Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Apr 7.
Published in final edited form as: Cell Host Microbe. 2019 Aug 14;26(2):297. doi: 10.1016/j.chom.2019.07.015

Redondoviridae, a Family of Small, Circular DNA Viruses of the Human Oro-Respiratory Tract Associated with Periodontitis and Critical Illness

Arwa A Abbas, Louis J Taylor, Marisol I Dothard, Jacob S Leiby, Ayannah S Fitzgerald, Layla A Khatib, Ronald G Collman *, Frederic D Bushman *
PMCID: PMC6800031  NIHMSID: NIHMS1048651  PMID: 31415757

In Table S1 of this article as originally published, the wrong sequence was mistakenly included for the pan-HCRV-AA qPCR assay probe during assembly of the table. The table has now been updated with the correct sequence (AAATGGAAGGGAGAGAGGCCTTTGG). This error does not alter the conclusions of the original paper. The authors apologize for any confusion or inconvenience this error may have caused.

RESOURCES