time 0), cells were treated with vehicle alone, ALA (Sigma) (1 μM, 10 μM, or 100 μM) or PA (Sigma) 0.2 mM or (PA 0.2 mM + ALA 1 μM) or (PA 0.2 mM + ALA 10 μM) or (PA 0.2 mM + ALA 100 μM). On the fifth day of culture, cells were stained with the ALP reagent kit (Genmed, Shanghai, China) according to the manufacturer’s protocol. The absorbance was measured at a wavelength of 520 nm according to the manufacturer’s protocol.
Real-time quantitative PCR (RT-qPCR)
Primary OBs were treated with vehicle alone, ALA (1 μM, 10 μM, or 100 μM) or PA 0.2 mM or (PA 0.2 mM + ALA 1 μM) or (PA 0.2 mM + ALA 10 μM) or (PA 0.2 mM + ALA 100 μM) for 3 days. Total RNA was extracted from OBs using TRIzol (Takara Biotech, Dalian, China) according to the manufacturer’s protocol. cDNA was obtained from 1 μg of total RNA, and RT-qPCR was carried out using the SYBR Green PCR Master Mix reagent kit (Takara Biotech, Dalian, China). The primer sequences used are listed in Table 2. PCR products were subjected to a melting curve analysis, and the relative expression was calculated for each gene by the 2-∆∆CT method, using β-actin for normalization. β-Catenin, RUNX2, and osterix mRNA (Takara Biotech, Dalian, China) expression levels were examined on day 3 after different treatments. Each sample was measured at least in triplicate.
Table 2.
Primer sequences used for the determination of gene expression
Gene (Rats) |
Primer sequence((5′ - 3′) | Product bp |
---|---|---|
β-catenin | Forward CATCACCACGCTGCATAATC | 156 |
Reverse GAGCTTGCTTTCCTGATTGC | ||
RUNX2 | Forward CATGGCCGGGAATGATGAG | 148 |
Reverse TGTGAAGACCGTTATGGTCAAAGTG | ||
os0074erix | Forward CACCCATTGCCAGTAATCTTCGT | 97 |
Reverse GGACTGGAGCCATAGTGAGCTTCT | ||
β-actin | Forward ACCCAGATCATGTTTGAGAC | 99 |
Reverse GTCAGGATCTTCATGAGGTAGT |
β-catenin, catenin beta1; RUNX2, runt-related transcription factor 2; osterix, Sp7 transcription factor; β-actin, actin, beta
Western blot analysis
Primary OBs were treated with vehicle alone, ALA (1 μM, 10 μM, or 100 μM) or PA 0.2 mM or (PA 0.2 mM + ALA 1 μM) or (PA 0.2 mM + ALA 10 μM) or (PA 0.2 mM + ALA 100 μM) for 3 days. OBs were scraped from the culture dish and washed twice with ice-cold PBS. Total protein was extracted from the cell pellet using RIPA lysis buffer (Shenergy Biocolor Bioscience & Technology Co, Shanghai, China) according to the manufacturer’s protocol. Protein concentrations were quantified using a BCA protein quantitative assay kit (Shenergy Biocolor Bioscience & Technology Co, Shanghai, China). The total proteins were separated by 10% SDS-PAGE and transferred to a 0.45-μm PVDF membrane (Millipore, Billerica, MA, USA). The membrane was incubated at room temperature in a blocking solution of 5% skimmed milk powder dissolved in TBST containing 0.05% Tween for 1 h, followed by incubation with the primary antibodies overnight at 4 °C. The membrane was washed three times in TBST (10 min each wash) and incubated with horseradish peroxidase-conjugated anti-rabbit (Abcam, ab136817) or anti-mouse (Abcam, ab136815) IgG secondary antibody at a 1:5000 dilution in the blocking solution. The blots were exposed to enhanced chemiluminescence (Pierce, Rockford, IL, USA). The antibodies used in this study included mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody at a 1:1000 dilution (Sigma-Aldrich A5441), rabbit β-catenin antibody at a 1:1000 dilution (Cell Signaling Technology, #9562), mouse RUNX2 antibody at a 1:500 dilution (Cell Signaling Technology,8486 s), and rabbit osterix antibody at a 1:500 dilution (Abcam, ab209484). The relative target protein levels were normalized to GAPDH in the same membrane.
Statistical analysis
Data were analysed by SPSS 18.0 software and were expressed as the mean ± standard deviation (SD). Means were compared using unpaired Student’s t-tests for comparisons between two groups and one-way ANOVA (Sidak’s multiple comparisons test) for comparisons among multiple groups. A two-tailed P value < 0.05 was considered significant.
Results
FO improved bone biomechanical properties in HFD-induced bone damage
The results of the three-point bending test in the femur samples showed that the biomechanical properties, such as the maximum load (p = 0.0012), maximum fracture load (p = 0.0004), ultimate tensile strength (p = 0.0242), stiffness (p = 0.0138), energy absorption (p = 0.0429), and elastic modulus (p = 0.0112), were decreased in the HFD group compared with the NC group after four different diets for 22 weeks. The maximum load (p = 0.0467), maximum fracture load (p = 0.0192), and ultimate tensile strength (p = 0.0264) were significantly enhanced in the HY group compared with the HFD group, but the stiffness, energy absorption, and elastic modulus showed no significant differences between the HY group and the HFD group. Moreover, compared with the NC group, the NY group had no difference in the above indicators (Fig. 1a-f).
Fig. 1.
The effect of FO on bone biomechanical properties. (a) The maximum load of the bone before crushing. (b) Maximum fracture load of the bone crushing. (c) Ultimate tensile strength of the bone before brittle fracture. (d) Stiffness, the slope of the linear region. (e) Energy absorption, AUC of the load multiplied by the displacement. (f) Elastic modulus, maximum slope of the stress-strain curve. Data represent the mean ± SD (n = 8). **P < 0.01, *P < 0.05 versus the NC group and ## P < 0.01, # p < 0.05 versus the HFD group by one-way ANOVA
FO ameliorated trabecular bone damage in HFD-induced bone loss
Consistent with the results of the three-point bending test, the trabecular volume bone mineral density (Tb. vBMD) (p = 0.0011), trabecular bone volume/total volume (Tb. BV/TV) (p = 0.0161), trabecular number (Tb. N) (p = 0.0042), and trabecular thickness (Tb. Th) (p = 0.0087) were decreased and the trabecular separation (Tb. Sp) (p = 0.0009) and structure model index (SMI) (p = 0.0348) were increased in the HFD group compared with the NC group after four different diet treatments for 22 weeks, and all of the above parameters (Tb. vBMD, p = 0.0141) (Tb. BV/TV, p = 0.0468) (Tb. N, p = 0.0288) (Tb. Th, p = 0.0035) (Tb. Sp, p = 0.0180) (SMI, p = 0.0182) were markedly improved in the rats of the HY group compared to the HFD group. However, compared with the NC group, the NY group had no difference in the above indicators (Fig. 2a, e-j). Meanwhile, the cortical volume bone mineral density (Ct. vBMD), cortical bone volume/total volume (Ct. BV/TV) and cortical bone thickness (Ct. Th) had no significant differences among the four groups (Fig. 2a-d).
Fig. 2.
The effect of FO on bone structural characteristics by microCT. (a) Representative 2D and 3D images of microCT reconstruction of distal femurs. Scale bar, 500 μm. (b-d) MicroCT analysis of cortical bone parameters: Ct. vBMD, cortical volumetric bone mineral density; Ct. BV/TV, cortical bone volume/total volume; Ct. Th, cortical bone thickness. (e-J) MicroCT analysis of trabecular bone parameters: Tb. vBMD, trabecular volumetric bone mineral density; Tb. BV/TV, trabecular bone volume/total volume; Tb. Th, trabecular thickness; Tb. N, trabecular number; Tb. Sp, trabecular separation; SMI, structure model index. The results are shown as the mean ± SD (n = 6). **P < 0.01, *P < 0.05 versus the NC group and ## P < 0.01, # p < 0.05 versus the HFD group by one-way ANOVA
FO changed the trabecular number and the number of adipocytes
The results of HE staining in the right tibia samples showed that the trabecular number was decreased in the HFD group compared with the NC group (p = 0.0027), while the HY group markedly increased the trabecular number compared with the HFD group (p = 0.0408) (Fig. 3a-b). We also found that the number of adipocytes in the HFD group was increased compared with the NC group (p < 0.0001), while it was dramatically decreased in the HY group compared with the HFD group (p = 0.0093) (Fig. 3a and c). Similarly, there were no significant differences between the NC and NY groups (Fig. 3a-c).
Fig. 3.
H&E staining to observe the trabecular number and number of adipocytes from rat tibial sections. (a) Representative images are shown. Scale bar, 100 μm. The black arrows indicate the trabecular bone structure. The red arrows represent adipocytes. (b) The trabecular number (N. trabecular) per square millimetre was evaluated (n = 5). (c) The number of adipocytes (N. adipocytes) per square millimetre was evaluated (n = 5). **P < 0.01, *P < 0.05 versus the NC group and ## P < 0.01, # p < 0.05 versus the HFD group by one-way ANOVA
FO increased bone formation markers and decreased bone resorption markers in the HY group compared with the HFD group
In contrast, the serum levels of the bone formation markers ALP and P1NP were lower in the HFD group than those in the NC group (p = 0.0006, 0.0039) and significantly higher in the HY group compared with those in the HFD group (p = 0.0426, 0.0057) (Fig. 4a-b). In contrast, the serum levels of CTX-1, a marker for bone resorption, were elevated in the HFD group compared with levels in the NC group (p = 0.0023) and were significantly reduced in the HY group compared with those in the HFD group (p = 0.0028) (Fig. 4c). However, compared with the NC group, the NY group had no difference in the above indicators (Fig. 4a-c).
Fig. 4.
The effect of FO on bone formation markers and bone resorption marker. (a-b) bone formation markers: ALP, alkaline phosphatase; P1NP, procollagen type I N-terminal propeptide. (c) bone resorption marker: CTX-1, C-telopeptide of type 1 collagen. Data are expressed as the mean ± SD (n = 8). **P < 0.01, *P < 0.05 versus the NC group and ## P < 0.01, # p < 0.05 versus the HFD group by one-way ANOVA
ALA dose-dependently restored the inhibition of ALP activity induced by PA
The effects of ALA on ALP activity were also assessed. As shown in Fig. 5a and c, the alteration of ALP activity was not observed in cells with ALA compared with the vehicle control group after 5 days of incubation with different concentrations of ALA. However, ALP activity was significantly decreased after 5 days of PA treatment (0.2 mM) compared with the vehicle control group (p < 0.0001), and ALA dose-dependently restored the inhibition of ALP activity induced by PA (PA0.2 mM + ALA1 μM versus PA 0.2 mM, p = 0.0177; PA0.2 mM + ALA10 μM versus PA 0.2 mM, p < 0.0001;PA0.2 mM + ALA100 μM versus PA 0.2 mM, p < 0.0001) (Fig. 5b and d).
Fig. 5.
ALP staining in primary OBs. (a) OBs were grown for 5 days in the indicated medium (con group contained 0.1% ethanol, ALA 1 μM, ALA 10 μM, ALA 100 μM). (b) OBs were grown for 5 days in the indicated medium (con group contained 0.1% ethanol and 2.4% BSA, PA 0.2 mM, PA 0.2 mM + ALA 1 μM, PA 0.2 mM + ALA 10 μM, PA 0.2 mM + ALA 100 μM). (c-d) ALP activity quantification was measured after different treatments. Data are shown as the mean ± SD (n = 3). **p < 0.01 versus vehicle treatment (con). ## p < 0.01 # p < 0.05 versus (PA 0.2 mM) treatment by one-way ANOVA
ALA promoted osteogenic gene (β-catenin, RUNX2, and osterix) expression and dose-dependently restored the inhibition of PA
To determine whether ALA could promote osteogenic-related gene expression, osteogenic-specific genes, including β-catenin, RUNX2, and osterix were examined in primary OBs. RT-qPCR analysis revealed that OBs treated with ALA showed higher gene expression with the vehicle group (Fig. 6a-c). Meanwhile, we observed the expression of osteogenic genes after PA treatment for 3 days. Consistent with ALP staining, significant decreases in osteogenic relative gene expression were observed (all p < 0.0001), and ALA can mitigate the decreases in osteogenic relative gene expression induced by PA in a concentration-dependent manner (all p < 0.01) (Fig. 6d-f).
Fig. 6.
The effect of ALA on osteogenic-related gene expression. RT-qPCR of β-catenin (a, d), Runx2 (b, e) and osterix (c, f) expression in primary OBs subjected to different treatments. Data are expressed as the mean ± SD from three independent experiments. ** p < 0.01, * p < 0.05 versus the vehicle treatment (con) in Fig. 6a-c. ## p < 0.01, # p < 0.05 versus the vehicle treatment (con) in Fig. 6d-f, && p < 0.01 & p < 0.05 versus PA 0.2 mM treatment in Fig. 6d-f by one-way ANOVA
ALA promoted osteogenic protein (β-catenin, RUNX2, and osterix) expression and dose-dependently restored the inhibition of protein expression induced by PA
Osteogenic-specific proteins, including β-catenin, RUNX2, and osterix, were also examined. Consistent with the RT-qPCR results, western blot analysis revealed that ALA upregulated osteogenic protein expression compared with the vehicle group (Fig. 7a and c-e). β-Catenin, RUNX2, and osterix were significantly decreased after 3 days of PA treatment (all p < 0.0001), and ALA dose-dependently restored the inhibition of osteogenic-specific proteins induced by PA (Fig. 7b and f-h).
Fig. 7.
The effect of ALA on osteogenic-related protein expression. (a-b) Western blot bands of β-catenin, RUNX2, osterix and GAPDH proteins in primary OBs subjected to different treatments. (c-h) Western blotting analysis of β-catenin, RUNX2 and osterix protein. Values were quantified by densitometry and normalized to GAPDH. Data are expressed as the mean ± SD from three independent experiments. ** p < 0.01, * p < 0.05 versus the vehicle treatment (con) in Fig. 7c-e. ## p < 0.01, # p < 0.05 versus the vehicle treatment (con) in Fig. 7f-h, && p < 0.01, & p < 0.05 versus PA 0.2 mM treatment in Fig. 7f-h by one-way ANOVA
Discussion
The major finding of this study was that FO alleviated bone loss in HFD rats. Meanwhile, ALA can promote primary osteoblastic function through increasing β-catenin/RUNX2/osterix genes and proteins expression and restoring PA induced ALP activity decreases.
Generally, osteoporosis had been considered to be a female disease. However, a recent study indicated that abdominal fat was also an osteoporosis alarm for men [23]. Another study indicated that males were more sensitive to diet and benefited from a healthy diet [24]. Obesity induced by HFD aggravated bone loss in the cancellous bone compartment, with a greater loss in males than females [25]. Our current study also focused on male rats, and trabecular bone loss was observed in HFD induced male SD rats.
The bone loss induced by HFD was attenuated by treatment with FO, as shown by micro-CT, three-point bending test and bone histology analysis.
Lipid metabolic disorder has been demonstrated to be detrimental to various organs and was associated with many diseases, such as type 2 diabetes, obesity [26],non-alcoholic fatty liver disease, cardiomyopathy [27], chronic kidney disease [28] and endothelial cell dysfunction [29]. Recent studies have indicated that overnutrition-induced metabolic disturbance could be a possible pathogenic factor in bone metabolism dysfunction, revealing the bone to be another victim of “lipotoxicity”. Cao et al. found that HFD decreased cancellous bone mass but had no effect on cortical bone mass in the tibia in mice [30], which was consistent with our study. Our unpublished data indicated that bone mineral density (BMD) was not significantly different among the four groups after four different diet treatments for 22 weeks by dual-energy X-ray. Combined with the microCT results, we inferred that the effect of HFD on trabecular bone was earlier than that on cortical bone.
Jason A. Inzana et al. showed that immature mice were more susceptible to the detrimental effects of HFD on cancellous bone in the distal femur, which increased the evidence of excess dietary fat as a possible pathologic factor of bone damage [31]. In our study, we observed SD rats starting from week 4 to week 27 and given different dietary interventions for 22 weeks, which was equivalent to the critical period of bone metabolism changes from early childhood to adulthood in humans [32]. Consistent with previous reported studies, we discovered that HFD reduced cancellous bone function in male growth-stage SD rats. However, there were no differences, including serological markers, bone biomechanics, microCT structure and bone histology, between the NC group and the NY group. The reason for this is that bone metabolism is in equilibrium when consuming a normal diet, but ALA only works when bone metabolism is imbalanced.
Bone metabolism depends on the dynamic balance between the osteogenesis of OBs and bone resorption by osteoclasts (OCs). At present, research on the bone protection of ALA is uncertain. Most studies indicated that the protective effect of ALA on bone metabolism was through inhibition of OCs [33, 34], and there were no studies on primary OBs. Recent studies indicated that the canonical Wnt/β-Catenin pathway affected BMSC osteogenic differentiation [35]. Wnt signalling can promote osteoblastic precursor differentiation into more differentiated OBs and can serve as a negative regulator of adipogenesis [36]. This differentiation process was tightly regulated by complex signalling events. β-Catenin is a key signalling molecule that promotes cell differentiation [37]. While many signals were convergent in OBs, the reduction of β-catenin led to osteopenia [38]. Our results showed that ALA dramatically promoted β-catenin gene and protein expression in OBs, which suggested that ALA may promote osteogenic differentiation through the Wnt pathway.
Osteogenesis generally involves three major phases: proliferation, extracellular matrix formation and mineralization, which are regulated by a diverse set of key factors, such as transcription factors, growth factors, hormones and signalling pathways [39]. RUNX2 was known as a specific regulator in osteoblastic differentiation at the whole stage, thus activating the expression of osteogenic-related genes [40]. Furthermore, recent studies have indicated that RUNX2 functions more as a promoter than as a transcription factor, acting as a transcriptional activator or repressor [41]. Osterix is another transcription factor for osteoblastic differentiation and bone formation. Osterix plays an important role in osteoblastic differentiation following RUNX2-mediated mesenchymal condensation [42]. Our study showed that ALA promoted the expression of the osteogenic transcription factors RUNX2 and osterix. PA inhibited the expression of RUNX2 and osterix, and ALA reversed the inhibitory effect of PA in a concentration-dependent manner. However, Casado-Diaz et al. showed that unsaturated fatty acids cannot reverse the inhibitory effect of omega-6 on osteogenesis [43]. The above study was inconsistent with the results of this study because of the different types of cells, intervention time, and application of omega-3 types.
ALP activity reflected the early function of OBs. Treating primary OBs using ALA alone did not change ALP activity significantly. However, when PA and ALA were simultaneously used to stimulate OBs, ALA restored the inhibition induced by PA in a concentration-dependent manner. Similarly, cell experiments also confirmed that under normal conditions, in OBs treated with ALA, only osteogenic gene and protein expression levels were increased, while no ALP activity change was observed. ALA affected the early function of OBs only when OBs were in a state of inhibition.
There were three limitations in this study. One limitation was that the present study was conducted in a rodent model and not in humans. Another limitation was that the mechanism of ALA promoting osteogenesis was explored only from the cellular side, and no in vivo experiments were conducted to investigate the mechanism. The third limitation was that two rats were placed in one cage, and diet intake was not able to be measured. Additionally, the body weight changes were not measured, although the diet intake and body weight changes might be important factors related to bone health. In the next step, we will conduct in vivo experiments to further elucidate the protective mechanism of ALA in alleviating bone damage induced by HFD and provide a theoretical basis for the clinical treatment of bone damage caused by HFD.
Conclusions
In the present study, our main finding was that FO alleviated bone loss in HFD rats, probably by promoting osteoblastic β-catenin/RUNX2/osterix gene and protein expression and restoring PA-induced ALP activity decreases. These findings indicated that FO might be a potential therapeutic agent for HFD-induced bone loss, most likely by promoting osteogenesis.
Acknowledgements
We thank our colleagues for their assistance, the Tianjin Bone Research Institute for the three-point bend test, and Shanghai Sixth People’s Hospital for the microCT test.
Abbreviations
- ALA
α-linolenic acid
- ALP
Alkaline phosphatase
- CTX-1
C-telopeptide of type 1 collagen
- DHA
Docosahexaenoic acid
- EPA
Eicosapentaenoic acid
- FO
Flaxseed oil
- GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
- HFD
High-fat diet
- HY
High-fat diet containing 10% flaxseed oil
- NC
Normal control diet
- NY
Flaxseed oil diet
- OB
Osteoblast
- OC
Osteoclast
- osterix
Sp7 transcription factor
- P1NP
Procollagen type I N-terminal propeptide
- PA
Palmitic acid; β-catenin: catenin beta1
- RT-qPCR
Real-time quantitative polymerase chain reaction
- RUNX2
Runt-related transcription factor 2
- WB
Western blot
- β-actin
Actin, beta
- ω-3 FA
Omega-3 unsaturated fatty acid
Authors’ contributions
JX, FC and YW designed the study. FC, YW and ZH performed the experiments. Data analyses ZD, HW and MZ analyzed data. Technical assistance was performed SS and CY provided technical assistance.FC wroted the manuscript and JX corrected the manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by the National Natural Science Foundation of China [grant numbers: 81370892 and 81400788], the Key research anddevelopment projection of Shandong province [grant numbers: 2016GSF201025, and 2016GGH3118], the Taishan Scholar Construction Project Special Funding [grant number: TS201712092], and the Medical and Health Technology Development Project of Shandong province [grant numbers: 2017WS704 and 2017WS718].
Availability of data and materials
All data generated or analysed during this study are included in this published article or are available from the corresponding author on reasonable request.
Ethics approval
The animal experimental protocol was approved by the Animal Ethics Committee of Shandong Provincial Hospital affiliated with Shandong University (Jinan, China).
Consent for publication
All authors support the submission to this journal.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Fulian Chen, Email: 521029400@qq.com, Email: chenfulian55@163.com.
Yan Wang, Email: 8482487@163.com.
Hongwei Wang, Email: wanghongwei1985@yeah.net.
Zhenhua Dong, Email: 327515203@qq.com.
Yan Wang, Email: joney123@126.com.
Mengqi Zhang, Email: m15064049292@163.com.
Jiaxuan Li, Email: lijx0213@163.com.
Shanshan Shao, Email: shaoshanshan11@126.com.
Chunxiao Yu, Email: yuchx@163.com.
Zhikun Huan, Email: fang199412@hotmail.com.
Jin Xu, Email: xujin267903@163.com.
References
- 1.Yedavally-Yellayi S, Ho AM, Patalinghug EM. Update on osteoporosis. Prim Care. 2019;46:175–190. doi: 10.1016/j.pop.2018.10.014. [DOI] [PubMed] [Google Scholar]
- 2.Tian Li, Yu Xijie. Fat, Sugar, and Bone Health: A Complex Relationship. Nutrients. 2017;9(5):506. doi: 10.3390/nu9050506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Tomlinson David, Erskine Robert, Morse Christopher, Onambélé Gladys. Body Fat Percentage, Body Mass Index, Fat Mass Index and the Ageing Bone: Their Singular and Combined Roles Linked to Physical Activity and Diet. Nutrients. 2019;11(1):195. doi: 10.3390/nu11010195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Devlin MJ, Robbins A, Cosman MN, Moursi CA, Cloutier AM, Louis L, Van Vliet M, Conlon C, Bouxsein ML. Differential effects of high fat diet and diet-induced obesity on skeletal acquisition in female C57BL/6J vs. FVB/NJ Mice Bone Rep. 2018;8:204–214. doi: 10.1016/j.bonr.2018.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Picke AK, Sylow L, Moller LLV, Kjobsted R, Schmidt FN, Steejn MW, Salbach-Hirsch J, Hofbauer C, Bluher M, Saalbach A, et al. Differential effects of high-fat diet and exercise training on bone and energy metabolism. Bone. 2018;116:120–134. doi: 10.1016/j.bone.2018.07.015. [DOI] [PubMed] [Google Scholar]
- 6.Alsahli A, Kiefhaber K, Gold T, Muluke M, Jiang H, Cremers S, Schulze-Spate U. Palmitic acid reduces circulating bone formation markers in obese animals and impairs osteoblast activity via C16-ceramide accumulation. Calcif Tissue Int. 2016;98:511–519. doi: 10.1007/s00223-015-0097-z. [DOI] [PubMed] [Google Scholar]
- 7.Rodrigues CF, Salgueiro W, Bianchini M, Veit JC, Puntel RL, Emanuelli T, Dernadin CC, Avila DS: Salvia hispanica L. (chia) seeds oil extracts reduce lipid accumulation and produce stress resistance in Caenorhabditis elegans. Nutr Metab (Lond) 2018, 15:83. [DOI] [PMC free article] [PubMed]
- 8.Abdelhamid AS, Martin N, Bridges C, Brainard JS, Wang X, Brown TJ, Hanson S, Jimoh OF, Ajabnoor SM, Deane KH, et al. Polyunsaturated fatty acids for the primary and secondary prevention of cardiovascular disease. Cochrane Database Syst Rev. 2018;7 Cd012345. [DOI] [PMC free article] [PubMed]
- 9.Montes Chañi Evelyn, Pacheco Sandaly, Martínez Gustavo, Freitas Maykon, Ivona Joaquin, Ivona Javier, Craig Winston, Pacheco Fabio. Long-Term Dietary Intake of Chia Seed Is Associated with Increased Bone Mineral Content and Improved Hepatic and Intestinal Morphology in Sprague-Dawley Rats. Nutrients. 2018;10(7):922. doi: 10.3390/nu10070922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Saini RK, Keum YS. Omega-3 and omega-6 polyunsaturated fatty acids: dietary sources, metabolism, and significance - a review. Life Sci. 2018;203:255–267. doi: 10.1016/j.lfs.2018.04.049. [DOI] [PubMed] [Google Scholar]
- 11.Lavado-Garcia J, Roncero-Martin R, Moran JM, Pedrera-Canal M, Aliaga I, Leal-Hernandez O, Rico-Martin S, Canal-Macias ML. Long-chain omega-3 polyunsaturated fatty acid dietary intake is positively associated with bone mineral density in normal and osteopenic Spanish women. PLoS One. 2018;13:e0190539. doi: 10.1371/journal.pone.0190539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wauquier F, Barquissau V, Leotoing L, Davicco MJ, Lebecque P, Mercier S, Philippe C, Miot-Noirault E, Chardigny JM, Morio B, et al. Borage and fish oils lifelong supplementation decreases inflammation and improves bone health in a murine model of senile osteoporosis. Bone. 2012;50:553–561. doi: 10.1016/j.bone.2011.05.030. [DOI] [PubMed] [Google Scholar]
- 13.Azuma MM, Gomes-Filho JE, Ervolino E, Pipa CB, Cardoso CBM, Andrada AC, Kawai T, Cintra LTA. Omega 3 fatty acids reduce bone resorption while promoting bone generation in rat apical periodontitis. J Endod. 2017;43:970–976. doi: 10.1016/j.joen.2017.01.006. [DOI] [PubMed] [Google Scholar]
- 14.Nakanishi A, Iitsuka N, Tsukamoto I. Fish oil suppresses bone resorption by inhibiting osteoclastogenesis through decreased expression of M-CSF, PU.1, MITF and RANK in ovariectomized rats. Mol Med Rep. 2013;7:1896–1903. doi: 10.3892/mmr.2013.1446. [DOI] [PubMed] [Google Scholar]
- 15.Mirfatahi M, Imani H, Tabibi H, Nasrollahi A, Hedayati M. effects of flaxseed oil on serum bone turnover markers in in hemodialysis patients a randomized controlled trial. Iranian Journal of Kidney Diseases. 2018;12:215–222. [PubMed] [Google Scholar]
- 16.Ribeiro DC, Pereira AD, de Santana FC, Mancini-Filho J, da Silva EM, da Costa CA, Boaventura GT. Incorporation of flaxseed flour as a dietary source for ALA increases bone density and strength in post-partum female rats. Lipids. 2017;52:327–333. doi: 10.1007/s11745-017-4245-2. [DOI] [PubMed] [Google Scholar]
- 17.Longo Amanda, Ward Wendy. Providing Flaxseed Oil but Not Menhaden Oil Protects against OVX Induced Bone Loss in the Mandible of Sprague-Dawley Rats. Nutrients. 2016;8(10):597. doi: 10.3390/nu8100597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Cohen SL, Ward WE. Flaxseed oil and bone development in growing male and female mice. J Toxicol Environ Health A. 2005;68:1861–1870. doi: 10.1080/15287390500226516. [DOI] [PubMed] [Google Scholar]
- 19.Longo Amanda B., Sullivan Philip J., Peters Sandra J., LeBlanc Paul J., Wohl Gregory R., Ward Wendy E. Lifelong intake of flaxseed or menhaden oil to provide varying n-6 to n-3 PUFA ratios modulate bone microarchitecture during growth, but not after OVX in Sprague-Dawley rats. Molecular Nutrition & Food Research. 2017;61(8):1600947. doi: 10.1002/mnfr.201600947. [DOI] [PubMed] [Google Scholar]
- 20.Turner CH, Burr DB. <basic biomechanical measurements of bone>. Bone. 1993;14:595–608. doi: 10.1016/8756-3282(93)90081-K. [DOI] [PubMed] [Google Scholar]
- 21.Yi XJ, Li JC, Wang SY, Yan MY, Cui J, Pei LP. effect of Aralia echinocaulis containing serum on Wnt/beta-catenin signaling pathway of primary osteoblast. Zhongguo Zhong Yao Za Zhi. 2017;42:2749–2753. doi: 10.19540/j.cnki.cjcmm.20170609.004. [DOI] [PubMed] [Google Scholar]
- 22.Liang D, Wang KJ, Tang ZQ, Liu RH, Zeng F, Cheng MY, Lian QS, Wu HK. Effects of nicotine on the metabolism and gene expression profile of SpragueDawley rat primary osteoblasts. Mol Med Rep. 2018;17:8269–8281. doi: 10.3892/mmr.2018.8884. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bredella MA, Lin E, Gerweck AV, Landa MG, Thomas BJ, Torriani M, Bouxsein ML, Miller KK. Determinants of bone microarchitecture and mechanical properties in obese men. J Clin Endocrinol Metab. 2012;97:4115–4122. doi: 10.1210/jc.2012-2246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Aslam MN, Jepsen KJ, Khoury B, Graf KH, Varani J. Bone structure and function in male C57BL/6 mice: effects of a high-fat Western-style diet with or without trace minerals. Bone Rep. 2016;5:141–149. doi: 10.1016/j.bonr.2016.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gautam J, Choudhary D, Khedgikar V, Kushwaha P, Singh RS, Singh D, Tiwari S, Trivedi R. Micro-architectural changes in cancellous bone differ in female and male C57BL/6 mice with high-fat diet-induced low bone mineral density. Br J Nutr. 2014;111:1811–1821. doi: 10.1017/S0007114514000051. [DOI] [PubMed] [Google Scholar]
- 26.Shimano H. Novel qualitative aspects of tissue fatty acids related to metabolic regulation: lessons from Elovl6 knockout. Prog Lipid Res. 2012;51:267–271. doi: 10.1016/j.plipres.2011.12.004. [DOI] [PubMed] [Google Scholar]
- 27.Ussher JR. The role of cardiac lipotoxicity in the pathogenesis of diabetic cardiomyopathy. Expert Rev Cardiovasc Ther. 2014;12:345–358. doi: 10.1586/14779072.2014.891939. [DOI] [PubMed] [Google Scholar]
- 28.Guebre-Egziabher F, Alix PM, Koppe L, Pelletier CC, Kalbacher E, Fouque D, Soulage CO. Ectopic lipid accumulation: a potential cause for metabolic disturbances and a contributor to the alteration of kidney function. Biochimie. 2013;95:1971–1979. doi: 10.1016/j.biochi.2013.07.017. [DOI] [PubMed] [Google Scholar]
- 29.Symons JD, Abel ED. Lipotoxicity contributes to endothelial dysfunction: a focus on the contribution from ceramide. Rev Endocr Metab Disord. 2013;14:59–68. doi: 10.1007/s11154-012-9235-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cao JJ, Gregoire BR, Gao H. High-fat diet decreases cancellous bone mass but has no effect on cortical bone mass in the tibia in mice. Bone. 2009;44:1097–1104. doi: 10.1016/j.bone.2009.02.017. [DOI] [PubMed] [Google Scholar]
- 31.Inzana JA, Kung M, Shu L, Hamada D, Xing LP, Zuscik MJ, Awad HA, Mooney RA. Immature mice are more susceptible to the detrimental effects of high fat diet on cancellous bone in the distal femur. Bone. 2013;57:174–183. doi: 10.1016/j.bone.2013.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Cherukupalli K, Larson JE, Puterman M, Sekhon HS, Thurlbeck WM. Comparative biochemistry of gestational and postnatal lung growth and development in the rat and human. Pediatr Pulmonol. 1997;24:12–21. doi: 10.1002/(SICI)1099-0496(199707)24:1<12::AID-PPUL3>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
- 33.Song J, Jing Z, Hu W, Yu J, Cui X. α-linolenic acid inhibits receptor activator of NF-κB ligand induced (RANKL-induced) Osteoclastogenesis and prevents inflammatory bone loss via downregulation of nuclear factor-KappaB-inducible nitric oxide synthases (NF-κB-iNOS) signaling pathways. Med Sci Monit. 2017;23:5056–5069. doi: 10.12659/MSM.904795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Nakanishi A, Tsukamoto I. n-3 polyunsaturated fatty acids stimulate osteoclastogenesis through PPARgamma-mediated enhancement of c-Fos expression, and suppress osteoclastogenesis through PPARgamma-dependent inhibition of NFkB activation. J Nutr Biochem. 2015;26:1317–1327. doi: 10.1016/j.jnutbio.2015.06.007. [DOI] [PubMed] [Google Scholar]
- 35.Kubota T, Michigami T, Ozono K. Wnt signaling in bone metabolism. J Bone Miner Metab. 2009;27:265–271. doi: 10.1007/s00774-009-0064-8. [DOI] [PubMed] [Google Scholar]
- 36.Meng J, Ma X, Wang N, Jia M, Bi L, Wang Y, Li M, Zhang H, Xue X, Hou Z, et al. Activation of GLP-1 receptor promotes bone marrow stromal cell osteogenic differentiation through beta-catenin. Stem Cell Reports. 2016;6:579–591. doi: 10.1016/j.stemcr.2016.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Krishnan V, Bryant HU, Macdougald OA. Regulation of bone mass by Wnt signaling. J Clin Invest. 2006;116:1202–1209. doi: 10.1172/JCI28551. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Holmen SL, Zylstra CR, Mukherjee A, Sigler RE, Faugere MC, Bouxsein ML, Deng L, Clemens TL, Williams BO. Essential role of beta-catenin in postnatal bone acquisition. J Biol Chem. 2005;280:21162–21168. doi: 10.1074/jbc.M501900200. [DOI] [PubMed] [Google Scholar]
- 39.Bruderer M, Richards RG, MAaMJ S, ARI D, Platz D. Switzerland: ROLE AND REGULATION OF RUNX2 IN OSTEOGENESIS. European Cells and Materials. 2014;28:269–286. doi: 10.22203/eCM.v028a19. [DOI] [PubMed] [Google Scholar]
- 40.Franceschi RT, Xiao G. Regulation of the osteoblast-specific transcription factor, Runx2: responsiveness to multiple signal transduction pathways. J Cell Biochem. 2003;88:446–454. doi: 10.1002/jcb.10369. [DOI] [PubMed] [Google Scholar]
- 41.Chen Y, Hu Y, Yang L, Zhou J, Tang Y, Zheng L, Qin P. Runx2 alleviates high glucose-suppressed osteogenic differentiation via PI3K/AKT/GSK3beta/beta-catenin pathway. Cell Biol Int. 2017;41:822–832. doi: 10.1002/cbin.10779. [DOI] [PubMed] [Google Scholar]
- 42.Lee DS, Roh SY, Park JC. The Nfic-osterix pathway regulates ameloblast differentiation and enamel formation. Cell Tissue Res. 2018;374:531–540. doi: 10.1007/s00441-018-2901-3. [DOI] [PubMed] [Google Scholar]
- 43.Casado-Diaz A, Ferreiro-Vera C, Priego-Capote F, Dorado G, Luque-de-Castro MD, Quesada-Gomez JM. Effects of arachidonic acid on the concentration of hydroxyeicosatetraenoic acids in culture media of mesenchymal stromal cells differentiating into adipocytes or osteoblasts. Genes Nutr. 2014;9:375. doi: 10.1007/s12263-013-0375-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analysed during this study are included in this published article or are available from the corresponding author on reasonable request.