Mast Cell CRF₂ Suppresses Mast Cell Degranulation and Limits the Severity of Anaphylaxis and Stress-Induced Intestinal Permeability

Abstract

Background:

Psychological stress and heightened MC activation are linked with important Immunological disorders including allergy, anaphylaxis, asthma, and functional bowel diseases, but the mechanisms remain poorly defined. We have previously demonstrated that activation of the corticotropin releasing factor (CRF) system potentiates MC degranulation responses during IgE-mediated anaphylaxis and psychological stress, via CRF receptor subtype 1 (CRF₁) expressed on MCs.

Objective:

In this study, we investigated the role of CRF receptor subtype 2 (CRF₂) as a modulator of stress-induced MC degranulation and associated disease pathophysiology.

Methods:

In vitro MC degranulation assays were performed with bone marrow derived MCs (BMMCs) derived from WT and CRF₂-deficient (CRF₂^−/−) mice and RBL-2H3 MCs transfected with CRF₂-overexpressing plasmid or CRF₂-siRNA. In vivo MC responses and associated pathophysiology in IgE-mediated passive systemic anaphylaxis (PSA) and acute psychological restraint stress were measured in WT, CRF₂^−/−, and MC-deficient Kit^W-sh/W-sh knock-in mice.

Results:

Compared with WT mice, CRF₂^−/− exhibited heightened serum histamine levels and exacerbated PSA-induced anaphylactic responses and colonic permeability. In addition, CRF₂^−/− mice exhibited increased serum histamine and colonic permeability following acute restraint stress. Experiments with BMMCs and RBL-2H3 MCs demonstrated that CRF₂ expressed on MCs suppresses store-operated Ca²⁺ entry (SOCE) signaling and MC degranulation induced by diverse MC stimuli. Experiments with MC-deficient Kit^W-sh/W-sh mice systemically engrafted with WT and CRF₂^−/− BMMCs demonstrated the functional importance of MC-CRF₂ in modulating stress-induced pathophysiology.

Conclusions:

MC CRF₂ is a negative, global modulator of stimuli-induced MC degranulation and limits the severity of IgE-mediated anaphylaxis and stress-related disease pathogenesis.

Graphical Abstract

Capsule summary:

Targeting CRF₂ and (or) downstream pathways has potential as a new therapeutic approach to limit excessive MC activation and intestinal permeability which initiate and perpetuate highly prevalent and burdensome diseases including allergy, anaphylaxis and functional bowel disorders.

Introduction

Psychological stress has a major influence on immune function and is a risk factor in many immune-related disorders. While numerous studies have investigated the influence of different stress paradigms on immune function and disease susceptibility, the underlying signaling pathways remain to be elucidated. Mast cells have become recognized as important early immune effectors cells in the stress response and stress-related pathophysiology. Mast cells are strategically positioned close to neurovascular units and host-environmental interfaces (e.g. mucosal epithelial barriers) and express a repertoire of receptors to sense and respond rapidly to a continuous array of stress signals from neuroendocrine, immunological and environmental origins. Upon activation, MCs release an array of preformed granule mediators including histamine proteases, and select cytokines via degranulation which trigger rapid and robust physiologic effects such as changes in blood flow, increased endothelial and epithelial permeability, hyper-secretion and immune cell activation and recruitment (1–6). While stress-induced MC degranulation and the associated tissue pathophysiology likely represents an critical host defense strategy to mobilize critical resources for the fight or flight response and enhance immune function, excessive MC activation can be detrimental and has been linked with the onset and severity of diseases including allergy, asthma and IBS (7–11).

The CRF system is well-established as a major stress regulatory system in the body (12) and is composed of a family of peptides related CRF and related family of urocortins (Ucn I-III) which mediate their actions via GPCR’s CRF₁ and CRF₂. The role of the CRF system has been extensively studied in the CNS with regards to HPA axis regulation and neurobehavioral paradigms (12, 13). More recently, the CRF system has been shown to be highly active in peripheral immunological and infectious challenge conditions (14–17), suggesting an important role in immune function. Comparatively, little known about the role of the CRF system in regulating the function of specific immune cells such as the MC. MCs express both CRF₁ and CRF₂ (18–20) and can synthesize and release ligands CRF and Ucn (21, 22). Pharmacological stimulation of CRF receptors on human and rodent MCs in vitro was shown to induce canonical GPCR signaling pathways, such as cAMP Ca²⁺ and pERK, and the selective release of de novo synthesized growth factors and cytokines (18, 19, 23), whereas CRF receptor ligands did not induce degranulation. The in vivo role of MC-expressed CRF receptors has remained elusive; however, we recently demonstrated that CRF₁ expressed on MCs acts as a positive modulator of stress-induced MC degranulation and associated tissue pathophysiology in response to anaphylaxis and psychological stress (22). In the present study, we demonstrate that the complementary CRF receptor subtype, CRF₂, is a negative modulator of MC degranulation and associated pathophysiological responses to immunological and psychological stressors, thus further supporting a critical homeostatic role for the MC-specific CRF system in mast cell activation and MC-associated diseases.

METHODS

Ethics statement

All protocols were approved by the North Carolina State University (Protocol 09-047B) and Michigan State University’s Institutional Animal Care and Use Committee (Protocol 03/15-039-00).

Animals

Founding breeders for all mice strains were obtained from the Jackson Laboratories (Bar Harbor, ME) and were housed in accordance with guidelines from the American Association for Laboratory Animal Care and Research Protocols. C57BL/6 (Stock no. 000664) and Kit^W-sh/W-sh mice (Stock no. 012861) used in this study were derived from homozygous breeders. Heterozygous CRF₂^+/− mice (B6; 129-Crhr2^tm1Jsp/J; Stock no. 010842) were purchased and bred to obtain wild-type CRF₂^+/+ and knockout CRF₂^−/− mice. The knockout CRF₂^−/− mice have three exons, which encode for the third intracellular loop of CRF₂ cytoplasmic region, replaced with a neomycin resistance cassette as described earlier (24). Standard PCR was used to genotype and confirm WT and CRF₂^−/− mice and BMMCs confirm both in house and via commercial services (GeneTyper, New York, New York) using PCR protocols published at www.jax.org.

Passive systemic anaphylaxis

Wildtype and CRF₂^−/− female mice (8 weeks of age) were sensitized by intraperitoneal injection (i.p.) with 20 µg of IgE monoclonal anti-dinitrophenyl in 100 µl PBS. The following day, mice were challenged with 1 mg of DNP in 100 µl PBS (i.p.). The mice were constantly observed and rectal body temperature recorded for 0, 15, 30, 60 and 120 minutes post DNP challenge (TH-5 Thermalert, Physitemp, Clifton, NJ). Mice were sacrificed at 0 min and 30 min post-DNP injection for serum collection via cardiac puncture and stored at −80⁰C until serum histamine level was quantified using a commercial EIA kit (Oxford Biomedical Research). Antalarmin experiments: PSA was performed as indicated above with the additional treatment group of antalarmin-treated CRF₂^−/− mice. Antalarmin (15 mg/kg) was injected (i.p.) in to male mice 15 minutes prior to DNP challenge. Mice were sacrificed 30 min post-DNP injection and plasma was collected via cardiac puncture for later histamine analysis.

Histamine measurements

Histamine concentrations were quantified in serum, plasma, and in cell pellets and supernatants from stimulated MC cultures with a histamine EIA kit (Oxford Biomedical Research, Rochester Hills, MI).

Quantification of tissue mast cell numbers

Small intestinal mesentery windows from wildtype and CRF₂^−/− mice were whole mounted on glass slides and fixed with Carnoy’s fixative and stained with Toulidine blue as described previously (25). The heart and ear from the same mice were fixed in 4% paraformaldehyde embedded in paraffin, deparaffinized sections were stained with Toluidine blue. Toluidine blue stained mast cells were counted in five, non-overlapping microscopic fields at a magnification of 400x. Each filed contained tissue sections that filled the entire hpf. Mesentery mast cells were counted in at least six mesenteric widows per mouse (n=4/genotype). Prior to performing tissue counts, each slide was coded so that counts were performed in a blinded manner. The average number of mast cells per high power field (hpf) was then calculated for each tissue and within each genotype.

White Blood Cell Differential Count

Blood was collected via cardiac puncture from wildtype and CRF₂^−/− female mice and placed into EDTA-treated tubes (Microvette, Nümbrecht, Ger many). Blood smears were performed followed by a differential white blood cell count (# basophils/100 WBCs).

Ussing chamber studies

Distal small intestine (ileum) was harvested from each mouse immediately after euthanasia and opened along the anti-mesenteric border. The intestinal mucosa was stripped from the seromuscular layer in oxygenated (95% O₂, 5% CO₂) Ringer solution (in mmol/l: 154 Na⁺, 6.3 K₊, 137 Cl⁻, 0.3 H₂PO₄, 1.2 Ca²⁺, 0.7 Mg²⁺, 24 HCO₃⁻; pH 7.4) and mounted in 1.13 cm² aperture Ussing chambers (World Precision Instruments, Inc., Sarasota, FL). Ileal mucosa was bathed on the serosal and mucosal sides with 10 ml Ringer’s solution. The serosal bathing solution contained 10 mM glucose, which was osmotically balanced on the mucosal side with 10 mM mannitol. Bathing solutions were oxygenated (95% O₂, 5% CO₂) and circulated in water-jacketed reservoirs maintained at 37°C. The spontaneous potential difference (PD) was measured using Ringer-agar bridges connected to calomel electrodes, and the PD was short-circuited through Ag-AgCl electrodes using a voltage clamp that corrected for fluid resistance. Tissues were maintained in the short-circuited state, except for brief intervals to record the open-circuit PD. Transepithelial electrical resistance (TER, measured as ×cm²) was calculated from the spontaneous PD and short-circuit current (I_sc), as previously described(26). After a 30-min equilibration period on the Ussing chambers, TER was recorded at 15 min intervals over a 1-h period and then averaged to derive the basal TER values for a given animal. After a 30 min equilibration period on Ussing chambers, FD4 (Sigma, 100 mg/ml) was added to the mucosal bathing reservoir of the Ussing chambers. After a 15 min equilibration period, standards were taken from the serosal side of each chamber and a 60 min flux period was established by taking 0.5 ml samples from the mucosal compartment. The quantity of FD4 was established by measuring the fluorescence in mucosal reservoir fluid samples in a fluorescence plate reader at 540 nm. Data are presented as the rate of FD4 flux in ng FD4.min.cm²

Culture of bone marrow derived mast cells (BMMCs) and RBL-2H3 cells

Bone marrow cells derived from female WT and CRF₂^−/− mice of approximately 4–6 weeks of age. Isolated bone marrow progenitor cells were cultured in RPMI 1640 media (with L-glutamine) supplemented with FBS (10%), sodium pyruvate (1 mM), MEM nonessential amino acids (1X), HEPES buffer (10 mM), penicillin (100 U/ml) and streptomycin (100 µg/ml) and recombinant cytokines [stem cell factor (5 ng/ml) and interleukin-3 (5 ng/ml)]. After four weeks, cultures comprised mainly of mast cells (93%) as determined by toluidine blue (Sigma-Aldrich, St. Louis, MO) staining, and flow cytometry analysis (BD LSR II, East Lansing, MI) using fluorescently labeled c-Kit (Biolegend, San Diego, CA), high-affinity IgE receptor (FcƐRI) antibodies (eBioscience, San Diego, CA) and CRF₂ anti-Rabbi. Media and supplements were purchased from Corning Cellgro (Manassas, VA) and recombinant cytokines from R&D Systems (Minneapolis, MN). The rat basophilic leukemia cell MC line (RBL-2H3) were grown in MEM media with 10% fetal bovine.

Confocal immunofluorescence staining

BMMCs and peritoneal mast cells were obtained from 8 week old female c57Bl/6 mice as previously described (25). Cells were pelleted, washed once with 1x PBS, cytospun onto slides, and fixed with 4% PFA for 20 minutes at 4°C. Slides were blocked at room temperature for 1 hour with blocking buffer (10% normal donkey serum, 0.3% Triton X-100) in 1x PBS, permeabilized (0.1% triton x100), and incubated with goat anti-CRF₁ (Novus Biologicals, NBP1–00175) and rabbit anti-CRF₂ (Novus Biologicals, NBP100–56485) in dilution buffer at a concentration of 1:100 diluted in 1% BSA in a humidified chamber overnight at 4⁰C. Slides were washed three times for five minutes and then incubated in with anti-rabbit-Cy3 and anti-goat-FITC secondary antibodies in dilution buffer (1:300) for 1 hour at room temperature in the dark. Slides were washed three times for 5 minutes with 1x PBS and ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher, P36971) was added prior to being cover-slipped. Confocal images were obtained with Olympus FV 1000 confocal laser scanning microscope, (Olympus America, Center Valley, PA).

β-Hex assay

RBL 2H3 cells or murine BMMCs (2×10 ⁶ cells/ml) were sensitized overnight at 37°C with 1 µg/ml anti-dinitrophenyl (DNP)-IgE (Sigma-Aldrich) in complete RPMI medium with cytokines. The following day cells were washed and resuspended in Tyrode’s buffer and BMMCs were seeded in a 96 well plate (0.45×10 ⁶ cells/well). The cells were equilibrated for an hour and stimulated with indicated concentrations of dinitrophenyl-albumin (DNP) (Sigma-Aldrich) for 1 h at 37°C. For A23187 and c48/80 stimulation, unsen sitized BMMCs were stimulated for 1 h. β-Hex activity was measured by addition of p-nitrophenol-N-acetyl-α-D-glucosaminide in 0.1 M sodium citrate (pH 4.5) for 1 hour at 37°C. The r eaction was terminated with 0.1 M carbonate buffer (pH 10.0) and the absorbance was recorded at 405 nm. The percent degranulation was calculated by dividing optical absorbance of the supernatant by the sum of optical absorbance by the supernatant and cell pellet (lysed with 0.1% Triton X-100) and multiplying by 100.

CRF₂ over-expression and knockdown in RBL-2H3 MCs

Lenti ORF clone of CRF₂ (CRHR2), transcript variant 1, and mGFP tagged plasmid were obtained from Origene (Rockville, MD) (Cat No: RG222881). CRF₂ shRNA clone (MSH028936-LVRU6MH) were purchased from GeneCopoeia (Rockville, MD). DH5 alpha competent cells were obtained from Invitrogen (Cat no: 18265017) and the plasmids were transfected and plated on selective antibiotic resistance LB plates according to the manufacturers protocol. After overnight incubation at 37⁰C, a single colony was picked for each individual clones and inoculated on 2.5 ml LB media containing antibiotics and kept for 8 hours at 37⁰C at 200 rpm. A total of 600 µl of culture inoculum was transferred in to 300 ml of LB broth on a sterile 1 L flask with antibiotics and kept at 200 rpm at 37⁰C overnight. Plasmid was extracted and the concentration was measured according to the manufacturer’s protocol (Qiagen Cat No: 12662).

Human embryonic kidney cell 293Ta lentivirus cells were seeded at a concentration of 1.5×10⁶ cells per well (6 well) and 2.5 µg of CRF₂ over-expressed or CRF₂ shRNA along with respective control eGFP or Scrambled shRNA plasmid control DNA were transfected using Lentiviral packaging kit (Origene Cat No: TR30022) according to manufacturer’s protocol. After overnight incubation at 37⁰C with 5% CO₂, the transfection media was replaced with normal 5% DMEM media with polybrene (1 µl of 4 mg/ml). 48h after transfection, the supernatant was collected from the 6 well plate and filtered onto a Nalgene ultracentrifuge tube and 5 ml of 20% sucrose was added into the bottom of the tube. Centrifuged at 25,000 rpm for 2 hour at 4⁰C and the supernatant was discarded and the lentiviral over-expressing CRF₂ plasmid or CRF₂ shRNA, pellet was re-suspended with 150 µl of 4% lactose and kept on ice for 15 min and centrifuged at a high speed for 1 min. Lentiviral aliquots were stored at −80⁰C until transfection.

Lentivirus tittering was done and RBL-2H3 at a concentration of 2.5×10⁵ cells were plated on a 12 well plate and grown over night. Lentivirus over expressing CRHR2 or CRF₂ shRNA plasmid at MOI of 40 and polybrene at a final concentration of 8 µg/ml was added in to each well and centrifuged the plate at 300 g for 60 min at 30⁰C. The plate was incubated at 37⁰C for overnight and the media was replaced with 15% MEM. After 48 h of transfection, the cells were trypsinized and transferred onto T75 flasks. The RBL-2H3 over expressing CRF₂ or CRF₂ shRNA tagged with GFP (CRF₂ Over expressed) or mCherry (CRF₂ shRNA) were sorted on the flow cytometry (Becton Dickinson FACSAria II, UNC, Chapel Hill, NC) based on the GFP or mCherry positive cells and multiplied and the RBL-2H3 cell aliquots were stored at liquid nitrogen for further study.

CRF₂ siRNA knockdown in RBL-2H3 cells

Overnight grown RBL-2H3 cells were seeded at a concentration on 5×10⁵ in a 6 well plate were transfected with CRF₂ siRNA (NM-022714, sigma) or scrambled siRNA (SIC00–1, sigma) of 150 ng using Qiagen Hi-perfect transfection reagent according to its manufacturer’s protocol. Six hours post transfection normal growth media added to each well and incubated at 37°C with 5% CO ₂ for 48 hour. After the incubation, transfected cells were primed with over-night IgE or not and stimulated with 1 hour DNP or A23187 (non IgE primed) and the β hexosaminidase, histamine and calcium mobilization assay was done as described above.

Human mast cell experiments with LAD2 cells

LAD2 cells provided by A. Kirshenbaum (NIH, USA) were cultured in StemPro-34 (Life Technologies, Carlsbad, CA) media supplemented with StemPro-34 Nutrient Supplement ((Life Technologies) l-Glutamine (2 mM) ((Life Technologies), Penicillin (100 U/ml)/Streptomycin (100 µg/ml) and rhSCF (Peprotech Inc., Rocky Hill, NJ) (100 ng/ml). Cell density was kept below 0.5 × 106/ml. and half the amount of media was replaced weekly. Cells were sensitized overnight with 100 ng/ml biotinylated human IgE (US Biologicals). On the following day, cells were washed with Tyrode’s buffer to remove excess IgE and stimulated with (vehicle, 0.1% BSA in PBS), streptavidin (100 ng/ml), and 1–100 nM of human Astressin 2B (A2B) (kind gift from Jean Rivier, The Salk Institute, La Jolla, CA). Release of β hexosaminidase was measured after 1 hour of stimulation as described above.

RT-PCR

Total RNA was extracted from heart tissue and BMMCs using TRIzol Reagent (Invitrogen) followed by DNase treatment and purification using the PureLink RNA mini kit (Life Technologies). cDNA was synthesized and amplified using the SuperScript® III One-Step RT-PCR System with CRF₂ specific primers (5′-TCGGGCAGGGTAGGACAG-3′ and 5′-CGGGCAGACGGTGACAGA-3′) designed to include the full mouse CRF₂ coding region (Sztainberg et al., 2009). Total RNA was isolated from RBL-2H3 cells using Qiagen RNAeasy kit and transcribed to cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA). CRF₂ expression was determined using CRF₂ specific primers (Forward Rat 1_Crhr2: ACTCTACTATGAGAATGAGCAG and Reverse Rat 1_Crhr2: TGACGATGTTGAACAGAAAC; Sigma-Aldrich).

Intracellular Ca²⁺ measurements

RBL-2H3 cells and murine BMMCs derived from WT and CRF₂^−/− mice were used for this study. On the day of the experiment, cells were washed and re-suspended in calcium assay buffer. Changes in intracellular calcium in response to stimulus were detected using the Fluo 4 NW Calcium assay kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Briefly, cells were loaded at 37 °C for 30 min with the fluorescent Ca²⁺ indicator, Fluo 4 NW, in the presence of Probenecid, followed by incubation at room temperature for another 30 min. Changes in fluorescence was measured by stimulating the cells by adding different concentrations of DNP/HSA or A2187 or c48/80. Change in fluorescence was measured using the FDSS/µCELL kinetic plate reader (hamamatsu) or Fluoroskan Ascent FL microplate reader (Thermo Fisher Scientific) at 480 nm excitation and 540 nm emission. The ratio was calculated by average increase in fluorescence divided with the baseline was determined for each time point after the addition of stimulus.

Store operated Ca²⁺ entry (SOCE) channel expression

BMMC lysates were prepared by re-suspending cells in RIPA buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitors (Thermo Fisher Scientific) at 4°C. Lysates were sonicated and centrifuged at 21,000 x g for 10 min. The protein concentration was measured using DC Protein Assay Kit (Bio-Rad). Cellular proteins were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membranes were blocked with 5% w/v BSA in Tris-buffered saline (TBS) with 0.1% Tween 20 (TBS-T) for 1 hour at room temperature, washed in TBS-T, incubated with the following Rabbit Anti-Human antibodies: STIM1 (alomone labs #ACC-063;1:500 dilution), Anti-TRPC1 (alomone labs #ACC-010;1:600 dilution), Anti-Orai1 (alomone labs #ACC-060;1:400 dilution), and β-actin (cell signaling, 4970, 1:1000) diluted in 5% w/v BSA in TBS-T for overnight at 4°C or 2 hours at room temperature, and then washed with TBS-T. Subsequently, the membranes were incubated with rabbit polyclonal secondary antibody (cell signaling 7074; 1:2000) for 1 hour at room temperature, washed with TBS-T and incubated in SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific). Bands were visualized with ChemiDoc MP Imager (Bio-Rad Laboratories) and the Image Lab software (version 4.1) was used for densitometric analysis.

Restraint stress model

Female mice were placed in individual transparent 50 ml plastic conical tubes, modified with air holes, for a 3 h period. Control mice remained in their original home cages for 3 h without food and water to avoid confounding effects of water or feed intake during the 3 h experimental period. Following RS, mice were immediately euthanized by CO₂ inhalation, and serum and ileal mucosa were collected for measurement of serum histamine and intestinal permeability, respectively.

BMMC engraftment in Kit^{W-sh/W-sh mice}

Female Kit^{W-sh/W-sh mice} (8–10 weeks of age) were injected intraperitoneally with 1×10⁷ BMMCs (suspended in 200 µl of sterile 1x PBS) derived from CRF₂^+/+ (WT) or CRF₂^−/− mice. At 16 weeks of age (4 weeks post-engraftment), engrafted mice were sacrificed by CO₂ inhalation. Intestinal mesentery window sections were harvested fixed in Carnoy’s fixative and stained with Toluidine blue to confirm engraftment of BMMCs.

Statistical analysis

In vivo and in vitro studies are presented as means ± SE from a representative experiments with an n=6–8 animals/treatment group (unless otherwise specified). Experimental results were repeated in a minimum of 2 independent experiments while some experiments were repeated in greater than 2 independent experiments (noted in figure legends). Comparisons between multiple experimental groups was performed using a 1 or 2-Way ANOVA where appropriate with a Tukey’s post-test. Comparisons between two treatments were analyzed using an unpaired two-tailed t test. Values of p<0.05 were considered statistically significant. All statistical analyses and calculations were performed using GraphPad Prism 5 software (San Diego, CA, USA).

RESULTS

CRF₂-deficiency exacerbates PSA-induced mast cell degranulation, anaphylaxis and intestinal permeability

To first define the role of CRF₂ in MC-associated disease in vivo, we compared MC responses and associated pathophysiology in a MC-dependent model of PSA. Compared with WT mice, CRF₂^−/− mice exhibited higher (by 4.1 fold) serum histamine levels, measured at 30 min post-PSA challenge (5017 ± 919 ng/ml and 1208 ± 235 ng/ml in CRF₂^−/− and WT mice, respectively, P<0.001, Fig. 1A). In agreement with serum histamine levels, CRF₂^−/− mice exhibited a greater peak reduction in body measured at 30 minutes post-DNP challenge (∆−4.55±0.85°C and ∆−6.8±0.54°C in WT and CRF ₂^−/− mice, respectively, P=0.04, Fig. 1B). Measurement of cardiac blood volume reduction, an index of systemic vasodilation and fluid extravasation induced by PSA (27, 28), was also greater in CRF₂^−/− mice at 30 and 120 min post-DNP challenge, compared with WT mice (Fig. 1C), thus indicating a more severe hypovolemic shock response in CRF₂^−/− mice. Intestinal permeability, measured as increased FD4 flux rate and reduced TER across ileal mucosa mounted on Ussing chambers, was Greater in CRF₂^−/− mice compared with WT mice 120 min post-PSA (Fig. 1D, E). Quantification of tissue MCs by Toluidine blue staining of heart, intestinal mesentery and skin showed that WT and CRF₂^−/− mice had similar distributions and numbers of tissue MCs (Fig. 1F-H). Further, circulating basophil numbers were similar between WT and CRF₂^−/− confirming that elevated histamine levels in CRF₂^−/− mice, were not due to increased basophil numbers. Given that many mast cell-dependent diseases exhibit a female sex bias and our previous studies demonstrating sex differences in mast cell responses (25), we also compared the influence of CRF₂ deficiency on PSA-induced serum histamine responses in female and male mice. These studies confirmed our previous research showing that females exhibit a greater release of serum histamine compared with males, CRF₂^−/− deficiency exacerbated serum histamine responses in both female and male mice (Supplemental Fig 1). Therefore, we conducted subsequent experiments in predominantly in female mice. Together, these experiments revealed a significant in vivo role for CRF₂ in IgE-mediated MC degranulation, anaphylaxis and intestinal permeability.

FIG 1. CRF₂ deficiency exacerbates passive systemic anaphylaxis and intestinal permeability.

Wild type (CRF₂^+/+) and CRF₂^−/− female mice (6–8 weeks of age) were sensitized systemically overnight with IgE and challenged with either PBS vehicle (Control) or anti-IgE DNP to induce passive systemic anaphylaxis (PSA). A: Serum histamine levels were measured at 30 min post-vehicle or DNP challenge. B: rectal temperature was recorded at 0 and 30 min and the change in body temperature was calculated and presented as ∆ °C. C: Cardiac blood volume was measured at 0, 30 and 120 min post DNP challenge. D, E: 120 min post-DNP challenge, ex vivo colonic permeability was measured on Ussing chambers as FD4 flux rate (D) and TER (E). F-H: Tissues from WT and CRF₂^−/− mice were fixed and stained with Toluidine blue and mast cell counts were performed and presented as mast cells/hpf. G: blood basophils were counted in blood smears and expressed at the % of basophils/100 WBCs. Data are means ± SEM from a representative experiment with n=6 animals per group. Experiments were repeated in n=6 (serum histamine, body temperature) or 2 (cardiac volume, mast cell and basophil counts) independent replicates. ^#,* symbols differ by p<0.05 using a 1-Way ANOVA (A, D); Different asterisks indicate significance determine by unpaired two-tailed t-test (B, C, E),*p<0.05, **p<0.01.

CRF₂ expressed on MCs is a negative modulator of MC degranulation

Corticotropin releasing factor receptors are widely expressed in numerous cell types, including MCs (20, 29, 30), but little is known regarding the localization or functional role of CRF₂ in MC function. Using confocal microscopy, CRF₂ was found to be localized to the both the surface and intracellularly in BMMCs and peritoneal (tissue) mast cells (Fig. 2). Further, a nuclear staining pattern of CRF₂ was also observed predominantly in BMMCs compared PMCs. Flow cytometry confirmed the surface expression of CRF₂ in BMMCs (Supplemental Fig. 2G). CRF₁ showed a different pattern of expression with a predominant surface localization in PMCs and BMMCs with some intracellular staining was observed mostly in BMMCs. To explore the functional role of MC CRF₂^−/−, we conducted in vitro degranulation assays with BMMCs derived from WT and CRF₂^−/− mice. In line with in vivo PSA studies, CRF₂^−/− BMMCs exhibited exacerbated degranulation responses measured as enhanced β-hex release following IgE-FcƐR1 cross-linking (Fig. 3A). Transmission electron microscopy (TEM) revealed a more activated appearance of CRF₂^−/− BMMCs following IgE/DNP, compared with WT BMMCs, thus supporting β-hex data (Fig. 3D). To determine whether the exacerbated MC degranulation responses observed in CRF₂^−/− BMMCs were specific to IgE-FcƐR1-mediated pathways, WT and CRF₂^−/− BMMCs were also stimulated with non-IgE dependent MC stimuli including the c48/80, which acts via the G-protein coupled receptor, Mrgpb2 (31), and A23187, which acts on downstream SOCE mechanisms from intracellular (e.g. endoplasmic reticulum, ER) and extracellular stores (32). Similar to IgE stimulus, CRF₂^−/− BMMCs exhibited exacerbated β-hex release in response to both A23187 and c48/80 (Fig. 3 B, C). Because our previous work demonstrated that CRF₁ potentiates stimuli-induced mast cell degranulation (22), we investigated whether enhanced degranulation in CRF₂^−/− BMMCs could be due to a reciprocal upregulation of CRF₁ expression. Quantitative PCR showed that compared with WT BMMCs, CRF₂ expression was down-regulated in CRF₂^−/− BMMCs (by ~ 40%) but CRF₁ expression was not significantly altered (Supplemental Fig. 3 A,B). It should be noted that because the loss of CRF₂ activity in CRF₂^−/− BMMCs (derived from CRF₂^−/− mice) is a result of a functional deletion of a c-terminal region, CRF₂ is still expressed as shown in Supplemental Fig. 3A, but at a lower level than WT BMMCs. There were no significant differences between WT and CRF₂^−/− BMMCs with regards to the cellular content of β-hex content or phenotype determined by c-kit/FcƐR1 expression by flow cytometry analysis (Supplemental Fig. 2), confirming that enhanced degranulation in CRF₂^−/− BMMCs were not due to an increased intracellular granule mediator content or aberrant MC phenotype.

FIG 2. Localization of CRF1 and CRF2 in BMMCs and peritoneal mast cells.

CRF1 (Cy3 Red) and CRF2 (FITC Green) nuclei (DAPI blue). z-Stack overlay images show a single plane cross section through horizontal plane (XY), sagittal plane (YZ), and coronal plane (XZ). Panels A-C) murine BMMCs. Panels D-F) PMCs. White arrow indicates the nuclear staining pattern of CRF₂ (Panel C).

FIG 3. Genetic deficiency and overexpression of CRF₂ induces divergent effects on stimuli induced MC degranulation. A:

β-hex % release from IgE-sensitized WT and CRF₂^−/− BMMCs stimulated with DNP (32 ng/mL). B, C: β-hex release from WT and CRF₂^−/− BMMCs stimulated with A23187 (B) and c48/80 (C). D: Transmission electron microscopy analysis of WT and CRF₂^−/− BMMCs stimulated with IgE/DNP. E,F: β-hex release from RBL-2H3 MCs transfected with CRF₂-overexpressing plasmid or eGFP control or CRF₂-siRNA. Data are means ± SEM from a representative experiment with n=3 (bone marrow donors) per group. Experiments were repeated in n=6 (A-C) or 2 (E-F) independent replicates. *Significance between groups was determined by an unpaired two-tailed t-test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

To further examine the link between CRF₂ expression on MCs and degranulation responses, we transfected CRF₂-plasmid into RBL-2H3 MCs to enhance CRF₂ expression. We confirmed the specificity of the CRF₂-over expression by qPCR which revealed and upregulation of CRF₂ expression (by 6.4 Fold; Supplemental Fig. 3C) compared with the empty GFP (eGFP) plasmid, while having no significant effect on CRF₁ expression (Supplemental Fig. 3D). CRF₂ over-expressed RBL-2H3 MCs exhibited suppressed IgE/DNP-mediated β-hex release (by 47%), compared with empty plasmid controls (Fig. 3E). We also knocked down CRF₂ expression in RBL-2H3 MCs with CRF₂-directed siRNA, which resulted in a 2-fold increase in β-hex release following IgE/DNP stimulation, compared with scrambled siRNA controls (Fig. 3F). Pharmacological inhibition of CRF₂ with the selective antagonist Astressin 2b (A2B) enhanced IgE-FcƐR1-induced β-hex release in both rat RBL-2H3 and human LAD2 MCs (Fig. 5), thus confirming the genetic experiments and translational significance to human MCs.

FIG 5. CRF2−/− BMMCs exhibit exacerbated Ca²⁺ mobilization responses to diverse mast cell stimuli.

Murine BMMCs from female mice were loaded with Fluo 4 Ca²⁺ indicator and stimulated with indicated MC degranulation stimuli as described in the Material and Methods Section. Intracellular Ca²⁺ mobilization (presented as ∆F480/F540 or as representative traces) in response to indicated concentrations of IgE/DNP (A,E), A23187 (B,F) and c48/80 (C,G) and Carbachol (D,H). Data shown are the means ± SE and are representative of 3 independent experiments performed in triplicate. Data were analyzed using a 1-way ANOVA *P < 0.05, **P < 0.001, ***P < 0.0001.

Given our previous work showing that MC CRF₁ potentiates MC degranulation while in the present study CRF₂ suppresses MC degranulation, we hypothesized that MC CRF₁ and CRF₂ might function in concert to regulate or balance MC degranulation responses. To test this hypothesis, we pre-treated CRF₂^−/− mice with the CRF₁ selective antagonist Antalarmin followed by induction of IgE-mediated PSA. Antalarmin significantly attenuated the exacerbated PSA-induced histamine release in CRF₂^−/− mice (Supplemental Fig. 4).

CRF₂ negatively regulates SOCE in MCs

We next explored the mechanism by which CRF₂ caused suppression of stimuli-induced MC degranulation. Because CRF₂ was shown to negatively modulate MC degranulation induced by diverse MC stimuli that utilize upstream, receptor-dependent pathways (IgE-FcεR1, and c48/80) or downstream, receptor-independent pathways (A23187) mechanisms, we hypothesized that CRF₂ was targeting a common downstream signaling mechanism utilized by MC degranulation stimuli. SOCE from intracellular (endoplasmic reticulum and golgi) and extracellular stores is essential for MC granule exocytosis and degranulation (33). Therefore, we conducted Ca²⁺ mobilization experiments with WT and CRF₂^−/− BMMCs loaded with the Fluo 4 Ca²⁺ indicator dye. These experiments showed that CRF₂^−/− BMMCs exhibited heightened IgE/DNP Ca²⁺ mobilization following IgE/DNP stimulation (Fig. 5). Furthermore, CRF₂^−/− BMMCs also exhibited heightened Ca²⁺ signaling in response to other MC stimuli including A23187, c48/80 and the muscarinic 3 receptor agonist carbachol (Fig. 5) overall demonstrating the global inhibitory role of CRF₂ in response to diverse MC stimuli.

We next conducted similar experiments in Ca²⁺-replete or Ca²⁺-free conditions (1 mM EDTA) to determine whether the heightened Ca²⁺ signaling in CRF₂^−/− BMMCs was due to enhanced release from intracellular stores such as the ER or via influx of extracellular Ca²⁺ via plasma membrane channels. As anticipated, removal of extracellular Ca²⁺ with EDTA significantly reduced Ca²⁺ signals induced by IgE/DNP in both WT and CRF₂^−/− BMMCs (Fig. 6A, B). However, EDTA did not ablate the heightened Ca²⁺ signaling in CRF₂^−/− BMMCs, compared with WT BMMCs (Fig. 6B, C) indicating heightened Ca²⁺ release from intracellular stores in CRF₂^−/− BMMCs. CRF₂^−/− BMMCs also exhibited increased expression of SOCE channels including the ER Ca²⁺ sensor stromal interacting molecule-1 (STIM1), and plasma membrane channels transient receptor potential canonical-1 (TRPC1) and Orai1 (Fig. 6D-I). Together these data indicate that CRF₂ is a negative and global modulator of stimuli-induced Ca²⁺ signaling with actions on intracellular release and subsequent extracellular Ca²⁺ entry.

FIG 6. CRF2−/− BMMCs exhibit heightened intracellular Ca²⁺ store release and expression of SOCE channels.

BMMCs derived from WT and CRF₂^−/− mice were loaded with Fluo 4, and intracellular Ca²⁺ levels were measured following stimulation with IgE/DNP. A,B: Representative intracellular Ca²⁺ traces for experiments conducted under Ca²⁺-replete (A) or Ca²⁺-free (1 mM EDTA; B) conditions. C: Mean peak change in fluorescence following IgE/DNP stimulus presented as ∆ peak fluorescence. D-I: Representative Western blots and densitometry analysis for STIM1 (D, G), TRPC1 (E, H), and Orai (F, I) in WT and CRF₂^−/− BMMCs. *Significance between groups was determined by an unpaired two-tailed t-test (C, G-I),*p<0.05, **p<0.01.

CRF₂^−/− mice exhibit elevated serum MC histamine and intestinal permeability in response to acute restraint stress

In vitro MC culture experiments revealed that MC CRF₂ exerted suppressive effects on MC degranulation induced by a diverse array of potent MC stimuli. Given these findings, we hypothesized that the global effects of CRF₂ on MC degranulation, would extend to non-IgE-dependent in vivo models of MC degranulation. To test this hypothesis, we compared MC degranulation responses, via measurement of serum histamine levels, in WT and CRF₂^−/− mice following a 1-hour period of psychological restraint stress. Compared with WT mice, CRF₂^−/− mice exhibited higher serum histamine levels following restraint stress (97.7 ± 5.9 ng/ml and 68.2 ± 7 ng/ml in CRF₂^−/− and WT mice, respectively, P<0.01, Fig. 7A). We also assessed colonic permeability measured as FD4 flux rates on Ussing chambers, which showed a significantly elevated FD4 flux rate in CRF₂^−/− mice following restraint stress, compared with WT mice. (Fig. 7B). Together, these data indicate that CRF₂ plays a global role in controlling MC degranulation and associated tissue pathophysiology induced by diverse stressors.

FIG 7. CRF2−/− mice exhibit heightened serum histamine levels and intestinal permeability following acute restraint stress.

Wild type and CRF₂^−/− mice female mice (8–10 weeks of age) underwent 1 h of restraint stress or housed under normal cage conditions (Control) as described in Materials and Methods. Serum histamine (A) and colonic permeability (B) was measured by ELISA following 1 h of restraint stress. Data are means ± SEM (n=8 mice/group). Data were analyzed using a 2-way ANOVA, *p<0.05, **p<0.01, ^#P=0.07.

MC CRF₂ is a negative modulator of stress-induced intestinal permeability

The above experiments demonstrated an important role for CRF₂ as a negative modulator of MC-dependent intestinal permeability induced by PSA and restraint stress. Further, in vitro experiments demonstrated the role of MC-specific CRF₂ in the control of stimuli-induced mast cell degranulation. We next determined the in vivo significance CRF₂ expressed on MCs utilizing a MC knock-in model. MC-deficient Kit^W-sh/W-sh mice were systemically engrafted with BMMCs derived from either WT or CRF₂^−/− mice. Twelve weeks post-engraftment, mice underwent 3 h of restraint stress and colonic permeability was measured in Ussing chambers. Compared with Kit^W-sh/W-sh mice engrafted with WT BMMCs, CRF₂^−/− engrafted mice exhibited the greater colonic permeability responses, measured as FD4 flux rates (Fig. 8A). WT and CRF₂^−/− mice exhibited similar reductions in colonic TER following restraint stress (Fig. 8B). Toluidine blue staining and MC counts in intestinal mesenteric tissue confirmed an equal engraftment rate between WT and CRF₂^−/− BMMCs in MC-deficient Kit^W-sh/W-sh mice (Fig. 8C).

FIG 8. CRF₂ expressed on mast cells is a critical modulator of stress-induced intestinal permeability.

Mast cell deficient Kit^W-sh/W-sh mice were engrafted with BMMCs derived from WT or CRF₂^−/− mice. Twelve weeks post-engraftment, mice were exposed to restraint stress (RS) for 3 hours. FD4 flux rate (A) and TER (B) measured from colon mounted on Ussing chambers from WT and CRF₂^−/− BMMC-engrafted Kit^W-sh/W-sh mice. C: MC numbers, determined with Toluidine blue staining in intestinal mesenteric windows from WT and CRF2−/− engrafted Kit^W-sh/W-sh mice. Data are means ± SEM (n=8 mice/group). Experiments were repeated in two independent studies. Data were analyzed using a 2-way ANOVA,*p<0.05.

DISCUSSION

Stress is an important risk factor in the clinical onset and severity of important immunological disorders including allergy, asthma and functional and inflammatory GI disorders. Mast cells (MCs) play a central role in many immunological disease and have gained recognition as a critical immune effector cell in the stress response. Mast cells are rapidly activated (within minutes) of exposure to diverse stressors including psychological, chemical and physical stressors resulting in the release of preformed granule mediators (e.g. histamine, proteases, TNF, etc.) via degranulation. Released MC mediators evoke profound physiologic effects in local and systemic tissues such as increased epithelial and endothelial permeability, neuronal activation and circulatory changes. While stress-induced MC activation likely represents an early defense or alarm mechanism to mobilize resources necessary for the individual to response appropriately to the stressor, excessive or prolonged MC activation is harmful leading to immune dysregulation and tissue damage and exacerbation of disease. While the major mast cell stimuli have been identified; how environmental factors such as stress play a role in exacerbating or limiting MC activation remain poorly understood. Here we demonstrated a novel function for CRF₂ expressed on MCs as a negative modulator of stimuli induced MC degranulation and MC-dependent pathophysiology associated with anaphylaxis and acute psychological stress.

Previous studies conducted in vitro with human and rodent MCs demonstrated that MC express both CRF₁ and CRF₂ receptors (22, 23) and that CRF receptor ligands can induce canonical GPCR pathways including cAMP and phoshoERK signaling (19, 22, 34). However, the precise role of the MC CRF system modulating MC function and MC-mediated disease pathogenesis has remained elusive. We recently demonstrated that CRF₁ receptor signaling in the MC is a potentiator of stimuli-induced MC degranulation and system and intestinal pathophysiology induced by PSA and psychological restraint stress (35). In the present study, our data revealed that, in contrast to CRF₁, CRF₂ exerts inhibitor actions on MC degranulation as loss of CRF₂ activity in in MCs, via genetic or pharmacological approaches, resulted in enhanced stimuli-induced MC degranulation and exacerbated responses to PSA and acute restraint stress. Selective inhibition of CRF₁ was shown to reduce PSA-induced MC responses in CRF₂^−/− mice to the level of WT mice, overall indicating that MC CRF₁ and CRF₂ act in concert to up- and downregulate, respectively the tone of MC degranulation and resultant MC-dependent pathophysiology. Therefore, it is plausible that a disruption of MC CRF₁ and CRF₂ homeostasis could shift the balance between hypo- and hyper-activated MC states and ultimately disease activity.

The broad inhibitory actions of CRF₂ on multiple MC degranulation stimuli and in vivo models led us to hypothesize that CRF₂ was targeting a common, downstream mechanism in MC degranulation. Results from the present study demonstrated that MC CRF₂ expression was negatively associated with Ca²⁺ mobilization induced by a diverse array of MC stimuli including IgE-antigen, c48/80 and the muscarinic receptor 3 agonist carbachol. The ability of CRF₂ to inhibit Ca²⁺ mobilization and degranulation provides supporting evidence that CRF₂ serves as a global regulation of MC activation. Experiments conducted under Ca²⁺-free conditions, further demonstrated that CRF₂ negatively modulated cytosolic Ca²⁺ entry from intracellular stores, presumably the ER. The precise signaling pathways by which CRF₂ inhibits intracellular store Ca²⁺ release remains to be fully defined. However, results from the present study revealed an increased expression of the ER Ca²⁺ sensing protein STIM1, and plasma membrane Ca²⁺ channels TRPC1 and Orai, which together represent the Ca²⁺ regulatory channels that play essential roles in SOCE and degranulation in MCs (33, 36). Increased expression of STIM1, Orai and TRPC1 have been associated with heightened Ca²⁺ mobilization and MC degranulation in food allergen-sensitized rats (37) which is in line with our findings with CRF₂^−/− BMMCs. The precise contribution of altered Ca²⁺ channel expression to CRF-mediated effects on Ca²⁺ mobilization and degranulation is unclear. Chronically elevated Ca²⁺ channel activity, due to genetic loss of CRF₂ function in CRF₂^−/− BMMCs, could lead to increase protein expression of STIM1, TRPC1 and Orai1 resulting in heightened MC activity. However, that short-term pharmacological blockade of CRF₂ and transient siRNA approaches were shown to enhance stimuli-induced MC degranulation suggests a more direct signaling event is likely involved.

Confocal microscopy revealed that CRF₂ was localized on the surface of the MC and intracellularly. Further, intra-nuclear expression of CRF₂ was also observed. In comparison, CRF₁ was localized predominantly to the cell surface of MCs with no apparent nuclear staining patterns. Together, these finding demonstrate differential cellular localization patterns between CRF₁ and CRF₂ but the relationship between cellular localization and divergent functions in MC activation requires further investigation. It has become increasing clear that a number of GPCRs target to the nuclear membrane(38) and can regulate DNA synthesis(39), transcription and gene expression (40) and histone modification(41). To our knowledge, this represents the first evidence for differential localization of CRF receptor subtypes in MCs and further investigations will likely provide insight into the divergent roles that CRF₁ and CRF₂ in MC function and provide valuable insight into approaches for potential therapeutic modulation.

Precisely how the CRF receptor system is regulated to maintain MC homeostasis with regards to degranulation remains to be fully defined. We and others have shown that MCs release CRF₁/CRF₂ ligands CRF and urocortin under basal and stimulated conditions (21, 22), and that CRF₁ and CRF₂ receptors modulate stimuli-induced MC degranulation in vitro in the absence of exogenous ligands. Together, these findings demonstrate that MCs possess a functional CRF system and implicates an autocrine regulation mechanism. Such a system could explain the ability of the MC CRF system to modulate rapid cellular signaling events in the MC such as Ca²⁺ mobilization degranulation events. In view of the CRF system as a homeostatic regulator of the stress response, activation CRF₁ in MCs could provide immunological protection by enhancing MC degranulation and subsequent physiological and immunological responses, especially during time of acute stressful challenges. On the other hand, CRF₂ activation may provide a critical homeostatic mechanism by limiting the extent of degranulation and downstream pathophysiology. Dysfunction or imbalance of this system could lead to aberrant MC function and heightened disease states. It has been shown in cultured MCs that CRF₁ and CRF₂ expression levels can be influenced by psychological stress exogenous CRF receptor ligand, Substance P and LPS (18, 20). There is also substantial evidence in humans and in animal models that CRF₁ and CRF₂ expression is altered under pathological conditions such as urticaria (42), colitis (15) (43) and chronic and early life stress (44, 45). The contribution of altered CRF receptor expression vs function in MC-associated disease pathogenesis remains to be fully elucidated.

In summary, the present study highlights a novel role for CRF₂ receptors expressed on MCs as negative modulators of MC degranulation in the acute response to immunological and psychological stress. Given the critical role of MCs as immune sentinels which rapidly respond to diverse stressful stimuli, the MC CRF₂ system may represent a critical control step to limit MC degranulation and disease pathophysiology. Further understanding of the precise mechanism by which CRF₂ controls MC degranulation and associated disease pathophysiology could unveil new therapeutic targets for immune diseases linked with stress and MC hyperactivity such as allergic inflammation and IBS.

FIG 4. CRF₂ selective antagonism enhances mast cell degranulation in rodent and human mast cells.

β-hex % release from RBL-2H3 mast cells (A) and human LAD2 cells (B) following pre-treatment with the CRF₂ antagonist drug Astressin 2B (A2B) at indicated concentrations. **p<0.01 1-Way ANOVA (n=6 replicates/treatment). Experiments repeated in n=3 independent experiments.

Key messages.

• Loss of CRF₂ function induces exacerbated MC degranulation, IgE-mediated anaphylaxis and psychological stress-induced intestinal barrier dysfunction.

• MC-specific CRF₂ suppresses degranulation induced by diverse MC stimuli via negative regulation of SOCE.

• Further characterization of the mechanisms by which CRF₂ negatively modulates MC activation could lead to novel therapeutic approaches for stress-related immunological disorders associated with MC hyperactivity.

Abbreviations:

BMMC

(Bone marrow derived mast cell)

CRF₁

(Corticotropin Releasing Factor Subtype 1)

CRF₂

(Corticotropin Releasing Factor Subtype 2)

MC

Mast cell

PMC

(Peritoneal mast cell)

SOCE

(store operated Ca²⁺ entry)

WT

(Wild-type)