Abstract
Mycoplasma hyorhinis is one of the causative agents of polyserositis and arthritis in post-weaning pigs. Here we describe the development of a multi-locus sequence typing (MLST) protocol for the characterization of M. hyorhinis field isolates. A total of 104 field isolates from different geographical locations, swine production systems, and clinical backgrounds, were analyzed. Twenty-seven genes, including housekeeping and those encoding surface proteins, were evaluated to index diversity. Genes encoding surface proteins were included to increase the discriminatory power of the MLST. Four target gene fragments were selected to be included in the final MLST-s (surface) protocol: pdhB, p95, mtlD and ung. Within each locus the nucleotide variation ranged from 1.4% to 20%. The 104 field isolates were classified into 39 distinct sequence types (STs). Multiple STs were found within the same production system and within the same pig. The majority of STs grouped strains from the same production system; however, cases existed where multiple systems shared a ST, indicating potential relationships between pig flows. The majority of the nucleotide changes observed in these genes generated synonymous changes, while non-synonymous changes were exclusively in the mtlD gene fragment, suggesting that this protein is undergoing selection. Molecular typing of M. hyorhinis will primarily aid swine practitioners with pig flow management and identifying sources of infection during outbreaks.
Introduction
In recent years, Mycoplasma hyorhinis has been recognized as an important cause of mortality in nursery pigs [1,2]. This pathogen colonizes the nasal and oropharyngeal epithelial surface of pigs. Piglets presumably become colonized through contact with sows, and the bacterium is transmitted via nose-to-nose contact among pigs following colonization and infection [3]. Although M. hyorhinis infections are frequently subclinical, they can cause polyserositis and arthritis in post-weaning pigs. In fact, 50% of polyserositis and approximately 10% of arthritis cases received annually at the Minnesota Veterinary Diagnostic Laboratory test positive for this pathogen by a Polymerase Chain Reaction (PCR)-based diagnostic testing method (Personal observations). M. hyorhinis-associated disease in finishing pigs is usually characterized by arthritis alone [4]. Other clinical presentations, including pneumonia, otitis, and conjunctivitis, have been reported [5,6]. However, the pathogenic significance of M. hyorhinis in these disease presentations is uncertain.
Evidence of heterogeneity between isolates within the M. hyorhinis species exists, including antigenic differences evidenced by seroreactivity to specific antisera [7,8], differences in virulence using in vivo models of infection [5, 9–11], and variable clinical presentation of disease between herds. While some herds are repeatedly affected by M. hyorhinis-associated arthritis, others tend to exhibit mostly polyserositis [12]. This diverse disease presentation also suggests that strains with different tissue tropisms may exist.
Molecular epidemiological techniques allow for the identification of sources of infection, tracking the spread of infectious microorganisms, and evaluating persistence or reintroduction of a pathogen in a population. Moreover, molecular epidemiology can play an important role in disease control, since molecular methods can be used to determine potential vaccine targets and predict vaccine efficacy [13, 14]. At the genome level, the use of pulsed-field gel electrophoresis (PFGE) to index variation within the M. hyorhinis species has revealed genetic diversity within the species[15,16]. ]PFGE requires relatively pure cultures and is time consuming, however, and interpretation of the resulting banding patterns can be ambiguous in some cases. Furthermore, since it identifies major genetic changes, small DNA changes will be missed [17]. Sequence-based tools, such as MLST (multilocus sequence typing), have been widely used for genotyping bacteria causing infections in pigs [18–22]. Furthermore, MLST is considered a rapid, inexpensive, repeatable, and unambiguous typing tool [23]. A traditional MLST scheme, based on the dnaA, rpoB, gyrB, gltX, adk and gmk genes, has been developed for M. hyorhinis [18, 23]. The variation reported by the authors showed a low percentage of polymorphic sites, ranging from 0.9–2.1%. A recently optimized version of the same MLST scheme evaluated the genetic diversity of 60 strains from Germany and Switzerland. Similarly, the authors reported genetic variation between strains with limited clonality [22]. While core metabolic genes are ideal for inferring phylogenic relationships, they can lack discriminatory power for differentiation of closely related strains [24]. In this manuscript, we describe the development of a novel MLST assay based on housekeeping and surface-encoding proteins to differentiate M. hyorhinis strains, termed MLST-s to reference the addition of surface proteins. Surface proteins were added to increase discriminatory power, since these genes may be subject to more intensive selective pressures compared to housekeeping genes, making them ideal for local epidemiological studies [24].
Materials and methods
Bacterial isolates, culture media and DNA extraction
A total of 104 M. hyorhinis isolates from pigs along with the M. hyorhinis type strain ATCC 17981 were studied (S1 Table). Isolates originated from the nasal cavity (n = 3), bronchus (n = 26), pericardium (n = 26), pleura (n = 21), peritoneum (n = 2) and joint (n = 19) of diseased pigs with lesions of polyserositis and a clinical history suggestive of M. hyorhinis infection (fever, depression, lameness, dyspnea). Six isolates originated from the bronchus (n = 1) and nasal cavity (n = 5) of healthy pigs. Finally, one isolate was obtained from an air sample taken from the outside of a barn housing nursery pigs. All isolates were obtained from cases submitted to the UMN Veterinary Diagnostic Laboratory from 2010 to 2012. All isolates were confirmed as M. hyorhinis utilizing a qPCR assay based on the 16S rRNA gene [25]. The isolates originated from multiple farms (nurseries, finishers, and gilt development sites) belonging to 21 different swine production systems, denoted as numbers 1–22 (no system 3) in 10 states of the US. Three isolates originated from a production system in Mexico (labeled MEX). Isolates were stored at -80°C until further testing, for which they were re-grown in 3 mL aliquots of modified Hayflick’s medium for 2 to 14 days [26]. The suspension was centrifuged, and M. hyorhinis genomic DNA was extracted using the DNeasy Blood & Tissue kit following the manufacturer’s protocol (Qiagen, Germantown, MD).
Loci selection and primer design
The whole genomes of four M. hyorhinis isolates available in GenBank (HUB-1 (NC_014448.1), GDL-1 (NC_016829.1) MCLD (NC_017519.1) and SK76 (NC_019552.1)) were utilized to identify potential target genes [27–30]. Identification of variable regions within the M. hyorhinis species was accomplished through a Clustal W progressive alignment of all 4 M. hyorhinis genomes using Mauve 2.3.1[31]. Further identification of areas of variation within different housekeeping and surface protein encoding genes, such as previously identified variable lipoproteins and adhesins [32], was performed using Geneious 7.0.6 (Biomatters, Auckland, New Zealand, http://www.geneious.com). Primers were designed using PrimerQuest® (IDT, Coralville, USA) software. In silico analysis of primer specificity was carried out using the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast). Genes with observed genetic variation between the available M. hyorhinis genomes were further tested with a subset of 6 distinct isolates originating in pigs from different production systems, ages, and geographical locations. Candidate genes were discarded if no nucleotide sequence variation was observed between these 6 isolates.
PCR conditions and sequencing
The loci selected were amplified in an Eppendorf thermal cycler (Eppendorf Mastercycler 5345, Hamburg, Germany) with a total volume of 25 μl. The reaction mixture contained 12 μl of HotStarTaq Master Mix (Qiagen, Germantown, MD), 0.8 μl of each primer (1 μM), 9.4 μl of H2O, and 2 μl of template DNA. PCR conditions were: 95°C for 15 min, followed by 35 cycles of 95°C for 1 min, 43.5°C for 1:30 mins, and 72°C for 1 min, and a final extension of 72°C for 10 min. PCR products were analyzed by electrophoresis using an 1.5% agarose gels stained with ethidium bromide, run at 120 V for 40 min, and visualized using a gel imaging system. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Germantown, MD) and bi-directionally sequenced by standard Sanger sequencing on an ABI 3730xl BigDye Terminator v 3.1 (Life Technologies, Grand Island, NY).
Data analysis
Resulting sequencing data was quality assessed, and sequences were aligned utilizing ClustalW within Geneious 7.0.6 and trimmed to equal sizes. MEGA 5.2.1 (version 5; www.megasoftware.net) was utilized to identify parsimony-informative sites. Nucleotide sequence alignments for each gene fragment were translated to assess the quality of change (synonymous or non-synonymous substitutions). Individual and concatenated dendrograms were computed using the Hasegawa-Kishino-Yano distance model and the UPGMA (unweighted pair group method with arithmetic mean) tree building method.
For each targeted locus, each distinct sequence variant was arbitrarily assigned a consecutive number starting with 1, with no weight given to the amount of nucleotide sequence variation among alleles [23]. A distinct sequence type (ST) or allelic profile number was defined for each combination of the allele numbers for each locus (i.e. 1-5-2-3). The STs were assigned consecutive numbers in order of description (i.e. ST1). Relationships among strains were evaluated using minimum spanning trees (MST) analysis, after the introduction of allelic profiles into Bionumerics software V7.1 (Applied Math, Sint Maartens-Latem, Belgium). The strains were grouped into clonal complexes, defined here “as a group of MLST genotypes in which every genotype shares at least 3 out of 4 loci in common with at least one other member of the group” (pubmlst.org/analysis/burst/burst.shtml).
Results
Selection and evaluation of M. hyorhinis MLST-s marker genes
A total of 27 genes were evaluated as potential target genes (S2 Table). All housekeeping genes except pdhB and ung were nearly identical (~ 99.5%) in all 4 annotated genomes and were therefore not included for further testing. While variation was observed within the nrdf and lspA surface protein genes when comparing the 4 annotated genomes, testing of the initial 6 M. hyorhinis isolates revealed no nucleotide sequence variation and were therefore not included for further testing. The gene sequences for vlpF and B genes were found to be highly divergent among the 4 available genomes, with no conserved flanking regions, hindering primer placement. Primers for the remaining vlp genes were designed; however, an amplicon was not obtained for vlpA, C, D and E genes. Although an amplicon was generated for the vlpG gene, the generated product had low quality and was not reproducible.
Minimal nucleotide sequence variation was observed within the cls, hexo and p37 genes and were therefore excluded from the subsequent testing of the remaining isolates. The discriminatory power of the technique was not affected after the removal of the 3 genes. Poor sequencing quality was obtained for the p3 gene and thus was excluded from further analysis. The final MLST-s protocol included: pdhB, p95, mtlD and ung (Table 1). The selected genes were dispersed throughout the M. hyorhinis genome. In silico analysis revealed no cross-reactivity between primer sequences and swine related non-targeted taxa.
Table 1. Primer sequences employed in MLST-s M. hyorhinis assay.
| Target gene | Gene name | Forward (5’-3’) | Reverse (5’-3’) |
|---|---|---|---|
| pdhB | Pyruvate dehydrogenase-E beta-1 subunit | AACGACCCAGATCCAGTTATTTT | TCGTTAATTGCGTGGAATCCTTC |
| p95 | Outer membrane protein p95 | GTTGCCAAGCAAGATGCTAAA | TGCTGAATGTACTCACCTGAAA |
| mtlD | Mannitol-1-phosphate 5-dehydrogenase | GGTGCAGGTAGCATTGGTCGTGG | GCCAAGATAACCCAAATAAGAATGC |
| ung | Uracil-dna glycosylase | GCAAGAACAAGACAAAGAAT | TAGCTAAACGGTGAAGGATGAGATA |
Relatedness of M. hyorhinis isolates
The dendrogram constructed based upon concatenated gene sequences (1441bp) revealed genetic polymorphisms among the examined isolates (S1 Fig). The nucleotide sequence variation (percent informative sites) within each gene ranged from 1.4% to 21% (Table 2), with mtlD showing the highest degree of variation and pdhB the lowest. Although nucleotide polymorphisms were observed, the majority resulted in synonymous changes in the pdhB, p95 and ung genes. In contrast, non-synonymous changes were seen within the mtlD gene (S2 Fig). Furthermore, in some instances, changes involved the switch from amino acids belonging to different groups, based on the characteristics of the side chain, polarity, or acid-base properties (i.e. alanine to serine, glutamic acid to lysine) (S2 Fig). The number of alleles per gene varied from six to 20, giving rise to 39 sequence types (STs) within the 104 isolates (Tables 2 and 3).
Table 2. Characteristics of regions used for multilocus sequence analysis and number of alleles.
| Target gene | Size (bp) | Trimmed length (bp) | Percent evaluated | Variable sitesa | Parsimony-informative sitesb | Percent informative sites (%) | No. of alleles |
|---|---|---|---|---|---|---|---|
| pdhB | 987 | 415 | 42 | 6 | 6 | 1.4 | 7 |
| p95 | 3171 | 289 | 9 | 8 | 6 | 2 | 9 |
| mtlD | 1101 | 537 | 49 | 120 | 115 | 21 | 20 |
| ung | 675 | 200 | 30 | 4 | 4 | 2 | 6 |
a A variable site contains at least two types of nucleotides or amino acids.
bA site is parsimony-informative if it contains at least two types of nucleotides (or amino acids), and at least two of them occur with a minimum frequency of two.
Table 3. Frequency and distribution of 39 M. hyorhinis STs within sample type, system, origin, and age of pig.
| ST | ST profile* | Frequency | Clonal complex | Sample type (no)† | System‡ | State of origin | Age (weeks) |
|---|---|---|---|---|---|---|---|
| 1 | 1-1-1-1 | 3 | 1 | Pericardium | 1, 21 | MN | 7,13 |
| 2 | 1-1-1-2 | 1 | 1 | Pericardium | 4 | NC | 3 |
| 3 | 1-1-1-3 | 2 | 1 | Pericardium, pleura | 8 | MN | 7 |
| 4 | 1-1-2-2 | 2 | 1 | Pleura, joint | 13, 14 | TN, IL | 7,9 |
| 5 | 1-1-2-3 | 1 | 1 | Pericardium | 8 | IA | 9 |
| 6 | 1-1-3-2 | 1 | 1 | Bronchus | 9 | NE | 13 |
| 7 | 1-1-8-2 | 2 | 1 | Joint | 13 | IL | 9 |
| 8 | 1-1-11-2 | 1 | 1 | Pleura | 17 | NC | NA |
| 9 | 1-1-16-2 | 1 | 1 | Bronchus | 6 | NE | 5 |
| 10 | 1-1-17-2 | 3 | 1 | Peritoneum (1), bronchus (2) | 5, 22 | OK, NE | 4,11 |
| 11 | 1-3-1-1 | 1 | 1 | Joint | 12 | MN | 8 |
| 12 | 1-3-1-2 | 1 | 1 | Pericardium | 7 | MN | 11 |
| 13 | 1-3-5-4 | 1 | S | Pleura | 11 | NC | 10 |
| 14 | 1-4-3-2 | 1 | 1 | Pleura | 9 | NE | 13 |
| 15 | 1-5-1-1 | 4 | 1 | Bronchus (1), pericardial (2), nasal (1) | 2 | MN | 8,11,13 |
| 16 | 1-5-1-2 | 1 | 1 | Joint | 2 | MN | 7 |
| 17 | 1-5-1-4 | 9 | 1 | Bronchus (3), joint (1), pericardium (2), pleura (3) | 5,7,10, 15,18 |
KS,MN,IN, OK | 7,8,9,11,13,50 |
| 18 | 1-5-4-1 | 5 | 1 | Bronchus(3), joint (1), nasal (1) | 2 | MN | 8,13 |
| 19 | 1-5-9-1 | 9 | 1 | Bronchus (2), joint (3) nasal (4) | 2 | MN | 6,8,13 |
| 20 | 1-5-13-1 | 1 | 1 | Pleura | 2 | MN | 8 |
| 21 | 1-6-10-2 | 1 | S | Pleura | 16 | PA | 4 |
| 22 | 1-7-18-1 | 1 | S | Pericardium | 19 | MEXICO | 20 |
| 23 | 1-8-1-1 | 1 | 1 | Pleura | 12 | MN | 5 |
| 24 | 1-8-15-2 | 1 | 2 | Pericardium | 19 | MEXICO | 8 |
| 25 | 1-8-19-2 | 1 | 2 | Pericardium | 19 | MEXICO | 10 |
| 26 | 2-1-1-2 | 1 | 1 | Nasal | REF§ | IA | NA |
| 27 | 2-2-2-2 | 4 | 3 | Pleura | 5 | KS, OK | 3,6 |
| 28 | 2-2-7-2 | 2 | 3 | Joint | NA | NA | NA |
| 29 | 3-5-1-4 | 5 | 1 | Bronchus, pericardium, pleura | 5 | OK | 8,10 |
| 30 | 3-5-14-1 | 2 | S | Aerosol, bronchus | 8 | MN | 6 |
| 31 | 4-3-14-5 | 5 | S | Pericardium | 5 | OK | 8 |
| 32 | 4-5-15-2 | 6 | S | Nasal cavity, pleura | 5 | OK | 4,5 |
| 33 | 5-5-4-1 | 1 | 1 | Nasal | 2 | MN | 8 |
| 34 | 5-5-4-2 | 1 | 1 | Pericardium | 2 | MN | 6 |
| 35 | 5-5-9-1 | 8 | 1 | Bronchus (2), joint (3), pericardial (2), pleura (1) | 2 | MN | 8 |
| 36 | 6-1-6-2 | 2 | S | Joint | NA | NA | NA |
| 37 | 7-3-12-2 | 13 | S | Bronchus (8), nasal cavity (3), pericardium (2) | 7 | MN | 14 |
| 38 | 7-8-3-2 | 1 | S | Pericardium | 20 | MN | 10 |
| 39 | 7-9-20-6 | 1 | S | Nasal | HUB-1¦ | CHINA | NA |
* Order of allele number for each locus: pdhB, p95, mtlD and ung
† Type of sample where isolate was obtained
‡ Systems are defined as the same owner and denoted as a number from 1–22
NA = not available
S = singleton, not part of a clonal complex
§ Reference strain (ATCC 17981)
¦ HUB-1 reference genome (GenBank)
Frequency and distribution of M. hyorhinis sequence types (ST)
The most frequent ST, ST37, was observed 13 times. Eighteen STs contained between 2 and 9 isolates, and 21 STs contained only one isolate. Minimum spanning tree analysis showed the grouping of 39 STs into 3 clonal complexes (CC), with CC1 encompassing more STs (n = 25) and isolates (n = 66) than any other clonal complex. CC2 and CC3 contained 2 STs each and a total of 2, and 6 isolates, respectively. Lastly, singletons, defined as isolates which share less than 3 out of 4 loci with another member of a clonal complex, were identified 10 times and included 30 isolates (Fig 1).
Fig 1. Minimum spanning tree analysis for 104 M. hyorhinis isolates.
Each circle corresponds to a sequence type (ST). Size of the circle represents numbers of isolates with same ST. Lines between STs indicate inferred phylogenetic relationships. Thickness of the line represents the number of allelic mismatches between the STs (bold = 1, plain = 2, dotted = 3). Grey zones that surround STs belong to the same clonal complex (CC). Number near circles indicates ST number. Color of the circle indicates the swine production system. Legend: “size” indicates number of isolates and “system” indicates system number.
ST37, the most frequent subtype, and ST19 contained isolates from only one management system (system 7 and 2, respectively), where specimens were collected the same day during an M. hyorhinis outbreak investigation (Table 3). Furthermore, two isolates from the upper respiratory tract (nasal cavity or bronchus) and pericardium were obtained from the same pig, evidencing that isolates recovered from systemic sites of diseased pigs can be also found in the nasal cavity or bronchi. ST19 was represented by isolates of healthy pigs from the nasal cavity or bronchi and diseased pigs from joints originating from system 2 in 2010 through 2012. Isolates with different STs (ST18 and ST35), however, were also obtained from pigs from that system during the same time frame (Table 3). Furthermore, in system 2, isolates from the pleura and bronchus of the same pig had different STs, differing by only one allele (mltD). In system 5, isolates in different U.S. states shared the same ST, suggesting a point source introduction. In contrast, 5 different STs were identified within the same system (Figs 1,2 and 3).
Fig 2. Minimum spanning tree analysis for 104 M. hyorhinis isolates.
Each circle corresponds to a sequence type (ST). Size of the circle represents numbers of isolates with same ST. Lines between STs indicate inferred phylogenetic relationships. Thickness of the line represents the number of allelic mismatches between the STs (bold = 1, plain = 2, dotted = 3). Grey zones that surround STs belong to the same clonal complex (CC). Number near circles indicates ST number. Color of circle represents the geographical location. Legend: “size” indicates number of isolates and “location” indicates the geographical location of the ST.
Fig 3. Minimum spanning tree analysis for 104 M. hyorhinis isolates.
Each circle corresponds to a sequence type (ST). Size of the circle represents numbers of isolates with same ST. Lines between STs indicate inferred phylogenetic relationships. Thickness of the line represents the number of allelic mismatches between the STs (bold = 1, plain = 2, dotted = 3). Grey zones that surround STs belong to the same clonal complex (CC). Number near circles indicates ST number. Color of circle represents type of sample. Legend: “size” indicates number of isolates and “sample type” indicates the anatomical location where the ST originated.
The isolates from ST17 (n = 9) originated from systemic sites of pigs of wide age distribution (7–50 weeks), and from 5 different systems in 4 different states collected in 2010–2012 (Table 3). It is important to note that information gathered for each isolate included “system,” which refers to the ownership of the pigs but lacks information on the pig flow or site. Therefore, the epidemiological interpretation of the data presented here may be limited since one system can be comprised of multiple producers who submit cases independently but share the same origin of pigs.
The reference strain HUB-1, originating from China, as well as the strains originating from Mexico showed unique STs. CC2 was comprised of isolates from the same system in Mexico (Table 3), while CC3 included isolates from different systems. Finally, no evident relationships were observed with respect to the age of the pig, lesion type, year, or US state of origin (Figs 1,2 and 3). However, strains originating from different countries (US, China and Mexico) clustered in distinct clonal complexes or as singletons. Additionally, there was no evidence of a specific ST being associated with virulence.
Discussion
The objective of this study was to develop an MLST-s typing scheme for epidemiological and genetic characterization of M. hyorhinis field isolates. The novel scheme was utilized on a set of 104 well-characterized isolates from various tissue types, swine production systems, ages and geographic locations. Twenty-seven loci were evaluated as potential gene targets; however, many of these loci were almost identical in 4 previously published M. hyorhinis genomes and therefore not pursued further. A previously published and later optimized MLST scheme, showed an overall low percentage of polymorphic sites within each of the included housekeeping genes [21, 22]. In view of the limited genetic variation observed in housekeeping genes, more variable genes, such as surface protein encoding genes, were incorporated. This modification could increase the possibility of detecting more genetic variation, making it useful for typing during localized disease outbreaks and studying the pathogenesis of M. hyorhinis [24]. In contrast, variable lipoprotein encoding genes revealed an immense amount of variation between the available genomes, lacking conserved areas for primer placing. These findings were somewhat anticipated given the fact that the genes coding for these lipoproteins are under constant change, either through recombination or high-frequency mutations, which affects their expression and size [33, 34].
The final MLST-s protocol contained 2 core housekeeping genes, pdhB and ung, with an observed variation between 1.4–2% resulting in 6 and 7 different allele types, respectively. Similar amounts of variation have also been observed within housekeeping genes in previously published MLST schemes for M. hyopneumoniae, M. agalactiae, M. bovis and M. hyorhinis [20–22, 35, 36]. One unanticipated finding was the little to no variation observed within widely recognized adhesins, such as p37 and p95. The recent sequencing of the complete p37 gene in 33 unrelated isolates from France showed 18 different nucleotide sequences.[21] Although variation was observed, the previous study concluded that the discriminatory power was relatively poor and that single-gene typing methods can fail at differentiating isolates that have a reduced variation. One possible explanation for the lack of variation is that the proteins encoded by these genes may be essential for host colonization and survivability [37]. In fact, it has been shown that truncated versions of certain adhesins within another swine mycoplasma species, M. hyopneumoniae, contribute to loss of virulence [38].
Even though variation was observed within pdhB, p95 and the ung loci, these nucleotide changes resulted in mostly synonymous changes. These findings are in accordance with previous results, where the genetic variation observed in housekeeping genes generally led to synonymous changes [21]. On the other hand, the surface protein-encoding gene mtlD showed great variation (~ 21%) within the analyzed sequences and more than 20 different alleles. The predicted amino acid sequence alignment of mtlD revealed multiple non-synonymous changes. In some cases, the changes were between amino acids of different chemical groups. Future studies should evaluate if these changes influence the antigenic variation of this species due to the protein location on the bacterial surface or if the changes contribute to virulence.
Modified MLST protocols are not novel. Hyper-variable genes have been incorporated into typing schemes for M. agalactiae, M. capricolum and B. pertussis [35, 39, 40]. In all cases, an increase in discriminatory power was obtained; in some cases, this modification led to the identification of MLST profiles associated with epidemics and globally distributed strains [40]. The increased ability to discriminate between isolates during an epidemic or outbreak investigation might be at the cost of the interpretation of observed evolutionary relationships [24]. In this study, most systems had at least two STs within a 2-year period, and most frequently the strains differed at the mtlD loci, evidencing that the addition of hyper-variable genes might be a useful tool for local epidemiological investigations.
The present study showed high genetic variation within the M. hyorhinis species, with multiple STs circulating within US swine herds. The MLST-s scheme presented here was revealed to be highly discriminatory, capable of subdividing 104 isolates into 39 distinct STs. Multiple STs were found within a single system and an individual pig during the same time frame. Yet, frequently, isolates from the same farm shared the same ST. ST17 included isolates from 5 different production systems. This result could indicate the dissemination of a clone that may be a more successful pathogen, the existence of an organism with a longer persistence and survivability, or a common gilt source between the systems. It could also be due to the convenient nature of the sampling performed here [35]. In contrast to the observed sharing of ST17 between systems, the majority of STs with more than one isolate originated from the same system.
No correlation between STs and the age of the pig, year of isolation, sample type, pathogenicity, and state of US origin was observed. These observations are in accordance with others [22,41]. However, in this study three distinct clonal complexes, two of which included strains from the US and one that exclusively contained strains from Mexico, were identified. This is in contrast with the findings generated with the previously published MLST scheme, where only one clonal complex was identified in each data set, that included isolates from three different countries [21, 22]. This finding suggests that the novel MLST-s presented here could have a higher discriminatory power compared to previously published schemes, possibly due to the addition of more variable genes. However, this study lacked a side by side comparison and therefore further research is required to test such hypothesis. Finally, it is possible that the over-representation of isolates in this dataset from diseased pigs could have hindered the identification of virulence-associated STs.
Currently, swine practitioners are faced with the challenge of controlling M. hyorhinis disease in affected post-weaning pigs. The application of the MLST-s protocol described here has resulted in better understanding of the diversity of M. hyorhinis field isolates circulating in US swine herds. This tool could help to elucidate further features of the epidemiology and dynamics of infection for this pathogen, understand disease outbreaks, assist with selection of isolates for vaccine production, and identify the potential origin of a specific isolate.
Supporting information
(DOCX)
(DOCX)
Data was analyzed in Geneious using the UPGMA tree method based on the Hasegawa-Kishino-Yano model. A total of 1,441 positions were employed in the final dataset and 1500 bootstrap replicates. Scale represents nucleotide substitutions per site.
(TIF)
Arrows indicate areas of non-synonymous changes between aligned sequences where the amino acid change was between different amino acid groups, based on polarity, pH level or side chain. Arrows from left to right: lysine (basic) vs. glutamic acid (acid), alanine (non-polar) vs. serine (polar) phenylalanine (aliphatic group) vs. leucine (aromatic).
(PNG)
(CSV)
Acknowledgments
The authors would like to thank Dr. Michael Murtaugh and Mi Yang for their support on data analysis.
Data Availability
All relevant data are within the paper. Under supporting files, an excel file is available, where all 104 concatenated sequences (4 genes) for each isolate can be found.
Funding Statement
This study was funded by The National Pork Board (grant #12-044) to AR and MC and by intramural funding from the College of Veterinary Medicine University of Minnesota– EZD program 2012 to MC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Rovira A, Clavijo MJ, Oliveira S. Mycoplasma hyorhinis infection of pigs. Acta Sci Vet. 2010;38(Suppl 1): s9–15. [Google Scholar]
- 2.Clavijo MJ, Murray D, Oliveira S, Rovira A. Infection dynamics of Mycoplasma hyorhinis in three commercial pig populations. Vet Rec. 2017. July 15;18(3): 68 10.1136/vr.104064 [DOI] [PubMed] [Google Scholar]
- 3.Kobisch M, Friis NF. Swine mycoplasmoses. Rev Sci Tech. 1996. December;15(4): 1569–605. 10.20506/rst.15.4.983 [DOI] [PubMed] [Google Scholar]
- 4.Neto JG, Gauger PC, Strait EL, Boyes N, Madson DM, Schwartz KJ. Mycoplasma-associated arthritis: critical points for diagnosis. J Swine Health Prod. 2012. March 1;20(2): 82–6. [Google Scholar]
- 5.Goiš M, Pospíšil Z, Černy M, Mrva V. Production of pneumonia after intranasal inoculation of gnotobiotic piglets with three strains of Mycoplasma hyorhinis. J Comp Pathol. 1971. July 1;81(3): 401–10. 10.1016/0021-9975(71)90028-4 [DOI] [PubMed] [Google Scholar]
- 6.Friis NF. A serologic variant of Mycoplasma hyorhinis recovered from the conjunctiva of swine. Acta Veterinaria Scandinavica. 1976;17(3): 343–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Friis NF. Mycoplasmas cultivated from the respiratory tract of Danish pigs. Acta Veterinaria Scandinavica. 1971;12(1): 69–79. [PubMed] [Google Scholar]
- 8.Rosengarten R, Wise KS. Phenotypic switching in mycoplasmas: phase variation of diverse surface lipoproteins. Science. 1990. January 19;247(4940): 315–8. 10.1126/science.1688663 [DOI] [PubMed] [Google Scholar]
- 9.Schulman A, Estola T, Garry-Andersson AS. On the occurrence of Mycoplasma hyorhinis in the respiratory organs of pigs, with special reference to enzootic pneumonia. Zentralbl Veterinarmed B. 1970. May;17(5): 549–53. 10.1111/j.1439-0450.1970.tb01565.x [DOI] [PubMed] [Google Scholar]
- 10.Goiš M, Kuksa F. Intranasal infection of gnotobiotic piglets with Mycoplasma hyorhinis: differences in virulence of the strains and influence of age on the development of infection. Zoonoses Public Health. 1974. June 1;21(5): 352–61. [DOI] [PubMed] [Google Scholar]
- 11.Kinne J, Johannsen U, Neumann R, Mehlhorn G, Pfützner H. The pathology and pathogenesis of experimental Mycoplasma hyorhinis infection of piglets with and without thermomotoric stress. 1. Pathologic-anatomic, histologic and immunomorphologic study results. Zentralbl Veterinarmed A. 1991. May;38(4): 306–20. [PubMed] [Google Scholar]
- 12.Clavijo MJ, Davies P, Morrison R, Bruner L, Olson S, Rosey E, et al. Temporal patterns of colonization and infection with Mycoplasma hyorhinis in two swine production systems in the US. Vet Microbiol. 2019. July 234 p 110–118. 10.1016/j.vetmic.2019.05.021 [DOI] [PubMed] [Google Scholar]
- 13.Zadoks RN, Schukken YH. Use of molecular epidemiology in veterinary practice. Vet Clin North Am Food Anim Pract. 2006. March 1;22(1): 229–61. 10.1016/j.cvfa.2005.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tankouo-Sandjong B, Sessitsch A, Liebana E, Kornschober C, Allerberger F, Hächler H, et al. MLST-v, multilocus sequence typing based on virulence genes, for molecular typing of Salmonella enterica subsp. enterica serovars. J Microbiol Methods. 2007. April 30;69(1): 23–36. 10.1016/j.mimet.2006.11.013 [DOI] [PubMed] [Google Scholar]
- 15.Barlev NA, Borchsenius SN. Continuous distribution of Mycoplasma genome 443 sizes. Biomed. Sci. 1991;2: 641–645. [PubMed] [Google Scholar]
- 16.Yamaguti M, Oliveira RC, Marques LM, Buzinhani M, Buim MR, Neto RL, et al. Molecular characterization of Mycoplasma hyorhinis isolated from pigs using pulsed-field gel electrophoresis and 16S rRNA sequencing. Vet Record Open. 2015. November 30;2(2): e000093 10.1136/vetreco-2014-000093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995. September;33(9): 2233–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.King SJ, Leigh JA, Heath PJ, Luque I, Tarradas C, Dowson CG, et al. Development of a multilocus sequence typing scheme for the pig pathogen Streptococcus suis: identification of virulent clones and potential capsular serotype exchange. J Clin Microbiol. 2002. October 1;40(10): 3671–80. 10.1128/JCM.40.10.3671-3680.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Olvera A, Cerda-Cuellar M, Aragon V. Study of the population structure of Haemophilus parasuis by multilocus sequence typing. Microbiology. 2006. December 1;152(Pt 12): 3683–90. 10.1099/mic.0.29254-0 [DOI] [PubMed] [Google Scholar]
- 20.Mayor D, Jores J, Korczak BM, Kuhnert P. Multilocus sequence typing (MLST) of Mycoplasma hyopneumoniae: a diverse pathogen with limited clonality. Vet Microbiol. 2008. February 5;127(1–2): 63–72. 10.1016/j.vetmic.2007.08.010 [DOI] [PubMed] [Google Scholar]
- 21.Tocqueville V, Ferré S, Nguyen NH, Kempf I, Marois-Créhan C. Multilocus sequence typing of Mycoplasma hyorhinis strains identified by a real-time TaqMan PCR assay. J Clin Microbiol. 2014. May 1;52(5): 1664–71. 10.1128/JCM.03437-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Trüeb B, Catelli E, Luehrs A, Nathues H, Kuhnert P. Genetic variability and limited clonality of Mycoplasma hyorhinis in pig herds. Vet Microbiol. 2016. August 15;191: 9–14. 10.1016/j.vetmic.2016.05.015 [DOI] [PubMed] [Google Scholar]
- 23.Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A. 1998. March 17;95(6): 3140–5. 10.1073/pnas.95.6.3140 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Cooper JE, Feil EJ. Multilocus sequence typing–what is resolved? Trends Microbiol. 2004;12(8): 373–377. 10.1016/j.tim.2004.06.003 [DOI] [PubMed] [Google Scholar]
- 25.Clavijo MJ, Oliveira S, Zimmerman J, Rendahl A, Rovira A. Field evaluation of a quantitative polymerase chain reaction assay for Mycoplasma hyorhinis. J Vet Diagn Invest. 2014. November;26(6): 755–60. 10.1177/1040638714555175 [DOI] [PubMed] [Google Scholar]
- 26.Lefèvre PC, Jones GE, Ojo MO. Pulmonary mycoplasmoses of small ruminants. Rev Sci Tech Off int Epiz. 1987;6(3): 713–757. [DOI] [PubMed] [Google Scholar]
- 27.Liu W, Fang L, Li S, Li Q, Zhou Z, Feng Z, et al. Complete genome sequence of Mycoplasma hyorhinis strain HUB-1. J Bacteriol. 2010. November 1;192(21): 5844–5. 10.1128/JB.00946-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Calcutt MJ, Foecking MF, Rosales RS, Ellis RJ, Nicholas RA. Genome sequence of Mycoplasma hyorhinis strain GDL-1. J Bacteriol. 2012. April;194(7): 1848 10.1128/JB.00033-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kornspan JD, Lysnyansky I, Kahan T, Herrmann R, Rottem S, Nir-Paz R. Genome analysis of a Mycoplasma hyorhinis strain derived from a primary human melanoma cell line. J Bacteriol. 2011. September 1;193(17): 4543–4. 10.1128/JB.05505-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Goodison S, Urquidi V, Kumar D, Reyes L, Rosser CJ. Complete genome sequence of Mycoplasma hyorhinis strain SK76. Genome Announc. 2013. February 28;1(1). pii: e00101–12. 10.1128/genomeA.00101-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Darling AE, Mau B, Perna NT. progressive Mauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One. 2010. June 25;5(6): e11147 10.1371/journal.pone.0011147 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Siqueira FM, Thompson CE, Virginio VG, Gonchoroski T, Reolon L, Almeida LG, et al. New insights on the biology of swine respiratory tract mycoplasmas from a comparative genome analysis. BMC genomics. 2013. March 14;14(1): 175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Citti C, Wise KS. Mycoplasma hyorhinis vlp gene transcription: critical role in phase variation and expression of surface lipoproteins. Mol Microbiol. 1995. November;18(4): 649–660. 10.1111/j.1365-2958.1995.mmi_18040649.x [DOI] [PubMed] [Google Scholar]
- 34.Citti C, Blanchard A. Mycoplasmas and their host: emerging and re-emerging minimal pathogens. Trends Microbiol. 2013. April;21(4): 196–203. 10.1016/j.tim.2013.01.003 [DOI] [PubMed] [Google Scholar]
- 35.McAuliffe L, Gosney F, Hlusek M, De Garnica ML, Spergser J, Kargl M, et al. Multilocus sequence typing of Mycoplasma agalactiae. J Medical Microbiol. 2011. June 1;60(Pt 6): 803–11. 10.1099/jmm.0.028159-0 [DOI] [PubMed] [Google Scholar]
- 36.Manso-Silván L, Dupuy V, Lysnyansky I, Ozdemir U, Thiaucourt F. Phylogeny and molecular typing of Mycoplasma agalactiae and Mycoplasma bovis by multilocus sequencing. Vet Microbiol. 2012. December 28;161(1–2): 104–12. 10.1016/j.vetmic.2012.07.015 [DOI] [PubMed] [Google Scholar]
- 37.Razin S. Peculiar properties of mycoplasmas: the smallest self-replicating prokaryotes. FEMS microbiology letters. 1992. December 15;100(1–3): 423–31. 10.1111/j.1574-6968.1992.tb14072.x [DOI] [PubMed] [Google Scholar]
- 38.Liu W, Xiao S, Li M, Guo S, Li S, Luo R, et al. Comparative genomic analyses of Mycoplasma hyopneumoniae pathogenic 168 strain and its high-passaged attenuated strain. BMC genomics. 2013. December;14(1):80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Manso-Silván L, Dupuy V, Chu Y, Thiaucourt F. Multi-locus sequence analysis of Mycoplasma capricolum subsp. capripneumoniae for the molecular epidemiology of contagious caprine pleuropneumonia. Vet Res. 2011. July 14;42(1): 86 10.1186/1297-9716-42-86 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.van Loo IH, Heuvelman KJ, King AJ, Mooi FR. Multilocus sequence typing of Bordetella pertussis based on surface protein genes. J Clin Microbiol. 2002. June 1;40(6): 1994–2001. 10.1128/JCM.40.6.1994-2001.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.dos Santos LF, Clavijo MJ, Sreevatsan S, Rovira A, Moreira MA, Pieters M. Genotyping of Mycoplasma hyorhinis using multiple-locus variable number tandem repeat analysis. J Microbiol Methods. 2015. April 30;111: 87–92. 10.1016/j.mimet.2015.02.003 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX)
(DOCX)
Data was analyzed in Geneious using the UPGMA tree method based on the Hasegawa-Kishino-Yano model. A total of 1,441 positions were employed in the final dataset and 1500 bootstrap replicates. Scale represents nucleotide substitutions per site.
(TIF)
Arrows indicate areas of non-synonymous changes between aligned sequences where the amino acid change was between different amino acid groups, based on polarity, pH level or side chain. Arrows from left to right: lysine (basic) vs. glutamic acid (acid), alanine (non-polar) vs. serine (polar) phenylalanine (aliphatic group) vs. leucine (aromatic).
(PNG)
(CSV)
Data Availability Statement
All relevant data are within the paper. Under supporting files, an excel file is available, where all 104 concatenated sequences (4 genes) for each isolate can be found.



