The authors wish to make the following corrections to this paper [1]: In Table A2, of the Appendix, in line 4 of page 14, for the primer of the hpo-miR396b stem-loop RT sequence “GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAAGA” the bold part should be changed to “AAGTTC”.
The authors would like to apologize for any inconvenience caused to the readers by these changes. The changes do not affect the scientific results.
Conflicts of Interest
The authors declare no conflict of interest.
Reference
- 1.Li A.-L., Wen Z., Yang K., Wen X.-P. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus) Int. J. Mol. Sci. 2019;20:2501. doi: 10.3390/ijms20102501. [DOI] [PMC free article] [PubMed] [Google Scholar]