Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2019 Oct 22;9(11):407. doi: 10.1007/s13205-019-1935-x

Hairy root induction and Farnesiferol B production of endemic medicinal plant Ferula pseudalliacea

Abedin Khazaei 1, Bahman Bahramnejad 1,✉, Ali-Akbar Mozafari 2, Dara Dastan 3,4, Sima Mohammadi 1
PMCID: PMC6805845  PMID: 31692659

Abstract

The effects of medium, gibberellic acid (GA3) and stratification treatments on the seed germination of Ferula pseudalliacea were evaluated. Filter paper medium, 500 micro molar GA3 and 8 week chilling treatment were resulted in significantly more seed germination than others. F. pseudalliacea was also transformed by Agrobacterium rhizogenes. Explants from young leaves, stems, cotyledon, and embryo were inoculated with A. rhizogenes strains ATCC 15834, 1724, A4, LB9402 and Ar318. Hairy roots were induced only from 10 to 12-days embryo explants using strains ATCC 15824 and 1724. Although, the transformation efficiency of ATCC 15834 (4%) strain was higher than 1724 (2%). Maximum hairy root transformation frequency (25%) was obtained in infection time of 10 min compared to that of 20 (20%) and 30 (5%) min. In addition, the transformation rate was significantly higher at the inoculation time of 72 h (29%) compared to that of 48 h (22%) and 24 h (6%). Transgenic hairy root lines were confirmed by PCR amplification of rolB gene. Hairy root lines were produced higher biomass in half B5 medium compared to that of half MS medium. Hairy roots lines from the strain ATCC 15834 produced more hairy root numbers and fresh and dried biomass compared to that of the strain 1724. Analyses of transgenic hairy root and natural roots extracts using HPLC showed that all the hairy root lines produced farnesiferol B.

Keywords: Seed germination, Agrobacterium rhizogenes, Transformation, Hairy root induction, Farnesiferol B

Introduction

The genus Ferula belongs to the Apiaceae family and mostly grows in arid climates (Pimenov and Leonov 1993; Pimenov et al. 2004). In Iranian flora, more than 15 endemic ferula species grows in natural habitats and typically called them as koma or kema (Sattar and Iranshahi 2017). Most of Ferula species are known for their resins and secondary metabolites with various phytochemical characteristics.

Many researchers have studied secondary metabolites of plants in the genus Ferula (Murray et al. 1982). Many ferula species such as F. gumosa, F. latisecta and F. asafetida have been utilized in folk medicine to treat various disease (Zargari 1997; Eigner and Scholz 1999). Furthermore, research related to the cytotoxic activity of main groups of chemical compounds such as umbelliprenin, gummosin, farnesiferol C, farnesiferol A, and badrakemone from the genus Ferula has been reported (Shahverdi et al. 2006; Barthomeuf et al. 2008; Lee et al. 2010). In other words, most species of this genus have been known as a valuable source of biologically important substances such as coumarins, sesquiterpenes, sesquiterpene coumarins, sesquiterpene lactones, sulphur-containing derivatives, monosaccharides, daucane esters and aromatic resins which are used in traditional medicine (Kapoor 2000; El-Razek et al. 2001; Iranshahi et al. 2007; Kanani et al. 2011; Razavi and Janani 2015; Asghari et al. 2016). Amongst these compounds, sesquiterpenecoumarin has frequent biological usage and is formed from the common coumarin group. Ferula sesquiterpene coumarins showed various biological activities such as antibacterial, antiviral (anti HIV), anti-inflammatory, spasmolytic, anticoagulant, P-glycoprotein (P-gp) inhibitory (Abd El-Razek 2003; Nazari and Iranshahi 2011; Zarei et al. 2013; Dastan et al. 2014; Gudarzi et al. 2015).

F. pseudalliacea is endemic specie found in the Kurdish (Sanandaj) mountains of western Iran used in traditional medicine for various purposes. Recently some new disesquiterpene and sesquiterpene coumarins were investigated from F. pseudalliacea. Sesqui- and disesquiterpene coumarins of F. pseudalliacea were found to have anti-bacterial, anti-cancer, anti-plasmodial, and phytotoxic effects (Dastan et al. 2012, 2014, 2016). In addition, F. pseudalliacea extract was able to stimulate apoptosis in human colon cancer HCT-116 cell line through activation of the mitochondrial pathway (Bamehr et al. 2019).

F. pseudalliacea is one of the most important and endangered medicinal plants in western Iran which is found in a narrow area of Kurdistan Province. F. pseudalliacea is spread in very low frequency in a mountains area due to poor seed germination. Poor seed germination in Apiaceae has been reported previously (Golmohammadi 2013; Moghadam et al. 2014). Seed dormancy is a common physiological feature of the Ferula species (Nadjafi et al. 2006; Keshtkar et al. 2008; Zare et al. 2011). For the sustainable use of native medicinal plants with seed dormancy under laboratory conditions, special treatments are needed to increase seed germination rate and decrease the time of germination.

Agrobacterium rhizogenes is an aerobic, soilborne gram-negative bacterium which causes hairy roots on higher plants. In other words, hairy root is a pathological disease of dicotyledonous plants after wounding and infection with A. rhizogenes. The root-inducing (Ri) plasmid of A. rhizogenes that contain T-DNA encoding root locus (rol) gene loci (rolA, rolB, and rolC) is responsible for the permanent transfer of DNA into host cells (Lima et al. 2009). The A. rhizogenes strains and vectors that used for hairy root induction and foreign gene expression was reviewed by Bahramnejad et al. (2019).

Through the last three decades hairy roots cultures have been used for a variety of purposes ranging from production of recombinant protein and metabolic engineering to analyses of rhizosphere physiology and biochemistry (Ono and Tian 2011). Most applications of hairy root cultures have focused on the large scale production of useful compounds or secondary metabolites (Xu et al. 2006). Endemic native medicinal plants contain important unique metabolites and need optimized protocol for their mass production.

To date, there has been no available report on optimization of factors affecting seed germination, hairy root induction and production of farnesiferol B in F. pseudalliacea. Thus, optimizing an efficient germination condition and A. rhizogenes-mediated hairy root system is a promising approach that could help provide farnesiferol B and other secondary metabolites from F. pseudalliacea. The aim of the present study was to optimize seed germination in in vitro conditions and to induce and optimize hairy roots for F. pseudalliacea and check the hairy roots for production of secondary metabolites, in particular farnesiferol B.

Materials and methods

Collection of the seeds

The seeds were collected in September, 2014 from mature growing plants of Ferula pseudalliacea in mountains near Sanandaj, Kurdistan Province of Iran.

Surface sterilization

Seeds were thoroughly rinsed under running tap water for 48 h then treated with 70% ethanol for one minute followed by 25 min in 2% hypochlorite sodium and three washes in sterile distilled water. All these steps were carried out in the laminar air flow chamber. Surface-sterilized seeds were inoculated aseptically on three basal mediums namely ¼ MS (Murashige and Skoog 1962), sand and wet paper. Different concentrations of GA3 (0, 500 and 1000 ppm), cold treatment time (0, 4, 6, 8 and 10 weeks), time of GA3 application (before stratification, during stratification and after stratification) were compared in factorial design for seed germination.

For embryo culture F. pseudalliacea mature seeds were rinsed under running tap water for 25 min and then placed in tap water for 72 h at 25 °C. Seeds were surface sterilized with ethanol 70% under laminar flow for 3 min, placed in 100% commercial Sodium Hypochlorite (Clorox) included 1–2 drops of Tween 20 for 20 min with continuous shaking. After washing three times with sterile distilled water, embryos were separated from the embedded seeds using a sterile scalpel and forceps and placed in plates. In each plate five embryos were cultured in ½ B5 mediumcontaining 0.5 g/L and 1.0 g/L activated charcoal under horizontal and vertical conditions in three replications.

Agrobacterium rhizogenes strains

Five strains of A. rhizogenes including Ar318, ArA4, ATCC 15834, 1724 and LBA9402 were used in present study. The bacterial strains were grown in LB medium plate containing 50 mg/l kanamycin and 100 mg/l rifampicin. A single colony has been picked, inoculated in liquid LB medium and incubated at 28 °C on shaker (180 rpm) for 48 h. Liquid cultures were centrifuged at 3000 g for 2 min and bacterial density was adjusted to desired OD600 of 0.6–1.0 with LB medium. After that inoculums were supplemented with acetosyringone at a final concentration of 100 μM.

Hairy root induction

Explants were treated with three concentrations of bacterial inoculums (optical density at 600 nm of 0.6, 0.8 or 1.0) for 10, 20 or 30 min. Leave, hypocotyls, cotyledons, roots and 10–12-day cultured embryo were used as explants for A. rhizogenes infection. The infection process was done as described by (Hosseini et al. 2017). For browning inhibition activated charcoal (0.2%) and 0.5 gL−1 Polyvinylpyrrolidone were added to medium.

Confirmation of transgenic hairy roots

Genomic DNA from wild type roots and putative transgenic hairy root lines were extracted via cetyl trimethyl ammonium bromide (CTAB) protocol (Sharma et al. 2013). Confirmation of hairy roots was performed using rolB gene specific primers (5´ ATCCAACTCACATCACAATGG -3´ and 5´ TTCTAAATCAGGTTCCTCCG -3). PCR was done using Cinnagen master mix (Cinnagen, Tehran, Iran). Each PCR reactions were containing 5 µ master mix, 0.200 µg genomic DNA or 10 ng plasmid DNA and 0.5 M of rolB forward and reverse primers. PCR conditions for rolB amplification were as follows: initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, elongation at 72 °C for 1 min, and 10 min final elongation (T100 Thermal Cycler, Bio-Rad). PCR products were run by electrophoresis in 1% agarose gels, stained with DNA Safe Stain (Cinaclone) and observed under UVI Doc Gel Documentation System (UVITEC, Cambridge, UK).

Mass proliferation of hairy roots

A confirmed hairy root line induced from 10 to 12 days cultured embryo using the ATCC 15834 strain was selected as it had a higher growth rate compared to other strains. The hairy root line and wild type roots were cultured in 1/2 MS and 1/2 B5 medium with 90 rpm shake at 25 ± 2 °C. Light condition was 16:8 h (light: dark). Root mass was harvested and measured after 10, 20 and 30 days culture. For each treatment we had three replications.

Quantification of Farnesiferol B

The hairy root cultures of F. pseudalliacea were harvested on day 30. Harvested hairy roots and fresh wild type root samples collected from nature were stored at − 80 °C. For farnesiferol B extraction, samples were dried at room temperature and ground by mortar and pestle to a fine powder. Extraction of farnesiferol B from wild type and transgenic hairy roots was conducted according to Dastan et al. (2012) with minor modifications. Each sample was minified (500 mg) and suspended in n-hexane, and placed in darkness for 2 days. Then, the mixtures were kept in continuous shaking at 80 rpm for 5 h and incubated in an ultrasonic bath for 10 min. After filtering through Whatman filter papers, the solvent was evaporated at 50 °C using rotary evaporator (Heidolph, Germany). The residues were dried and the n-hexane extracts were scraped and kept in a dark place. Two mg of each extract were dissolved in 1 mL DMSO and filtered through a 0.45 µm/L filter. Seven different concentrations of farnesiferol B standard extracted from our previously research (Dastan et al. 2012) were prepared in 1 mL DMSO ranging from 1 to 200 μg/mL. The peak areas obtained from the injections were used to calculate the calibration curve and real amount of farnesiferol B. The HPLC column Spherisorb ODS-2 (5 μm) with reversed phase 4.6 mm × 250 mm was used and elution was conducted at a flow rate of 1.0 mL/min at 25 °C and detection at 324 nm with 20 μL sample injection volume (MeOH in H2O (80–100% MeOH). The chromatographic peak of farnesiferol B was confirmed according to the retention time of the reference standard and extracts spiked with the standard solution. The quantitative analysis was done with external standardization using quantification of the peak areas using Agilent ChemStation software.

Statistical analysis

The germination experiments were arranged infactorial design and hairy root optimization experiment were done in a completely randomizeddesign (CRD) with three replications. The treatment means were compared by the LSD test at p = 0.05 with SAS software.

Results

In vitro seed germination

F. pseudalliacea seed has dormancy and no study as yet has been published on the optimization of seed germination in ex situ condition. Therefore, we tried to find an appropriate medium and pre-treatment technology for breaking dormancy and increasing germination of F. pseudalliacea seeds in laboratory. The sterilized seeds of F. pseudalliacea were placed on various medium including ¼ MS, filter paper and wet sand. The highest germination percentage has been recorded in filter paper (60.83%) followed by ¼ MS (37.5%) (Figs. 1 and 2).

Fig. 1.

Fig. 1

Open in a new tab

F. pseudalliacea plant in hillside of Kurdistan province of Iran (a, b). The resin secreted from aerial part of plants (c, d). F. pseudalliacea seed germination in filter paper (e, f), ½ MS (g) and wet sand (h)

Fig. 2.

Fig. 2

Open in a new tab

Effect of medium (a), chilling (b), time of GA3 application (c) and GA3 concentration (d) on germination of F. pseudalliacea seeds in in vitro condition. Dissimilar letters mark significant differences at the 5% level of LSD test

The effects of gibberellic acid (GA3) concentration, time of GA3 application (TGA) and cold stratification (CS) on seed germination were investigated in a factorial experiment. The results of the ANOVA test indicated that seed germination was significantly affected by the GA3, TGA and CS. GA3 had a significant effect on seed germination of F. pseudalliacea (p < 0.05). Application of 500 ppm of GA3 increased seed germination percentage significantly (42.5%) compared to that of control (26.65%). Time of GA3 application (TGA) before stratification, with stratification and after stratification significantly affected seed germination (p < 0.05). Seeds treated with 500 ppm GA3 before stratification gave 40.80% germination while during stratification and after stratification this percentage changed to 68.30%, and 21.65%, respectively.

Induction of the hairy root

The A. rhizogenes strains ATCC 15834, 1724, A4, LBA9402 and Ar-318 were assessed on different explants including young leaves, stems, cotyledon, embryo, none of which responded to infection nor produced hairy roots. All of these explants were browned and died after few days following infection due to the high secretion of secondary metabolites of explants. Finally, hairy roots were induced in 10–12-day cultured embryo explants of F. pseudalliacea among and transformation only occurred in two A. rhizogenes strains ATCC 15834 and 1724. The strain ATCC 15834 with 30% transformation was significantly more effective than strain 1724 with 15% transformation (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Effect of A. rhizogenes strain on amount of hairy root (a) and number of hairy roots per explants (b). Dissimilar letters mark significant differences at the 5% level of LSD test

Explants were incubated with bacterial suspension for three different times of 10, 20 or 30 min. At the incubation time of 10 min the highest percentage of transformation (32%) was obtained which was significantly different compared to that of 20 or 30 min (Fig. 2). Extending the time of infection over 30 min caused browning and reduced survival of explants (data not shown).

Co-cultivation of A. rhizogenes strain ATCC 15834 for 72 h with 10–12-day cultured embryo explants resulted in the highest transformation rate (29%). This transformation rate was less at 48 h (22%) and 24 h (6%) (Fig. 3). A. rhizogenes strain ATCC 15834 cultures of OD600 1.0 induced the highest percentage of explants with hairy roots (Fig. 4). The bacterial culture of OD600 0.6 resulted in the lowest transformation rate (5%).

Fig. 3.

Fig. 3

Open in a new tab

Effect of A. rhizogenes strains (a), time of infection (b), concentrations of bacterial suspensions (c) and co-culture time (d) on transformation of 10–12-day cultured embryo explants for induction of hairy roots. Dissimilar letters mark significant differences at the 5% level of LSD test

Molecular conformation analysis of transgenic hairy roots

For confirming the transformation with two strains of A. rhizogenes, ATCC 15834 and 1724, PCR analysis was carried out using pairs of specific primers which amplify the T-DNA rolB gene present in A. rhizogenes. In explants infected with ATCC 15834 and 1724 strains, the rolB gene produced a band size of 500 and 513 bp, respectively. The PCR band size of 500 was not observed in wild type roots (negative control) (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

PCR analysis of rolB gene in transformed roots by A. rhizogenes ATCC 15834 and 1724 strains: M, Marker 2000 bp, lane 6, negative control (DNA roots of non-transgenic roots), lane 7, positive control (plasmid DNA) and lane 1–3, transformed roots with strain ATCC 15834 and lane 4 and 5 transformed with strain 1724

For comparison of hairy root growth from different bacterial strains, a transgenic line from 10 to 12-day cultured embryo explants infected with ATCC 15834 and one with 1724 were selected and cultured in MS and 1/2 B5 medium. The transgenic hairy roots induced by ATCC 15834 grew more rapidly and produced more branch than that of 1724 (Figs. 3a, 6). In addition, the amount of both fresh and dry weights of hairy roots were higher in ATCC 15834 lines compared to 1724.

Fig. 6.

Fig. 6

Open in a new tab

Production of transgenic hairy roots from 10 to 12-day cultured embryo explants of F. pseudalliacea by A. rhizogenes strain ATCC 15834. a Seedling obtained from embryo culture in sterile condition. b, c Hairy root production of explants 4 weeks after infection (b) and 6 weeks (c). d Microscopic picture of hairy roots. e Proliferation of hairy roots after 2 months in ½ MS medium. f Proliferation of hairy roots after 4 months in liquid ½ MS medium. g, h Comparisons of hairy roots growth in ½ MS (g) and ½ B5 (h)

Transgenic lines from both strains ATCC 15834 and 1724 were proliferated in ½ MS and half B5 medium. The ½ B5 medium cultures yielded in higher hairy root biomass compared to½ MS medium at different harvest times (Fig. 6).

Farnesiferol B contents of F. pseudalliacea roots

The amount of farnesiferol B of hairy root lines and wild type roots was compared by HPLC (Fig. 7). In 100 mg n-hexane extracts of wild type F. pseudalliacea root, the amount of farnesiferol B was 1.2 mg. The average amount of farnesiferol B, in 100 mg n-hexane extract of transgenic hairy root lines induced by strain ATCC 15834 was 0.7 mg. The mean of farnesiferol B was 0.75 mg/100 mg of extracts for transgenic hairy root lines induced by strain 1724. This was a proof of production of farnesiferol B in hairy roots of F. pseudalliacea (Fig. 8).

Fig. 7.

Fig. 7

Open in a new tab

The amount of Farnesiferol B obtained from different transgenic lines and natural roots (nmol/g DW). Dissimilar letters mark significant differences at the 5% level of LSD test

Fig. 8.

Fig. 8

Open in a new tab

HPLC chromatograms for analysis of Farnesiferol B content in wild type root (a), transgenic hairy roots hairy roots induced by strain 1724 (b) and ATCC 15834 (c)

Discussion

The seed germination rate is low for F. pseudalliacea due to seed dormancy. No effort has been put forward for the in vitro propagation of this critically endemic medicinal plant species. In this study, the effects of GA3, stratification and medium were tested on seed germination rate. Findings demonstrate that the highest germination rate was obtained in filter paper medium compared to MS and wet sand. In addition, GA3 and stratification significantly increased seed germination rate. Similar results were observed for Ferula species F. assafoetida L., F. ovina and F. gummosa where GA3 application and cold treatment significantly decreased seed dormancy and increased seed germination (Hassani et al. 2009; Keshtkar et al. 2008; Nadjafi et al. 2006). The action of low temperatures and GA3 application in decreasing seed dormancy might be related to the reduction of the level of inhibitor compounds or increased production of promotive hormones (Hassani et al. 2009) (Fig. 8).

To induce hairy roots, various explants including young leaves, stems, cotyledon, and young embryo were infected by five A. rhizogenes strains. Only the two strains of ATCC 15834 and 1724 on 10–12-day cultured embryo explants produced hairy roots and other explants failed to produce hairy roots. Diverse response of different explants to Agrobacterium has been reported for various plants. For example, in Withania sominifera (Indian ginseng), amongst the different explants including seedling roots, hypocotyls, cotyledons, stems, cotyledonary nodes and leaf pieces hairy roots were only induced from cotyledons and leaves (Murthy et al. 2008). The age, type and nature of explants affect the efficiency of Agrobacterium mediated transformation (Trypsteen et al. 1991; Yonemitsu et al. 1990) and specificity of Agrobacterium transformation is strongly related tohormonal and metabolite balance of plant tissues (Nin et al. 1997). In an experiment for induction of hairy roots in Althea officinalis using A. rhizogenes, on different explants including leaf, petiole and shoot, the maximum transformation frequency was observed on shoot explants with ATCC15834 strain (Tavassoli and Afshar 2018). One of the major problems we encountered in in vitro culture of F. pseudalliacea was browning and necrosis as a result of high amounts of secreted exudates from wounds in explants. Different approaches for reducing explants exudates including application of different antioxidants in medium, application of activated charcoal and PVP and using 10–12 days culture embryos which were the only cultured embryos that could survive after infection with A. rhizogenes strains.

Finding the optimal infection time is important in improving transformation efficiency of each plant. The 10 min infection time resulted in the maximum percentage of hairy root induction in 10–12 days cultured embryo explants by both strains ATCC 15834 and 1724. Similar results were reported for Ipomoea purpurea cotyledon explants (Tan et al. 2007) and Bacopa monnieri leaf explants (Bansal et al. 2014). Increasing the infection time to above 10 min in 10–12-day cultured embryo explants showed a decline in the percentage of hairy root induction. These results suggest that longer infection time might decrease explants viability and lead to lower root induction.

In fact, efficacy of A. rhizogenes strain on transformation has frequently been reported in numerous plant species (Sujatha et al. 2013). The ability of A. rhizogenes to infect plant species are strain dependent (Porter and Flores 1991; Sharafi et al. 2014). In an experiment for optimization of hairy root induction in Callerya speciose four strains, A4, LBA9402, R1601 and four explants, hypocotyls, cotyledons, leaves and excised stems were used. The highest rate of transformation was obtained in cotyledons by strain LBA9402 (Yao et al. 2016). Also, in hairy root induction of medicinal plant Semecarpus anacardium L. using A. rhizogenes strains LBA 9402, A4 and ATCC 15834, transformation frequency was higher in ATCC15834 strain compared to that of A4 and LBA 9402, regardless of explants types (Panda et al. 2017). These results confirm that transformation efficiency affected by both bacterial strain and explant in different plants. Amongst the five different A. rhizogenes strains, only strains ATCC 15834 and 1724 induced hairy roots in 10–12-day cultured embryo explants of F. pseudalliacea. Although, strain ATCC 15834 is clearly more effective than strain 1724. This research is the first to document and report hairy root induction with A. rhizogenes in F. pseudalliacea. Hairy root cultures offer many advantages including high and continuous yields of a wide range of metabolites, a high growth potential and genetic and biosynthetic stability (Grzegorczyk et al. 2006).

Inoculation, co-cultivation periods and concentration of bacteria are the main factors which play important roles in induction of hairy roots (Brijwal and Tamta 2015; Alpizar et al. 2006) showed that by raising the inoculation duration, the efficiency of hairy root formation increased, but it also led to tissue necrosis (Alpizar et al. 2006). Moreover, treatment of explants with A. rhizogenes suspension at OD600 of 0.2, 0.4 and 0.6 generated a steadily increasing transformation efficiency, but generated low transformation when suspensions with OD600 0.2 were used because there were insufficient A. rhizogenes cells to infect and transfer TDNA into explants cells (Liu et al. 2016). In this study, 10 min of bacterial infection and 72 h of co-cultivation periods were resulted in highest hairy roots in embryo explants of F. pseudalliacea. In addition, the increasing the OD600 of the infecting bacterial culture to one led to transformation frequency.

In this study we showed the presence of farnesiferol B in transgenic hairy root lines of the F. pseudalliacea by HPLC. This is the first report of hairy root induction in this species and also production of farnesiferol B in its hairy roots. This system provides an efficient tool for hairy root production of F. pseudalliacea and is useful for commercial production of important secondary metabolites such as farnesiferol B under in vitro conditions. Hairy root system for production of biological important compounds has been utilized in a variety of plant species (DeBoer et al. 2009; Kajikawa et al. 2009). F. pseudalliacea contains many important known and new secondary metabolites that can be produced through hairy root culture.

In conclusion seed germination of F. pseudalliacea was first optimized. A protocol for hairy root induction and increasing growth rate in hairy root cultures in F. pseudalliacea was developed. The hairy root transformation of F. pseudalliacea using A. rhizogenes strains ATCC 15834 and 1724 were established. The only explants for hairy root induction proved to be 10–12 day embryos. Farnesiferol B was measured in hairy root cultures and natural roots. Finally, since F. pseudalliacea is an endemic medicinal plant, hairy root cultures might be considered a useful system for large-scale production of farnesiferol B and other secondary metabolites.

Acknowledgements

This work was supported by the University of Kurdistan. The authors would like to thank Dr. Mirzaghaderi, University of Kurdistan, for his help in counting of mitotic chromosomes.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

References

  1. Abd El-Razek MH. Terpenoid coumarins of the genus Ferula. Heterocycles. 2003;60:689–716. [Google Scholar]
  2. Alpizar E, Dechamp E, Espeout S, Royer M, Lecouls A-C, Nicole M, Bertrand B, Lashermes P, Etienne H. Efficient production of Agrobacterium rhizogenes-transformed roots and composite plants for studying gene expression in coffee roots. Plant Cell Rep. 2006;25:959–967. doi: 10.1007/s00299-006-0159-9. [DOI] [PubMed] [Google Scholar]
  3. Asghari J, Atabaki V, Baher E, Mazaheritehrani M. Identification of sesquiterpene coumarins of oleo-gum resin of Ferula assa-foetida L. from the Yasuj region. Nat Prod Res. 2016;30:350–353. doi: 10.1080/14786419.2015.1050669. [DOI] [PubMed] [Google Scholar]
  4. Bahramnejad B, Naji M, Bose R, Jha S. A critical review on use of Agrobacterium rhizogenes and their associated binary vectors for plant transformation. Biotechnol Adv. 2019;S0734–9750(19):30095. doi: 10.1016/j.biotechadv.2019.06.004. [DOI] [PubMed] [Google Scholar]
  5. Bamehr H, Saidijam M, Dastan D, Amini R, Pourjafar M, Najafi R. Ferula pseudalliacea induces apoptosis in human colorectal cancer HCT-116 cells via mitochondria-dependent pathway. Arch Physiol Biochem. 2019;125:284–291. doi: 10.1080/13813455.2018.1455710. [DOI] [PubMed] [Google Scholar]
  6. Bansal M, Kumar A, Reddy MS. Influence of Agrobacterium rhizogenes strains on hairy root induction and ‘bacoside A’production from Bacopa monnieri (L.) Wettst. Acta Physiol Plant. 2014;36:2793–2801. [Google Scholar]
  7. Barthomeuf C, Lim S, Iranshahi M, Chollet P. Umbelliprenin from Ferula szowitsiana inhibits the growth of human M4Beu metastatic pigmented malignant melanoma cells through cell-cycle arrest in G1 and induction of caspase-dependent apoptosis. Phytomedicine. 2008;15:103–111. doi: 10.1016/j.phymed.2007.04.001. [DOI] [PubMed] [Google Scholar]
  8. Brijwal L, Tamta S. Agrobacterium rhizogenes mediated hairy root induction in endangered Berberis aristata DC. SpringerPlus. 2015;4:443. doi: 10.1186/s40064-015-1222-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dastan D, Salehi P, Gohari AR, Zimmermann S, Kaiser M, Hamburger M, Khavasi HR, Ebrahimi SN. Disesquiterpene and sesquiterpene coumarins from Ferula pseudalliacea, and determination of their absolute configurations. Phytochemistry. 2012;78:170–178. doi: 10.1016/j.phytochem.2012.02.016. [DOI] [PubMed] [Google Scholar]
  10. Dastan D, Salehi P, Ghanati F, Gohari AR, Maroofi H, Alnajar N. Phytotoxicity and cytotoxicity of disesquiterpene and sesquiterpene coumarins from Ferula pseudalliacea. Ind Crop Prod. 2014;55:43–48. [Google Scholar]
  11. Dastan D, Salehi P, Aliahmadi A, Gohari AR, Maroofi H, Ardalan A. New coumarin derivatives from Ferula pseudalliacea with antibacterial activity. Nat Prod Res. 2016;30:2747–2753. doi: 10.1080/14786419.2016.1149705. [DOI] [PubMed] [Google Scholar]
  12. DeBoer KD, Lye JC, Aitken CD, Su AK-K, Hamill JD. The A622 gene in Nicotiana glauca (tree tobacco): evidence for a functional role in pyridine alkaloid synthesis. Plant Mol Biol. 2009;69:299–312. doi: 10.1007/s11103-008-9425-2. [DOI] [PubMed] [Google Scholar]
  13. Eigner D, Scholz D. Ferula asa-foetida and Curcuma longa in traditional medical treatment and diet in Nepal. J Ethnopharmacol. 1999;67:1–6. doi: 10.1016/s0378-8741(98)00234-7. [DOI] [PubMed] [Google Scholar]
  14. El-Razek MHA, Ohta S, Ahmed AA, Hirata T. Sesquiterpene coumarins from the roots of Ferula assa-foetida. Phytochemistry. 2001;58:1289–1295. doi: 10.1016/s0031-9422(01)00324-7. [DOI] [PubMed] [Google Scholar]
  15. Golmohammadi F. Medical plant of Ferula assa-foetida and its cultivating, main characteristics and economical importance in South Khorasan province-east of Iran. TJEAS. 2013;3:2334–2346. [Google Scholar]
  16. Grzegorczyk I, Królicka A, Wysokińska H. Establishment of Salvia officinalis L. hairy root cultures for the production of rosmarinic acid. Zeitschrift für Naturforschung C. 2006;61:351–356. doi: 10.1515/znc-2006-5-609. [DOI] [PubMed] [Google Scholar]
  17. Gudarzi H, Salimi M, Irian S, Amanzadeh A, Mostafapour Kandelous H, Azadmanesh K, Salimi M. Ethanolic extract of Ferula gummosa is cytotoxic against cancer cells by inducing apoptosis and cell cycle arrest. Nat Prod Res. 2015;29:546–550. doi: 10.1080/14786419.2014.951854. [DOI] [PubMed] [Google Scholar]
  18. Hassani S, Saboora A, Radjabian T, Fallah Husseini H. Effects of temperature, GA3 and cytokinins on breaking seed dormancy of Ferula assa-foetida L. IJSTS. 2009;33:75–85. [Google Scholar]
  19. Hosseini SM, Bahramnejad B, Douleti Baneh H, Emamifar A, Goodwin PH. Hairy root culture optimization and resveratrol production from Vitis vinifera subsp. sylvesteris. World J Microbiol Biotechnol. 2017;33:67–76. doi: 10.1007/s11274-017-2235-4. [DOI] [PubMed] [Google Scholar]
  20. Iranshahi M, Arfa P, Ramezani M, Jaafari MR, Sadeghian H, Bassarello C, Piacente S, Pizza C. Sesquiterpene coumarins from Ferula szowitsiana and in vitro antileishmanial activity of 7-prenyloxycoumarins against promastigotes. Phytochemistry. 2007;68:554–561. doi: 10.1016/j.phytochem.2006.11.002. [DOI] [PubMed] [Google Scholar]
  21. Kajikawa M, Hirai N, Hashimoto T. A PIP-family protein is required for biosynthesis of tobacco alkaloids. Plant Mol Biol. 2009;69:287. doi: 10.1007/s11103-008-9424-3. [DOI] [PubMed] [Google Scholar]
  22. Kanani MR, Rahiminejad MR, Sonboli A, Mozaffarian V, Kazempour Osaloo S, Nejad Ebrahimi S. Chemotaxonomic significance of the essential oils of 18 Ferula species (Apiaceae) from Iran. Chem Biodivers. 2011;8:503–517. doi: 10.1002/cbdv.201000148. [DOI] [PubMed] [Google Scholar]
  23. Kapoor L. Handbook of ayurvedic medicinal plants: Herbal reference library. Boca Raton: CRC Press; 2000. [Google Scholar]
  24. Keshtkar A, Keshtkar H, Razavi S, Dalfardi S. Methods to break seed dormancy of Astragalus cyclophyllon. Afr J Biotechnol. 2008;7:3874–3877. [Google Scholar]
  25. Lee J-H, Choi S, Lee Y, Lee H-J, Kim K-H, Ahn K-S, Bae H, Lee H-J, Lee E-O, Ahn K-S. Herbal compound farnesiferol C exerts antiangiogenic and antitumor activity and targets multiple aspects of VEGFR1 (Flt1) or VEGFR2 (Flk1) signaling cascades. Mol Can Ther. 2010;9:389–399. doi: 10.1158/1535-7163.MCT-09-0775. [DOI] [PubMed] [Google Scholar]
  26. Lima JE, Benedito VA, Figueira A, Peres LEP. Callus, shoot and hairy root formation in vitro as affected by the sensitivity to auxin and ethylene in tomato mutants. Plant Cell Rep. 2009;28:1169–1177. doi: 10.1007/s00299-009-0718-y. [DOI] [PubMed] [Google Scholar]
  27. Liu S, Su L, Liu S, Zeng X, Zheng D, Hong L, Li L. Agrobacterium rhizogenes-mediated transformation of Arachis hypogaea: an efficient tool for functional study of genes. Biotechnol Biotechnol Equip. 2016;30:869–878. [Google Scholar]
  28. Moghadam FH, Dehghan M, Zarepur E, Dehlavi R, Ghaseminia F, Ehsani S, Mohammadzadeh G, Barzegar K. Oleo gum resin of Ferula assa-foetida L. ameliorates peripheral neuropathy in mice. J Ethnopharmacol. 2014;154:183–189. doi: 10.1016/j.jep.2014.03.069. [DOI] [PubMed] [Google Scholar]
  29. Murray RDH, Méndez J, Brown SA. The natural coumarins. Chichester: Wiley; 1982. [Google Scholar]
  30. Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant. 1962;15:473–497. [Google Scholar]
  31. Murthy HN, Dijkstra C, Anthony P, White DA, Davey MR, Power JB, Hahn EJ, Paek KY. Establishment of Withania somnifera hairy root cultures for the production of withanolide A. J Integr Plant Biol. 2008;50:975–981. doi: 10.1111/j.1744-7909.2008.00680.x. [DOI] [PubMed] [Google Scholar]
  32. Nadjafi F, Bannayan M, Tabrizi L, Rastgoo M. Seed germination and dormancy breaking techniques for Ferula gummosa and Teucrium polium. J Arid Environ. 2006;64:542–547. [Google Scholar]
  33. Nazari ZE, Iranshahi M. Biologically active sesquiterpene coumarins from Ferula species. Phytother Res. 2011;25:315–323. doi: 10.1002/ptr.3311. [DOI] [PubMed] [Google Scholar]
  34. Nin S, Bennici A, Roselli G, Mariotti D, Schiff S, Magherini R. Agrobacterium-mediated transformation of Artemisia absinthium L. (wormwood) and production of secondary metabolites. Plant Cell Rep. 1997;16:725–730. doi: 10.1007/s002990050310. [DOI] [PubMed] [Google Scholar]
  35. Ono NN, Tian L. The multiplicity of hairy root cultures: prolific possibilities. Plant Sci. 2011;180:439–446. doi: 10.1016/j.plantsci.2010.11.012. [DOI] [PubMed] [Google Scholar]
  36. Panda BM, Mehta UJ, Hazra S. Optimizing culture conditions for establishment of hairy root culture of Semecarpus anacardium L. 3 Biotech. 2017;7:21. doi: 10.1007/s13205-017-0608-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pimenov MG, Leonov MV. The genera of the Umbelliferae: a nomenclator. Kew: Royal Botanic Gardens; 1993. [Google Scholar]
  38. Pimenov M, Leonov M, Van Wyk B-E, Tilney P. Asia, the continent with the highest Umbelliferae biodiversity. S Afr J Bot. 2004;70:417–419. [Google Scholar]
  39. Porter JR, Flores H. Host range and implications of plant infection by Agrobacterium rhizogenes. Crit Rev Plant Sci. 1991;10:387–421. [Google Scholar]
  40. Razavi SM, Janani M. A new ester coumarin from Ferula Persica wild, indigenous to Iran. Nat Prod Res. 2015;29:717–721. doi: 10.1080/14786419.2014.982650. [DOI] [PubMed] [Google Scholar]
  41. Sattar Z, Iranshahi M. Phytochemistry and pharmacology of Ferula persica Boiss: a review. Iran J Basic Med Sci. 2017;20:1–8. doi: 10.22038/ijbms.2017.8085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Shahverdi A, Saadat F, Khorramizadeh M, Iranshahi M, Khoshayand M. Two matrix metalloproteinases inhibitors from Ferula persica var. persica. Phytomedicine. 2006;13:712–717. doi: 10.1016/j.phymed.2006.01.003. [DOI] [PubMed] [Google Scholar]
  43. Sharafi A, Sohi HH, Azadi P, Sharafi AA. Hairy root induction and plant regeneration of medicinal plant Dracocephalum kotschyi. Physiol Mol Biol Plants. 2014;20:257–262. doi: 10.1007/s12298-013-0217-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sharma P, Khajuria A, Verma S. Genomic DNA extraction from Ferula jaeschkeana Vatke (Apiaceae) optimized for random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) analysis. Proc Natl Acad Sci India Sect B Biol Sci. 2013;83:341–345. [Google Scholar]
  45. Sujatha G, Zdravkovic-Korac S, Flamini Calic D, Kumari BR. High-efficiency Agrobacterium rhizogenes-mediated genetic transformation in Artemisia vulgaris: hairy root production and essential oil analysis. Ind Crops Prod. 2013;44:643–652. [Google Scholar]
  46. Tan R-F, Tao J, Li L. Genetic transformation of Ipomoea purpurea mediated by Agrobacterium rhizogenes. Floric Ornam Biotech. 2007;1:131–135. [Google Scholar]
  47. Tavassoli P, Afshar Safipour. Influence of different Agrobacterium rhizogenes strains on hairy root induction and analysis of phenolic and flavonoid compounds in marshmallow (Althaea officinalis L.) 3 Biotech. 2018;8:351. doi: 10.1007/s13205-018-1375-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Trypsteen M, Van Lijsebettens M, Van Severen R, Van Montagu M. Agrobacterium rhizogenes-mediated transformation of Echinacea purpurea. Plant Cell Rep. 1991;10:85–89. doi: 10.1007/BF00236463. [DOI] [PubMed] [Google Scholar]
  49. Xu H, Zhou X, Lu J, Wang J, Wang X. Hairy roots induced by Agrobacterium rhizogenes and production of regenerative plants in hairy root cultures in maize. Sci Chin Ser C Life Sci. 2006;49:305–310. doi: 10.1007/s11427-006-0305-1. [DOI] [PubMed] [Google Scholar]
  50. Yao SC, Bai LH, Lan ZZ, Tang MQ, Zhai YJ, Huang H, Wei RC. Hairy root induction and polysaccharide production of medicinal plant Callerya speciosa Champ. Plant Cell Tissue Organ Cult. 2016;126:177–186. [Google Scholar]
  51. Yonemitsu H, Shimomura K, Satake M, Mochida S, Tanaka M, Endo T, Kaji A. Lobeline production by hairy root culture of Lobelia inflata L. Plant Cell Rep. 1990;9:307–310. doi: 10.1007/BF00232857. [DOI] [PubMed] [Google Scholar]
  52. Zare A, Solouki M, Omidi M, Irvani N, Oladzad A, Mahdi Nezad N. Effect of various treatments on seed germination and dormancy breaking in Ferula assa-foetida L. (Asafetida), a threatened medicinal herb. Trakia J Sci. 2011;9:57–61. [Google Scholar]
  53. Zarei H, Rezaee R, Behravan E, Soltani F, Mosaffa F, Iranshahi M, Behravan J. Diversin, from Ferula diversivittata protects human lymphocytes against oxidative stress induced by H2O2. Natural Prod Res. 2013;27:1016–1019. doi: 10.1080/14786419.2012.688053. [DOI] [PubMed] [Google Scholar]
  54. Zargari A. Pharmaceutical plants. Tehran: Persian Tehran University Press; 1997. [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES