Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Induces Interleukin-17 Production via Activation of the IRAK1-PI3K-p38MAPK-C/EBPβ/CREB Pathways

Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) associated with severe pneumonia has been one of the most important viral pathogens in pigs. IL-17 is a proinflammatory cytokine that might be associated with the strong inflammation caused by PRRSV. Therefore, we sought to determine whether PRRSV infection affects IL-17 expression, and if so, determine this might partially explain the underlying mechanisms for the strong inflammation in HP-PRRSV-infected pigs, especially in lungs. Here, we show that PRRSV significantly induced IL-17 expression, and we subsequently dissected the molecular mechanisms about how PRRSV regulated IL-17 production. Furthermore, we show that Ser74 and Phe76 in nsp11 were indispensable for IL-17 production and viral replication. Importantly, we demonstrated that PI3K inhibitor impaired IL-17 production and alleviated lung inflammation caused by HP-PRRSV infection. Our findings will help us for a better understanding of PRRSV pathogenesis.

ABSTRACT

Porcine reproductive and respiratory syndrome virus (PRRSV) is widely prevalent in pigs, resulting in significant economic losses worldwide. A compelling impact of PRRSV infection is severe pneumonia. In the present study, we found that interleukin-17 (IL-17) was upregulated by PRRSV infection. Subsequently, we demonstrated that PI3K and p38MAPK signaling pathways were essential for PRRSV-induced IL-17 production as addition of phosphatidylinositol 3-kinase (PI3K) and p38MAPK inhibitors dramatically reduced IL-17 production. Furthermore, we show here that deleting the C/EBPβ and CREB binding motif in porcine IL-17 promoter abrogated its activation and that knockdown of C/EBPβ and CREB remarkably impaired PRRSV-induced IL-17 production, suggesting that IL-17 expression was dependent on C/EBPβ and CREB. More specifically, we demonstrate that PRRSV nonstructural protein 11 (nsp11) induced IL-17 production, which was also dependent on PI3K-p38MAPK-C/EBPβ/CREB pathways. We then show that Ser74 and Phe76 amino acids were essential for nsp11 to induce IL-17 production and viral rescue. In addition, IRAK1 was required for nsp11 to activate PI3K and enhance IL-17 expression by interacting with each other. Importantly, we demonstrate that PI3K inhibitor significantly suppressed IL-17 production and lung inflammation caused by HP-PRRSV in vivo, implicating that higher IL-17 level induced by HP-PRRSV might be associated with severe lung inflammation. These findings provide new insights onto the molecular mechanisms of the PRRSV-induced IL-17 production and help us further understand the pathogenesis of PRRSV infection.

IMPORTANCE Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) associated with severe pneumonia has been one of the most important viral pathogens in pigs. IL-17 is a proinflammatory cytokine that might be associated with the strong inflammation caused by PRRSV. Therefore, we sought to determine whether PRRSV infection affects IL-17 expression, and if so, determine this might partially explain the underlying mechanisms for the strong inflammation in HP-PRRSV-infected pigs, especially in lungs. Here, we show that PRRSV significantly induced IL-17 expression, and we subsequently dissected the molecular mechanisms about how PRRSV regulated IL-17 production. Furthermore, we show that Ser74 and Phe76 in nsp11 were indispensable for IL-17 production and viral replication. Importantly, we demonstrated that PI3K inhibitor impaired IL-17 production and alleviated lung inflammation caused by HP-PRRSV infection. Our findings will help us for a better understanding of PRRSV pathogenesis.

INTRODUCTION

Porcine reproductive and respiratory syndrome (PRRS) is one of the most severe swine diseases widely prevalent in the world. Typical clinical symptoms of PRRS are reproductive failures in pregnant sows and respiratory disorders in piglets (1, 2). The pathogenic agent is porcine reproductive and respiratory syndrome virus (PRRSV), which is an enveloped, single positive-stranded RNA virus (3). PRRSV genome is approximately 15.4 kb in length and contains at least 11 open reading frames (ORFs), encoding 8 structural proteins and at least 16 nonstructural proteins: nsp1α, nsp1β, nsp2TF, nsp2N, nsp2-6, nsp7α, nsp7β, and nsp8-12 (4). PRRSV is highly restricted to monocyte/macrophage lineage and replicates preferentially in porcine alveolar macrophages (PAMs) and subsets of macrophages in lymphoid tissues (5). In 2006, highly pathogenic PRRSV (HP-PRRSV) emerged in China, causing high fever, high mortality, and high morbidity in infected pig herds. Since then, HP-PRRSV has become the dominant circulating PRRSV strain in China, resulting in economic losses for the swine industry (6, 7).

Interleukin-17 (IL-17), first cloned in 1993, is an important proinflammatory cytokine (8). A broad range of cells, including Th17 cells, CD8⁺ T cells, γδT cells, natural killer (NK) cells, NKT cells, and neutrophils, could produce IL-17 during immune responses (9, 10). Some studies have shown that macrophages also have the ability to produce IL-17 (11, 12). Cellular responses to IL-17 require the expressed IL-17RA and IL-17RC, which are ubiquitous in most tissues and cell lines. IL-17 binds to the heterodimeric IL-17RA/C receptor to activate many common signaling pathways, including NF-κB, mitogen-activated protein kinases (MAPKs), and C/EBPs, to induce the expression of inflammatory cytokines, chemokines and granulocyte colony-stimulating factor (10, 13). IL-17 also results in the selective recruitment of neutrophils into the inflamed tissue and increased release of chemokines (14). In addition, IL-17 enhances the effects of interleukin-1β (IL-1β) and tumor necrosis factor alpha (TNF-α). For example, IL-17 in combination with either IL-1β or TNF-α particularly increases prostaglandin E₂ production (15). Therefore, IL-17 is considered an important proinflammatory factor in the cytokine network.

HP-PRRSV infection is associated with severe lung inflammation and injury, and lung edema, hemorrhage, pneumonia, and peribronchiolitis are quickly observed after HP-PRRSV infection (16). In addition, proinflammatory cytokines are consistently and highly expressed, particularly IL-1 and TNF-α (17). Amounts of inflammatory cells, including mononuclear macrophages, neutrophils, and mast cells, infiltrate alveolar spaces (18). As a proinflammatory cytokine, IL-17 has been shown to play critical roles in the immune response, causing increased tissue inflammation and immune-mediated tissue injury and linking innate and adaptive immunity (14, 19). For example, IL-17 levels are elevated in H1N1-infected mouse lungs, and IL-17-deficient mice have ameliorated acute lung injury (20). Moreover, secretion of IL-17 is increased in the model of chronic obstructive pulmonary disease, and IL-17RA-deficient mice are protected from both airway inflammation and fibrosis (21). These reports imply that IL-17 is an important pathogenic factor for pneumonia. Therefore, we seek to determine whether HP-PRRSV infection affects IL-17 expression.

In the study, we demonstrated that HP-PRRSV infection induced IL-17 upregulation in alveolar macrophages, serum, and bronchoalveolar lavage fluid (BALF). Subsequently, we showed that activation of IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathways was required for HP-PRRSV to induce IL-17 production. Of the PRRSV proteins, nsp11 was proved to induce IL-17 production, in which Ser74 and Phe76 play an essential role in IL-17 induction. Most importantly, phosphatidylinositol 3-kinase (PI3K) inhibitor suppressed IL-17 production and relieved lung inflammation in HP-PRRSV-infected pigs. Our study provides further information for our better understanding of PRRSV pathogenesis.

RESULTS

PRRSV infection induces IL-17 expression.

To investigate whether PRRSV infection influences IL-17 expression, we infected porcine alveolar macrophages (PAMs) with HP-PRRSV and examined IL-17 expression by real-time PCR at the indicated times postinfection. Our results showed that infection with HP-PRRSV, but not heat-inactivated HP-PRRSV, significantly induced IL-17 mRNA expression in PAMs. It was upregulated about 20- and 30-fold at 36 and 48 h postinfection, respectively (Fig. 1A). The upregulation of IL-17 was in a dose-dependent manner (Fig. 1B). Correspondingly, the IL-17 protein level measured by enzyme-linked immunosorbent assay (ELISA) was significantly elevated in the culture supernatant of PAMs infected with HP-PRRSV (Fig. 1C). In addition, we showed that classical PRRSV strain CH1a also significantly induced IL-17 mRNA expression in PAMs (Fig. 1D). These data suggest that PRRSV infection can upregulate IL-17 production.

FIG 1.

IL-17 was upregulated by PRRSV infection. (A) PAMs were inoculated with medium alone, HP-PRRSV (HV isolate), or heat-inactivated HP-PRRSV (HV isolate) at an MOI of 0.1. Total RNA was extracted from cell lysates at 12, 24, 36, and 48 h postinoculation. Real-time PCR was used to analyze IL-17 expression. Results were normalized to GAPDH and are expressed as the fold induction over medium alone. (B) PAMs were either mock infected or infected with HP-PRRSV (HV isolate) at MOIs of 0.01, 0.1, and 0.5 for 48 h, and total RNA was extracted for detection by real-time PCR. (C) Supernatants were harvested at the indicated times after HP-PRRSV infection (MOI = 0.1) to measure IL-17 production by ELISA. ND, not detected. (D) PAMs were inoculated with medium or CH1a at an MOI of 0.1. Total RNA was extracted at 12, 24, 36, and 48 h postinoculation, and IL-17 mRNA was analyzed by real-time PCR. The data are representative of three independent experiments (means ± the standard errors of the mean [SEM]). *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001 (Student t test).

The PI3K-p38MAPK signaling pathway is essential for PRRSV-induced IL-17 production.

To explore the mechanism underlying the enhanced production of IL-17 after PRRSV infection, PAMs were pretreated with dimethyl sulfoxide (DMSO) or inhibitors of the key signaling pathways, including p38MAPK, PI3K, MEK, JNK, mTOR, PKC, AP-1, and NF-κB, followed by HP-PRRSV infection 1 h later. At 48 h postinfection, IL-17 expression was analyzed. As shown in Fig. 2A, HP-PRRSV-induced IL-17 expression was observably diminished by the addition of PI3K inhibitor (LY294002) and p38MAPK inhibitor (SB203580) (ca. 87 and 75% decreases, respectively). However, inhibition of MEK (AZD8330), JNK (SP600125), mTOR (KU-0063794), PKC (GF109203X), and NF-κB (BAY11-7082) signal pathways had no significant effects on IL-17 production. To further confirm the effects of PI3K and p38MAPK inhibitors, we treated PAMs with PI3K or p38MAPK inhibitor at different concentrations, followed by infection with HP-PRRSV for 48 h. As expected, the inhibitory effects of both inhibitors occurred in a dose-dependent manner (Fig. 2B), while HP-PRRSV replication was not affected at the used concentrations (Fig. 2C). These results suggest that PI3K and p38MAPK signal pathways are involved in HP-PRRSV-induced IL-17 production.

FIG 2.

The PI3K-p38MAPK pathway is essential for PRRSV-induced IL-17 production. (A) PAMs were pretreated with inhibitors of p38MAPK (SB203580, SB), PI3K (LY294002, LY), ERK1/2 (AZD8330, AZD), mTOR (KU-0063794, KU), PKC (GF109203X, GF), AP-1 (SR11302, SR), NF-κB (BAY11-7082, BAY), or DMSO control, and 1 h later the cells were inoculated with or without HP-PRRSV (HV isolate) (MOI = 0.1). After 48 h, IL-17 mRNA was analyzed by real-time PCR. (B) PAMs were pretreated with PI3K inhibitor (LY294002) and p38MAPK inhibitor (SB203580) at different doses, and 1 h later the cells were infected with HP-PRRSV (HV isolate) (MOI = 0.1). After 48 h, the total RNAs were extracted for analyzing IL-17 mRNA by real-time PCR. (C) PRRSV ORF7 mRNA was analyzed. (D) PAMs were inoculated with HP-PRRSV (HV isolate) (MOI = 0.1), and cells were harvested at 0, 6, 12, and 24 h postinfection. Western blotting was used to examine the levels of p-AKT, total-AKT, p-p38MAPK, total-p38MAPK, and β-actin. (E) PAMs were pretreated with PI3K inhibitor (LY294002) at different doses, or DMSO control, and 1 h later the cells were inoculated with or without HP-PRRSV (HV isolate) (MOI = 0.1). After 24 h, the cells were harvested and lysed for Western blot analysis to determine the levels of p-AKT, total-AKT, p-p38MAPK, total-p38MAPK, and β-actin. The data are representative of three independent experiments (means ± the SEM). *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ns, not significant (Student t test).

To investigate whether PI3K and p38MAPK are activated after HP-PRRSV infection, PAMs infected with HP-PRRSV were collected at different times postinfection for Western blot analysis. As shown in Fig. 2D, the phosphorylation levels of AKT and p38MAPK were increased in HP-PRRSV-infected PAMs. It has been reported that p38MAPK can be phosphorylated by PI3K (22, 23). Thus, to further investigate whether HP-PRRSV-induced p38MAPK activation is through PI3K, we treated PAMs with increasing concentrations of PI3K inhibitor and then infected PAMs with HP-PRRSV 1 h later. The results showed that the phosphorylated p38MAPK induced by HP-PRRSV was impaired by PI3K inhibitor (Fig. 2E). Together, these results demonstrate that PRRSV infection induces IL-17 production by activating PI3K and p38MAPK pathways in PAMs.

C/EBPβ and CREB response elements are critical for PRRSV to activate porcine IL-17 promoter.

To gain further knowledge of the transcriptional regulation mechanism of PRRSV-induced IL-17 production, we cloned a 2,550-bp fragment of the 5′-flanking region of porcine IL-17 gene. To assess the activity of porcine IL-17 promoter and to determine the region responding to PRRSV infection, pGL3 luciferase reporter plasmids encoding a series of truncated deletions were constructed (Fig. 3A). Marc-145 cells transfected with these constructs were then infected with PRRSV or left uninfected. Luciferase assay showed that all the constructs, except the construct −83/+56-luc, exhibited higher luciferase activities after PRRSV infection. Among them, −263/+56-luc was more efficiently activated by PRRSV, which manifested a 3-fold induction over its basal-level activity (Fig. 3B). This observation suggests that the region from positions −263 to +56 in the porcine IL-17 promoter is sufficient for PRRSV-induced promoter activity and that the regulatory elements might exist in this region. Using bioinformatics analysis (http://www.cbrc.jp/research/db/TFSEARCH.html [24, 25]), we found that there were several putative transcriptional regulatory elements located in this region, including C/EBPβ (−234 to −227 and −194 to −186), CREB (−154 to −145 and −129 to −123), and AP-1 (−94 to −86) binding sites. To determine which transcriptional regulatory element(s) in this region is important for the activation of IL-17 promoter by PRRSV, we deleted each of C/EBPβ, CREB and AP-1 binding sites from −263/+56-luc to generate differential mutation vectors (Fig. 3C). Thereafter, we monitored IL-17 promoter activity following PRRSV infection. Luciferase results showed that there was no significant difference in luciferase activity when AP-1 binding site was deleted, whereas mutations with C/EBPβ or CREB binding site deletion exhibited reduced IL-17 promoter activation. Remarkably, the IL-17 luciferase promoter nearly lost its ability to respond to HP-PRRSV stimulation when all C/EBPβ and CREB binding sites were deleted (Fig. 3D), implying that the C/EBPβ and CREB response elements might be critical for PRRSV to activate IL-17 promoter.

FIG 3.

Porcine IL-17 promoter was activated by HP-PRRSV. (A) Cloning and sequence analysis of the 2,550-bp porcine IL-17 gene 5′-flanking region. A schematic representation of the pIL-17 promoter and promoter truncated mutants inserted into pGL3-Basic luciferase vectors is shown. (B) The IL-17 promoter vectors and pGL3 empty vector were respectively transfected into Marc-145 cells. After 12 h, the cells were inoculated with HP-PRRSV (HV isolate) (MOI = 1.0) or medium, and the cells were then harvested to determine the luciferase activity at 36 h postinfection. (C) Schematic representation of the −263/+56-luc IL-17 promoter deletion mutant vectors. (D) Marc-145 cells were transfected with the −263/+56-luc IL-17 promoter deletion mutant vectors or pGL3 empty vector. After 12 h, the cells were inoculated with HP-PRRSV (HV isolate) (MOI = 1.0) or medium. The cells were harvested to determine the luciferase activity at 36 h postinfection. The data are representative of three independent experiments (means ± the SEM). Differences were evaluated by a Student t test (*, P < 0.05).

PRRSV upregulates IL-17 through C/EBPβ and CREB pathways.

To further investigate the role of C/EBPβ and CREB in PRRSV-induced IL-17 production, we respectively knocked down C/EBPβ and CREB in PAMs using specific small interfering RNA (siRNA) before HP-PRRSV infection (Fig. 4A). Our data revealed that C/EBPβ or CREB silencing led to a significant reduction of IL-17 expression (∼78 and ∼63% decreases, respectively) (Fig. 4B). Knockdown of C/EBPβ or CREB did not affect HP-PRRSV replication (Fig. 4C). These findings indicate that C/EBPβ and CREB are essential for PRRSV-induced IL-17 expression.

FIG 4.

PRRSV upregulates IL-17 through C/EBPβ and CREB pathways. (A) PAMs were transfected with siRNA targeting C/EBPβ or CREB. After 48 h, the cells were harvested and lysed for Western blot analysis to examine the levels of C/EBPβ or CREB. (B and C) PAMs were transfected with siRNA targeting C/EBPβ or CREB, and then the cells were inoculated with or without HP-PRRSV (HV isolate) (MOI = 0.1). After 48 h, total RNAs were extracted for IL-17 mRNA analysis (B) and ORF7 mRNA (C) by real-time PCR. The data are representative of three independent experiments (means ± the SEM). *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ns, not significant (Student t test). (D) PAMs were incubated with PRRSV (HV isolate) (MOI = 0.1), and the cells were then harvested at 0, 6, 12, and 24 h postinfection. Cells were lysed for Western blot analysis to determine the levels of p-C/EBPβ, total-C/EBPβ, p-CREB, total-CREB, and β-actin. (E and F) PAMs were pretreated with DMSO control or PI3K inhibitor (LY294002) (E) and p38MAPK inhibitor (SB203580) (F) at different doses, and 1 h later the cells were incubated with HP-PRRSV (HV isolate) (MOI = 0.1). Cells were harvested at 12 h postinfection and lysed for Western blot analysis to determine the levels of p-C/EBPβ, total-C/EBPβ, p-CREB, total-CREB, and β-actin.

In addition, we investigated whether C/EBPβ and CREB were activated in PAMs during the course of PRRSV infection. PAMs were infected with HP-PRRSV at a multiplicity of infection (MOI) of 0.1 and then harvested for the analysis of C/EBPβ and CREB phosphorylation at 6, 12, or 24 h postinfection. As shown in Fig. 4D, enhanced phosphorylation of C/EBPβ and CREB was observed. Strikingly, when PAMs were pretreated with different doses of PI3K inhibitor 1 h before HP-PRRSV infection, the levels of phosphorylated C/EBPβ and CREB were significantly suppressed (Fig. 4E). p38MAPK inhibitor also diminished the phosphorylation of C/EBPβ and CREB (Fig. 4F). These results suggest that the activation of C/EBPβ and CREB by PRRSV is mediated by PI3K and p38MAPK pathways.

PRRSV nsp11 upregulates IL-17.

To examine which PRRSV protein(s) can induce IL-17 production, 3D4/21 cells were transfected with the plasmids containing each of the HP-PRRSV structural protein genes and nonstructural protein genes. Real-time PCR results showed that, of PRRSV proteins, nsp11 potentially induced IL-17 production compared to the control in a dose-dependent manner (Fig. 5A and B). To further validate this, we cotransfected 3D4/21 cells with IL-17 promoter (−263/+56-luc) and nsp11 plasmid to analyze the luciferase activity. As shown in Fig. 5C, nsp11 significantly enhanced IL-17 promoter activity.

FIG 5.

PRRSV nsp11 upregulates IL-17 production. (A) PRRSV structural and nonstructural protein expression vectors were transfected into 3D4/21 cells. After 24 h, the total RNA was extracted. IL-17 mRNA was quantified by real-time PCR, and results are expressed as the fold induction over the pcDNA3.1 vector control. (B) 3D4/21 cells were transfected with different doses of nsp11 expression vectors, and IL-17 mRNA was detected after 24 h. (C) 3D4/21 cells were cotransfected with −263/+56-luc promoter plasmid and nsp11 plasmid or pcDNA3.1 control. After 36 h, the cells were harvested, and the luciferase activity was measured. (D and E) 3D4/21 cells were transfected with nsp11 vector and then treated with PI3K inhibitor (LY294002) and p38MAPK inhibitor (SB203580) (D) or transfected with siRNA targeting CREB and C/EBPβ (E). The total RNA was extracted, and IL-17 mRNA was quantified by real-time PCR. The data are representative of three independent experiments (means ± the SEM). Differences were evaluated by Student t test. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (F) 3D4/21 cells were transfected with nsp11 plasmid at different doses. After 24 h, the cells were harvested and lysed for Western blot analysis. (G) 3D4/21 cells were transfected with nsp11 plasmid, and 6 h later the cells were treated with PI3K inhibitor (LY294002). The cells were harvested and lysed for Western blot analyses.

To investigate whether the PI3K-p38MAPK-C/EBPβ/CREB pathways are also involved in nsp11-induced IL-17 production, 3D4/21 cells were transfected with nsp11 expression vectors in the presence or absence of the inhibitor LY294002 and SB203580. As shown in Fig. 5D, IL-17 expression was dramatically decreased by inhibiting PI3K or p38MAPK signal pathway, suggesting that PI3K and p38MAPK pathways are essential for nsp11-induced IL-17 production. To clarify that C/EBPβ and CREB are also important for nsp11 to induce IL-17 production, 3D4/21 cells with the knockdown of C/EBPβ or CREB were transfected with nsp11 and then assayed for IL-17 expression. As shown in Fig. 5E, the level of IL-17 expression was decreased by 57 and 67% in C/EBPβ and CREB knockdown cells, respectively.

To further examine whether nsp11 induces PI3K, p38MAPK, C/EBPβ, and CREB activations, 3D4/21 cells were transfected with different amounts of nsp11, and the phosphorylation levels of these proteins were analyzed. As shown in Fig. 5F, the phosphorylation levels of AKT, p38MAPK, C/EBPβ, and CREB were significantly increased dose dependently. Next, to investigate whether PI3K signaling pathway is essential for p38MAPK, C/EBPβ, and CREB phosphorylation induced by nsp11, 3D4/21 cells were overexpressed with nsp11 plasmid in the presence of the PI3K inhibitor LY294002. As shown in Fig. 5G, all phosphorylation events were remarkably suppressed in a dose-dependent manner. Together, these observations demonstrate that PRRSV nsp11 induces IL-17 production through the activation of PI3K-p38MAPK-C/EBPβ/CREB pathways.

PRRSV nsp11 upregulating IL-17 requires IRAK1.

IRAK1 is a ubiquitously expressed serine/threonine kinase in the Toll-like receptor/IL-1 receptor (TLR/IL-1R) signaling pathways (26). Since it is reported that IRAK1 interacts with PRRSV nsp11 (27), we sought to investigate a possible link between IRAK1 and IL-17 production. 3D4/21 cells transfected with nsp11 were treated with different amounts of IRAK1/4-inhibitor (2, 5, and 10 μM) and then harvested for IL-17 analysis. As shown in Fig. 6A, IRAK1/4-inhibitor downregulated IL-17 expression with decreases of ca. 30, 55, and 67%, respectively. Correspondingly, HP-PRRSV-induced IL-17 upregulation was also impaired by IRAK1/4-inhibitor (Fig. 6B). HP-PRRSV replication was not affected at the used concentration (Fig. 6C). These results suggest that IRAK1 is required for nsp11-induced IL-17 production.

FIG 6.

PRRSV nsp11 upregulates IL-17 expression through IRAK1. (A) 3D4/21 cells were transfected with nsp11 expression vector or pcDNA3.1 vector control with different doses of IRAK-1/4 inhibitors. IL-17 mRNA was detected by real-time PCR after 24 h. (B and C) PAMs were pretreated with IRAK-1/4 inhibitor for 12 h, and then the cells were inoculated with or without HP-PRRSV (HV isolate) (MOI = 0.1). After 48 h, IL-17 mRNA (B) and PRRSV ORF7 mRNA (C) were analyzed by real-time PCR. (D) 3D4/21 cells were transfected with siRNA targeting IRAK1 or NC control. After 48 h, the cells were harvested for Western blot analyses to examine the level of IRAK1. (E) 3D4/21 cells were cotransfected with siRNA targeting IRAK1 and nsp11 plasmid or pcDNA3.1 control. Total RNA was extracted, and IL-17 mRNA was quantified by real-time PCR after 24 h. (F) 3D4/21 cells were cotransfected with siRNA targeting IRAK1 and nsp11 plasmid. After 24 h, the cells were harvested and lysed for Western blot analyses to examine the levels of p-AKT, total-AKT, p-p38MAPK, total-p38MAPK, p-C/EBPβ, total-C/EBPβ, p-CREB, total-CREB, nsp11, and β-actin. Differences were evaluated by using a Student t test. *, P ≤ 0.05; ns, not significant.

To further verify the role of IRAK1, we transfected nsp11 to 3D4/21 cells in which IRAK1 was silenced by siRNA (Fig. 6D) and then evaluated IL-17 expression. As shown in Fig. 6E, IL-17 expression was decreased when IRAK1 was knocked down. Moreover, the nsp11-induced phosphorylation of AKT, p38MAPK, C/EBPβ, and CREB was remarkably suppressed by silencing IRAK1 (Fig. 6F). These data demonstrate that IRAK1 is required for PRRSV nsp11-induced IL-17 production.

PRRSV nsp11 Ser74 and Phe76 are the key amino acids for IL-17 upregulation.

PRRSV nsp11, a 223-amino-acid protein, is usually divided into N-terminal domain and C-terminal domain (28). To determine which domain of nsp11 is essential for IL-17 production, we constructed six truncated mutants, including C46 (amino acids [aa] 1 to 46), C92 (aa 1 to 92), C185 (aa 1 to 185), N47 (aa 47 to 223), N93 (aa 93 to 223), and N137 (aa 137 to 223) (Fig. 7A). Each of the mutant vectors was transfected into 3D4/21 cells, and then IL-17 expression was analyzed. Our results showed that C92, C185, and N47 induced IL-17 production, but C46, N93, and N137 did not (Fig. 7B), implying that 47 to 92 aa might be important for nsp11 to upregulate IL-17 production. A mutant with the deletion of 47 to 92 aa was then generated and transfected into 3D4/21 cells. As expected, nsp11 lacking 47 to 92 aa did not upregulate IL-17 expression (Fig. 7C), suggesting that 47 to 92 aa in nsp11 were essential for IL-17 production.

FIG 7.

PRRSV nsp11 Ser74 and Phe76 are the key amino acids for IL-17 regulation. (A) Schematic representation of the wild-type (WT) nsp11 and its truncated mutants. The mutants included C46 (amino acids [aa] 1 to 46), C92 (aa 1 to 92), C185 (aa 1 to 185), N47 (aa 47 to 223), N93 (aa 93 to 223), and N137 (aa 137 to 223). (B) 3D4/21 cells were transfected with wild-type nsp11 or its truncated mutants. IL-17 mRNA was quantified by real-time PCR. Results are expressed as the fold induction over pcDNA3.1 vector control. (C) Wild-type nsp11 and the mutant with the P47-R92 deletion were transfected into 3D4/21 cells. After 24 h, IL-17 mRNA was quantified by real-time PCR. (D) Wild-type nsp11 and S74A, F76A, and S74A/F76A mutants were transfected into 3D4/21 cells, and the IL-17 mRNA was analyzed. (E) 3D4/21 cells were cotransfected with −263/+56-luc promoter and S74A, F76A, and S74A/F76A mutants or wild-type nsp11 plasmid. After 36 h, the cells were harvested, and the luciferase activity was analyzed. (F) 3D4/21 cells were transfected with nsp11 and its mutants. After 24 h, the cells were harvested and lysed for Western blot analyses to examine the levels of p-AKT, total-AKT, p-p38MAPK, total-p38MAPK, p-C/EBPβ, total-C/EBPβ, p-CREB, total-CREB, nsp11, and β-actin. (G) 293T cells were cotransfected with IRAK1 expression vector and S74A, F76A, and S74A/F76A mutants or wild-type nsp11. At 24 h posttransfection, the cells were harvested for coimmunoprecipitation analysis. Differences were evaluated by Student t test. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.

It has been reported that PRRSV nsp11 is an asymmetric dimer and serine-74 and phenylalanine-76 are the major dimerization site determinants (29). To examine whether Ser74 and/or Phe76 are essential for IL-17 production, we constructed nsp11 mutants in which serine (S74A), phenylalanine (F76A), or both were replaced by alanine. As expected, the mutants of S74A, F76A, or S74A/F76A failed to induce IL-17 expression (Fig. 7D) and activate IL-17 promoter (Fig. 7E), suggesting that the two residues are essential for nsp11 to induce IL-17 production. In addition, mutations of Ser74 and Phe76 in nsp11 had impaired abilities to induce the phosphorylation of AKT, p38MAPK, C/EBPβ, and CREB (Fig. 7F) and interact with IRAK1 (Fig. 7G). Together, these data indicate that PRRSV nsp11 Ser74 and Phe76 are the key amino acids for nsp11 to induce IL-17 production.

nsp11 Ser74 and Phe76 might be essential for virus replication.

Given the important roles of nsp11 Ser74 and Phe76, we next tried to investigate their roles in PRRSV-induced IL-17 production. We constructed series of PRRSV infectious clones with respective mutated sites, including pcDNA3.1-HV-S74A, pcDNA3.1-HV-F76A, pcDNA3.1-HV-S74A/F76A, and pcDNA3.1-HV-Δ47-92, and attempted to rescue recombinant viruses. pcDNA3.1-HV-F131A and pcDNA3.1-HV-S196A were constructed as controls. We then performed indirect immunofluorescence assay using PRRSV N protein monoclonal antibody (SDOW17) to detect the rescued recombinant viruses. We successfully rescued the recombinant viruses rHV, rHV-F131A, and rHV-S196A. However, we could not rescue the recombinant viruses with the mutations, including pcDNA3.1-HV-S74A, pcDNA3.1-HV-F76A, pcDNA3.1-HV-S74A/F76A, and pcDNA3.1-HV-Δ47-92. Considering the important role of nsp11 for virus replication and the necessity of Ser74 and Phe76 for nsp11 endoribonuclease activity, we speculate that Ser74 and Phe76 might be essential for virus replication, at least in part.

PI3K inhibitor reduces IL-17 production and lung inflammation in pigs infected with HP-PRRSV.

Since PI3K plays an important role in PRRSV-induced IL-17 production, we then investigated whether PI3K inhibitor can reduce PRRSV-induced IL-17 production and lung inflammation in vivo. We intranasally infected six 4-week-old pigs with HP-PRRSV at a dose of 2 × 10⁵ 50% tissue culture infective dose(s) (TCID₅₀)/ml, and then half of PRRSV-infected pigs were treated with PI3K inhibitor LY294002 (20 mg/kg, administered intraperitoneally [i.p.]) three times at days 0, 2, and 4 postinfection. Pigs were euthanized, and samples were collected at day 6 postinfection. Our results showed that IL-17 mRNA expression was upregulated in PAMs and lungs from HP-PRRSV-infected pigs (Fig. 8A and B). However, IL-17 expression was significantly decreased in LY294002-treated pigs (Fig. 8A and B). Accordingly, the higher protein levels of IL-17 in serum and bronchoalveolar lavage fluid (BALF) induced by HP-PRRSV were significantly suppressed in LY294002-treated pigs (Fig. 8C and D). However, LY294002 has no impact on PRRSV replication in vivo (Fig. 8E). By hematoxylin and eosin (H&E) staining, we found that PI3K inhibitor LY294002 alleviated the lung inflammation (Fig. 8F). However, even though the average body temperature of the LY294002-treated pigs tended to be lower than that of the HP-PRRSV-infected pigs without LY294002 treatment, there was no significant difference between them (data not shown). These data suggest that the downregulating IL-17 might help reduce pneumonia caused by HP-PRRSV infection.

FIG 8.

PI3K inhibitor reduces IL-17 production and lung inflammation in pigs infected with HP-PRRSV. Six piglets were infected intranasally with 2 ml of HP-PRRSV (HV isolate) (1 × 10⁵ TCID₅₀/ml), and three of the infected piglets were treated with PI3K inhibitor LY294002 (20 mg/kg, i.p., three times at days 0, 2, and 4). Three piglets were inoculated with 2 ml of PBS as controls. At 6 days postinfection, the piglets were euthanized, and tissue samples were collected. (A and B) IL-17 mRNAs in PAMs and lung tissues were analyzed by real-time PCR. The results were normalized to GAPDH and are expressed as the fold induction over samples from uninfected pigs. (C and D) The levels of IL-17 in serum and BALF were quantified by ELISA. (E) HP-PRRSV ORF7 mRNAs in PAMs and lungs were quantified by real-time PCR. *, P ≤ 0.05; **, P ≤ 0.01 (Student t test). (F) H&E staining of the lung samples.

Taken together, our data suggest that HP-PRRSV induces IL-17 production via IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathways, in which nsp11 might play an essential role (Fig. 9).

FIG 9.

Model showing that PRRSV nsp11 induces IL-17 production mainly via IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathways.

DISCUSSION

In this study, we investigated the ability of PRRSV to induce IL-17 expression and the underlying mechanisms. The results showed that HP-PRRSV infection upregulated IL-17 production both in vitro and in vivo. We further demonstrated that PRRSV nsp11 induced IL-17 expression and Ser74 and Phe76 in nsp11 were essential for the induction. Subsequently, the addition of inhibitors of IRAK1, PI3K, or p38MAPK or the knockdown of C/EBPβ or CREB considerably reduced IL-17 production, suggesting that IRAK1, PI3K, p38MAPK, C/EBPβ, and CREB signaling pathways are critical for IL-17 induction by PRRSV. Importantly, we demonstrated that PI3K inhibitor reduced IL-17 production and lung inflammation caused by HP-PRRSV infection.

IL-17 mediates host immune responses against extracellular pathogens, which is associated with the pathogenesis of various inflammation diseases (13). Recently increasing evidence suggests that IL-17 is involved in viral infection. For example, IL-17 plays a vital function in influenza virus-induced acute lung injury. The levels of IL-17 and IL-17-responsive cytokines and chemokines are elevated in the BALFs of H1N1- infected mouse lungs, and IL-17-deficient mice have ameliorated acute lung injury (20). IL-17 is also reported to play a pathogenic role during respiratory syncytial virus (RSV) infections. Increased IL-17 levels are found with RSV infection, and anti-IL-17 antibody reduces inflammation and increases RSV-specific CD8⁺ T cells (30). Furthermore, in herpes simplex virus 2- and murine cytomegalovirus-infected mice, the IL-17 expression is significantly elevated, which contributes to the exacerbated inflammation and mortality (31). Human papillomavirus infection can significantly upregulate IL-17 expression and promote lung tumor cell progression (32). In the present study, we show that IL-17 is induced by PRRSV infection in the alveolar macrophages, lungs, BALF, and sera of PRRSV-infected pigs. Considering the role of IL-17 in immune responses, we hypothesize that the high level of IL-17 in the lungs should be of particular significance in the lung inflammation and injury in HP-PRRSV-infected pigs. It has been reported that macrophages, rather than Th17 cells, are the main producer of IL-17 in allergic inflammation related to asthma or in proliferative inflammatory atrophy lesions (11, 12). Therefore, we assume that PAMs might be one of the important resources of IL-17 during HP-PRRSV infection. Interestingly, one study has reported that HP-PRRSV infection reduces the number of Th17 cells in peripheral blood and lung (33). However, considering that we used a different HP-PRRSV isolate from the previous report (33), we cannot exclude the possible role of Th17 cells in our model.

We find that IL-17 is induced by HP-PRRSV nsp11. As a major genetic marker in the nidoviruses, nsp11 has been demonstrated to have conserved endoribonuclease activity and play critical roles in the viral life cycle (34). The structures of nsp11 contain N-terminal domain and C-terminal domain. The catalytic center of endoribonuclease activity is located in the C-terminal domain, and the major catalytic sites are usually regarded as His129, His144, Lys173, and Tyr219, but the function of the N-terminal domain is not clear (28). Recently, nsp11 is presumed to exist mainly as a dimer in solution, and the putative dimerization site determinants are Ser74 and Phe76, which are located in the dimerization interface. Mutations of the two site determinants destabilize the dimer in solution and severely diminish nsp11 endoribonuclease activity (29). In our study, we found that nsp11 P47-R92 is essential for IL-17 upregulation, implying that nsp11 N-terminal domain has an important role. More specifically, Ser74 and Phe76 of nsp11 are crucial for IL-17 expression, since mutations of the two sites dramatically decrease the IL-17 level. Moreover, we show that infectious virus with mutation of Ser74 (S74A) or Phe76 (F76A) or a P47-R92 deletion cannot be rescued. These findings further reveal the critical roles played by nsp11 Ser74 and Phe76 in viral replication. However, more studies are still required to explore the features of nsp11.

IL-17 expression is regulated by multiple factors. A lot of transcription factors, including CREMα, CREB, NF-κB, IRF4, STAT3, and retinoic acid-related orphan receptor γt (RORγt), contribute to the increased IL-17 production. For example, it has been reported that CREMα, IRF4, and RORγt can directly bind to IL-17 promoter and increase its activity to induce IL-17 gene expression (35–37). STAT3 induces IL-17 expression, and deletion of the STAT3 gene in T cells abrogated IL-17 production (38). The Tax protein of human T-cell leukemia virus type 1 (HTLV-1) activates the human IL-17 promoter via CREB pathway (39). In addition, IL-17 production is remarkably reduced in C/EBPβ^−/− mice (40). In our study, we found that C/EBPβ and CREB are required for PRRSV-induced IL-17 production. Mutations of the C/EBPβ and CREB binding sites downregulate the activation of IL-17 promoter, and silencing them by siRNA significantly reduces IL-17 expression. Moreover, it has been shown that cellular signaling pathways such as PI3K/AKT, PKC, p38MAPK, ERK1/2, and mTOR are required for IL-17 induction. For instance, the PI3K/Akt pathway positively modulates IL-17 expression in rheumatoid arthritis (41), and high glucose induces IL-17 expression via PI3K/Akt/ERK-dependent signaling (42). In PKC^−/− mice, IL-17 production is reduced (43). Activation of p38MAPK is essential for IL-17 production in arthritis and autoimmune encephalomyelitis (44, 45), and mTORC1 positively modulates IL-17 expression through several pathways (46). In our study, we demonstrate that the increase of IL-17 induced by PRRSV and nsp11 is associated with PI3K and p38MAPK pathways, since PI3K and p38MAPK inhibitors reduce the upregulated IL-17 production. Importantly, PRRSV infection indeed induces the activation of PI3K, p38MAPK, and C/EBPβ (47–49). The relationship of PRRSV infection and CREB activation has not been reported before, but many other viruses, including HTLV-1 and varicella-zoster virus, can induce CREB activation (50, 51). Moreover, it has been reported that most transcription factors are activated through phosphorylation by cellular kinases. Our results show that phosphorylation of C/EBPβ and CREB is regulated by PI3K and p38MAPK activation in PRRSV-infected cells. In agreement with this, there are reports showing that thrombin-induced COX-2 expression is mediated through PI3K-dependent CREB pathway (52) and that MiR-145 is negatively regulated by C/EBPβ through the PI3K/Akt pathway (53). In Epstein-Barr virus-infected cells, C/EBPβ, which is required for the activation of BZLF1 promoter, is phosphorylated through the p38MAPK pathway (54), and in SARS coronavirus-infected cells, p38MAPK could regulate CREB activation (55). Therefore, the findings that PRRSV and nsp11 activate the phosphorylation of C/EBPβ and CREB through PI3K and p38MAPK pathways are important for the activation of the IL-17 promoter and the upregulation of IL-17 production.

PI3Ks are a family of intracellular signaling proteins involved in a plethora of cellular processes. There is growing evidence showing that PI3K is associated with inflammation. LY294002, a nonselective PI3K inhibitor, generally reduces inflammation in disease models. For example, LY294002 significantly reduces bronchial inflammation in a murine asthma model (56). In our study, we observe that LY294002 significantly reduces IL-17 levels in PAMs, lungs, sera, and BALF and effectively ameliorates lung inflammation and injury. These findings may reveal a method for mitigating the lung inflammatory response induced by PRRSV infection.

IRAK1 mediates signaling downstream of TLR/IL-1R and activates the NF-κB and MAPK pathways to play important roles in innate immunity and inflammation (26). It has been reported that IRAK1 can interact with nsp11, based on coimmunoprecipitation and laser scanning confocal microscopy studies (27). Thus, it is possible that the interaction of nsp11 and IRAK1 triggers IRAK1 downstream activation to induce IL-17 production. It has been reported that IL-17 expression is reduced in IRAK-1^−/− mice, and these mice are protected from developing various inflammatory diseases (57, 58). Here, we found that the IRAK1 inhibitor and siRNA knockdown of IRKA1 reduce IL-17 expression induced by nsp11. It is true that IRAK1 interacts with nsp11. However, mutations of S74A and F76A impair the interaction between nsp11 and IRAK1. These data verify that nsp11 regulates IL-17 production by interacting with IRAK1, in which Ser74 and Phe76 play a critical role. Furthermore, we also observe that IRAK1 siRNA downregulates phosphorylated AKT, p38MAPK, C/EBPβ, and CREB, implying that AKT, p38MAPK, C/EBPβ, and CREB are the downstream effectors of IRAK1 in IL-17 induction. There is evidence that IRAK1 regulates PI3K activation. For example, in mouse sperm cells, inhibition of IRAK1/4 signaling significantly blocks lipopolysaccharide-induced PI3K phosphorylation (59). In addition, in BEAS-2B, IRAK1 regulates PI3K through PKCα, and IRAK1 siRNA downregulates the phosphorylation of PKCα and the inhibition of PKCα completely blocks the AKT activation (60).

Other inflammatory cytokines such as IL-1β and TNF-α are also upregulated during PRRSV infection and are involved in the immunopathology. To investigate whether PRRSV-induced IL-1β and TNF-α upregulation is also regulated by the IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathway, we treated PAMs with IRAK1, PI3K, and p38MAPK inhibitors or the knockdown of C/EBPβ and CREB, respectively. Our results showed that IRAK1 inhibitor dramatically suppressed PRRSV-induced IL-1β and TNF-α expression and p38MAPK inhibitor also significantly reduce IL-1β and TNF-α expression. However, PI3K inhibitor and knockdown of C/EBPβ or CREB by siRNA had no significant effects on IL-1β and TNF-α production, suggesting that PI3K, C/EBPβ, and CREB signaling pathways are not required for IL-1β and TNF-α induction by PRRSV (data not shown). It has been reported that PRRSV induces IL-1β production through TLR4/MyD88, ERK1/2, p38MAPK, AP-1, and NF-κB pathways and NLRP3 inflammasome (61, 62). Moreover, PRRSV induces TNF-α production through ERK1/2 and NF-κB pathways (63, 64). Thus, PRRSV regulates IL-17 expression, but not IL-1β and TNF-α expression, via the PI3K-p38MAPK-C/EBPβ/CREB pathway.

In summary, our results show that PRRSV-induced IL-17 expression is dependent on the activation of IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathways. Of PRRSV proteins, nsp11 is able to upregulate IL-17 production by interacting with IRAK1. Importantly, PI3K inhibitor LY294002 significantly reduces IL-17 levels and lung inflammation and injury in pigs infected with HP-PRRSV.

MATERIALS AND METHODS

Ethics statement.

All animal trials in this study were performed according to the guidelines of the Beijing Laboratory Animal Welfare and Ethics of the Beijing Administration Committee of Laboratory Animals and were approved by the Beijing Association for Science and Technology (approval ID SYXK [Beijing] 2007-0023). The animal studies also complied with the China Agricultural University Institutional Animal Care and Use Committee guidelines (ID SKLAB-B-2010-003) and were approved by the Animal Welfare Committee of China Agricultural University.

Cell culture and virus propagation.

Porcine alveolar macrophages (PAMs) were obtained from postmortem lung lavage of 8-week-old specific-pathogen-free (SPF) pigs and maintained in RPMI medium 1640 supplemented with 10% heat-inactivated fetal bovine serum (FBS). 3D4/21 cells (ATCC CRL-2843), a porcine alveolar macrophage cell line, were maintained as PAMs. Marc-145 cells (ATCC CRL-12231), a PRRSV-permissive cell line derived from African green monkey kidney cells, and 293T cells (ATCC CRL-3216) were cultured in Dulbecco modified Eagle medium (DMEM) with 10% FBS. The HP-PRRSV (HV isolate) and the classical PRRSV strain CH1a were propagated on PAMs or Marc-145 cells, and the virus titers were determined. Briefly, PRRSV was serially diluted 10-fold in complete DMEM or RPMI 1640 to infect 5 × 10⁴ Marc-145 cells or PAMs in 96-well plates. PRRSV infection was determined at 72 h postinfection using immunofluorescent staining for the PRRSV N protein. Virus titer was determined using Reed-Muench method, and expressed as the TCID₅₀. Virus was stored at –80°C until use.

RNA extraction and real-time PCR.

Total RNA was extracted from treated cells with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was prepared from 1 μg of RNA using 10 U of Moloney murine leukemia virus reverse transcriptase (TaKaRa), a deoxynucleoside triphosphate mix, and oligo(dT) primers. Real-time PCR analysis was performed by using a ViiA 7 real-time PCR system (Applied Biosystems) and SYBR green real-time PCR Master Mix (CWBIO). The gene-specific primers for porcine IL-17 were the forward primer CTCTCCAACGCAACGAGGAC and the reverse primer GTCACCATCACTTTCTCCAGCC. The level of IL-17 mRNA was normalized according to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression (forward primer, CCTTCCGTGTCCCTACTGCCAAC; reverse primer; GACGCCTGCTTCACCACCTTCT).

ELISA.

The IL-17 protein levels in BALF, plasma, and cell culture supernatants were measured using porcine IL-17 ELISA kits (Abcam) in accordance with the manufacturer’s instructions.

Plasmid construction.

Genomic DNA was extracted from PAMs using a DNA extraction kit (TaKaRa). A 2,550-bp-length Sus scrofa IL-17 gene promoter (NC_010449.5) was cloned and inserted into the luciferase reporter vector pGL3-Basic (named −2494/+56-luc). The sequence relative to the transcription initiation site (+1) was determined by DNA sequencing. The truncated mutants of IL-17 promoter were constructed using the primers listed in Table 1 and inserted into pGL3-Basic vector at the KpnI and NheI sites. C/EBPβ, CREB, and AP-1 element deletion mutants were generated by overlapping PCR from the −263/+56-luc vector and then subcloned into the pGL3-Basic vector.

TABLE 1.

Sequences of the primers used for the truncated IL-17 promoter^a

Primer	Sequence
–2494/+56-luc	GGGGTACCTACGACTCCAATTAGACC
−1376/+56-luc	GGGGTACCAAAGGCACTATCAGAGGA
−959/+56-luc	GGGGTACCACACTGGCAACCACTGAC
–446/+56-luc	GGGGTACCTAGTTTCTGGAATGGTCTCC
–263/+56-luc	GGGGTACCATGAATTATGTGTCCCCTCT
–83/+56-luc	GGGGTACCCGAAGCCCTATAAAAAGAGAG
+56-NheI	CTAGCTAGCCGTAGTTTCTCCTGATGTA

^aNucleotide+1 represents the transcription initiation site of the IL-17 promoter.

Genes encoding viral proteins were amplified as previously described (65). All construction vectors were confirmed by DNA sequencing. The point mutants of the nsp11 were constructed using Q5 site-directed mutagenesis kit (NEB) according to the manufacturer’s instructions. The primers are listed in Table 2.

TABLE 2.

Sequences of the primers used for PRRSV nsp11 mutants

Primer	Sequence
N47 forward	CGGGATCCATGCCAGATCGGCTGGTAGCCAG
N93 forward	CGGGATCCATGGGCGAGGCTCAAGTGCTTCC
N137 forward	CGGGATCCATGACCACCGTTGGGGGATGTCATC
N reversea	CCGGAATTCTCATTCAAGTTGAAAATAGGCCGTC
C forwardb	CGGGATCCATGGAAGGGTCGAGCTCCCCG
C46 reverse	CCGGAATTCTCACCACCTTTCATTGTTCTGGGT
C92 reverse	CCGGAATTCTCATCTAACAAATTTTGTGAGATAG
C185 reverse	CCGGAATTCTCAGTCTGGGAGGTACACATCCGT
Δ47-92 forward	GGCGAGGCTCAAGTGCTT
Δ47-92 reverse	CACCTTTCATTGTTCTGGGTTG
S74A(Q5) forward	GGTGGGCCCCGCTGTGTTTTTAG
S74A(Q5) reverse	ATATAGCCGGCACCAATG
F76A(Q5) forward	CCCCTCGGTGGCTTTAGGCACCC
F76A(Q5) reverse	CCCACCATATAGCCGGCA
S74A/F76A(Q5) forward	GGCTTTAGGCACCCCTGGGGTT
S74A/F76A(Q5) reverse	ACAGCGGGGCCCACCATATAGCC

^aThe reverse primer of the N47, N93, and N137 deletion mutants.

^bThe forward primer of the C46, C92, and C185 deletion mutants.

Luciferase reporter assays.

Marc-145 cells seeded in 24-well plates were transfected with the constructed plasmids (pRL-TK, pGL3-Basic, and IL-17 promoters) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. After 12 h, the cells were infected with or without virus at an MOI of 1 for 36 h. Cell extracts were prepared and analyzed for firefly and Renilla luciferase activities using a dual-luciferase reporter assay kit (Promega) according to the manufacturer’s instructions.

Coimmunoprecipitation and Western blot analysis.

Cells were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (CWBIO) with 100 U of proteinase inhibitors (CWBIO) and 20 μM NaF on ice. Protein levels were quantified using bicinchoninic acid assay. Similar amounts of protein from each extract were separated by SDS–12% PAGE and transferred to polyvinylidene difluoride membranes (Millipore). Membranes were blocked with 5% skim milk in PBS with 0.05% Tween 20, followed by incubation overnight at 4°C with the antibodies anti-p-AKT, anti-AKT, anti-p-p38MAPK, anti-p38MAPK, anti-p-C/EBPβ, anti-C/EBPβ, anti-p-CREB, or anti-CREB (1:1,000; Cell Signaling Technology); anti-β-actin (1:1,000; Sigma); or anti-PRRSV nsp11 (1:10,000; prepared in our laboratory). For coimmunoprecipitation assays, total proteins of cell extract were incubated with anti-HA and anti-FLAG antibody (Sigma) for 2 h, followed by incubation with 10 μl of anti-FLAG M2 magnetic beads (Sigma) overnight. The membranes were then incubated with the appropriate secondary antibody for 1 h (1:5,000; Santa Cruz Biotechnology). Signals were visualized using enhanced chemiluminescence (CWBIO).

siRNA knockdown.

siRNAs specific for the C/EBPβ and CREB genes (GenePharma) or the siRNA targeting IRAK1 gene (Santa Cruz Biotechnology) or a nonspecific control (NC) were transfected using HiPerFect transfection reagent (Qiagen). These experiments were performed as previously described (66), and the efficiency of the knockdown of protein expression was assessed by Western blotting.

Construction strategy for infectious cDNA clones.

According to the strategies as previously described, a full-length cDNA clone (pcDNA3.1-HV) was obtained (67). The full genome of HV was divided into five overlapping fragments, and the fourth fragment contains the nsp11-coding region. The fourth fragment that contains S74A, F76A, F131A, or S196A mutation site or the 47–92 deletion mutation was cloned. These mutant fragments were then inserted into the pcDNA3.1-HV fragment that was digested by ClaI and EcorV restriction enzymes using HiFi DNA assembly master mix (NEB) to generate the full-length infectious cDNA clones with the respective mutated site. These plasmids (pcDNA3.1-HV, pcDNA3.1-HV-S74A, pcDNA3.1-HV-F76A, pcDNA3.1-HV-F131A, pcDNA3.1-HV-S196A, pcDNA3.1-HV-S74A/F76A, and pcDNA3.1-HV-Δ47-92) were transfected into 293T cells. At 72 h posttransfection, cell culture supernatants were inoculated on PAMs or Marc-145 cells, and an immunofluorescence assay was performed for virus detection.

Animal experiment.

Nine 4-week-old SPF piglets were randomly divided into three groups (three piglets per group). Six piglets were intranasally inoculated with 2 ml of HP-PRRSV (1 × 10⁵ TCID₅₀ virus/ml). After 1 h, half of the HP-PRRSV-infected piglets were treated with PI3K inhibitor LY294002 (20 mg/kg, i.p. injection mixed with 4% DMSO, 30% PEG 300, 5% Tween 80, and ddH₂O. At days 2 and 4 after PRRSV infection, second and third treatments with LY294002 were performed. At 6 days postinfection, the pigs were euthanized, and samples were collected.

Statistical analysis.

Statistical analysis was performed using GraphPad Prism software, and differences were analyzed using a Student t test. Significance is denoted in the figures as follows: *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; and ns, not significant.