Abstract
Background
Helicobacter pylori infection is etiologically associated with some important health problems such as gastric cancer. Because of the high clinical importance of H. pylori infection, development of a noninvasive test for the detection of H. pylori is desirable.
Methods
In this study, a loop‐mediated isothermal amplification (LAMP) targeted ureC of H. pylori was evaluated on 100 stool specimens and compared with a stool antigen test. Culture and rapid urease test were considered as gold standards.
Results
The overall detection rate of the fecal antigen test and LAMP was 58% and 82%, respectively. The analytical sensitivity of the fecal antigen test and LAMP was 500 and 10 H. pylori cells/g and 10 fg DNA/reaction, which is equal to six H. pylori genome.
Conclusion
LAMP technique has been characterized by high sensitivity and low detection limit for the detection of H. pylori in stool specimen. Clinical diagnostic performance of LAMP was better than the stool antigen test.
Keywords: clinical performance; Helicobacter pylori, limit of detection, loop‐mediated isothermal amplification, sensitivity, stool antigen test
INTRODUCTION
Helicobacter pylori is a curved, microaerophilic, and Gram‐negative rod bacterium. This bacterium is the most common human pathogen such that over half of the world's population is infected with this bacterium 1. In developed and developing countries, about 50% and 90% of adults, respectively, are infected with the bacteria 2. This bacterium is considered as the main cause of gastritis, gastric and duodenal ulcers, gastric adenocarcinoma, and MALT lymphoma 3.
In 1994, the International Agency for Research on Cancer introduced H. pylori as a class A carcinogens (definite carcinogen) 4. Gastric cancer, as a consequence of chronic gastric infection by H. pylori, is the fourth most common cancer and the second leading cause of cancer‐related death in the world 5, 6.
Several methods can be used to diagnose H. pylori infection, which are divided into invasive and noninvasive methods based on the use of endoscopy. Histopathology, culture, and rapid urease test (RUT) are considered as the invasive tests. Fecal antigen test, urea breath test (UBT), and serology are known as the noninvasive tests 7, 8.
It is reported that mortality and morbidity rates at a single endoscopy were one in 2,000 and one in 200 people, respectively 9, 10. Therefore, great efforts have been performed to develop an accurate and reliable noninvasive method to diagnose H. pylori.
On the basis of the Florence consensus report (Maastricht IV), endoscopy for diagnostic examination of the upper gastrointestinal tract (GI) with biopsies is recommended for old symptomatic patients and all patients with alarming features (such as weight loss, dysphagia, GI bleeding, abdominal mass, and iron deficient anemia). In dyspeptic patients younger than the age of 45 years and in populations where the prevalence of H. pylori is over 20%, test and treatment strategy is preferable. In these patients, H. pylori infections were assayed using a reliable noninvasive method and decision for the treatment of infection can be made. Test and treatment strategy is cost effective and efficient in patients with dyspepsia. Some of the noninvasive methods are proposed for the detection of H. pylori in test and treatment strategy including UBT, fecal antigen test, and serological test 11.
However, the culture of H. pylori from gastric biopsy specimen is the gold standard methods for diagnosis of H. pylori infection, but the culture of this bacterium from stool sample is extremely difficult due to overgrowth of other bacteria 12, 13.
Despite having a sensitivity of 88–95% and specificity of 95–100%, UBT is an expensive test and requires special device 13. Furthermore, the serological test has low specificity; therefore, this method cannot be used for following up the eradication 8, 14.
Today, the stool antigen test is more accessible and has been examined in numerous studies. The sensitivity and specificity of the test have been reported above 90%. But in polyclonal stool antigen, test sensitivity and specificity will drop. However, this test is very useful, as a noninvasive test but have limitations, such as the effect of stool consistency in the test result, and clinical limitations such as bleeding. Monoclonal stool antigen kits are also very expensive 15, 16, 17.
Molecular methods can also be used as a noninvasive test for detection of H. pylori in the stool of patients. One of the molecular techniques currently used in the diagnosis of various microorganisms is loop‐mediated isothermal amplification (LAMP). In this method, an isothermal temperature (60–65°C) is applied for 60–90 min and amplification is done by Bst DNA polymerase. A positive reaction is indicated by the turbidity caused by an increase in quantity of magnesium pyrophosphate in the reaction as a by‐product of nucleic acid amplification or the color change after adding an intercalating dye to the reaction solution 18, 19.
Detection of H. pylori in stool specimens with LAMP technique can be used as a noninvasive test for the diagnosis and appropriate treatment of infection. It can also be used in epidemiological studies on H. pylori infection in different populations.
The purpose of this study was to set up the LAMP reaction as a fast noninvasive method and for the evaluation of its diagnostic value for the detection of H. pylori in stool of patients suffering from gastroduodenal disorders referred to Imam Khomeini Hospital, Kermanshah, and compared with the stool antigen detection kit.
MATERIALS AND METHODS
Study Population and Sampling
This study was a descriptive cross‐sectional survey that was carried out on 100 patients who were referred to Imam Khomeini Hospital in Kermanshah in 2013–2014. Patients were examined by a specialist through gastrointestinal endoscopy. Informed consent and patient data collection form were completed for each patient. Patients were excluded if they have been taking drugs for the treatment of H. pylori infection 2 weeks prior to the study 20. Two pairs of biopsy specimens were collected from the antrum and corpus of the stomach for RUT and culture. One pair of biopsy specimens were transported to the laboratory in Brucella broth containing 20% glycerol as transport medium at 4°C. The other one was used for RUT. Stool samples were also collected from all patients. Stool samples were transported to the laboratory at 4°C and stored at −70°C until analysis.
RUT and culture were considered as the gold standard in this study. Sensitivity and specificity of the stool antigen detection kit and LAMP were compared according to the result of gold standard tests. A positive result was defined as either positive culture or positive RUT, and a negative result was considered if both tests were negative.
Culture
In order to set up the LAMP method, extracted DNA from pure colonies H. pylori was used in each reaction. Therefore, H. pylori was cultured in columbia agar plates enriched with eggs containing 5 mg/l trimethoprim, 10 mg/l vancomycin, and 2.5 mg/l amphotericin B. The plates were incubated under microaerophilic condition at 37°C for 3–5 days.
For the primary isolation and subculture of the identified colonies, the culture conditions were used as initially described. Tiny translucent gray presumed colonies were confirmed by gram staining, and positive reaction for oxidase, catalase, and urease tests 21.
DNA Extraction
DNA of stool samples was extracted using a stool‐specific DNA extraction kit (QIAamp DNA Stool Mini Kit; Qiagene, Hilden, Germany) according to the manufacturer's instruction. The quality of the extracted DNA was determined by the Nanodrop device (Thermo Scientific, Delaware, USA) and stored at −20°C.
Helicobacter pylori DNA of the pure colonies was extracted by using a kit (AccuPrep Genomic DNA Extraction Kit; Bioneer, South Korea) according to the manufacturer's protocol. The quality of extracted DNA was determined by the Nanodrop device. H. pylori clinical isolates were used as a positive control and approved by biochemical methods, the Gram stain, and ureC gene PCR test.
Analytical Sensitivity of Stool Antigen Test and LAMP
The analytical sensitivity of LAMP and stool antigen tests was determined using spiking of specific cell number of pure 3 days old culture of H. pylori. The bacterial cell number was quantified by Petroff‐Hausser Counter. Cell counting was done three times, and the mean was considered as a real number of H. pylori in suspension. H. pylori suspension was used to make tenfold serial dilution in phosphate‐buffered saline (PBS), and the appropriate number of H. pylori cells was spiked in 200 mg of fecal samples 22. It must be noted that fecal sample used in the analytical sensitivity testing was collected from a patient who was negative for H. pylori in RUT, culture, and PCR of gastric biopsy and also negative for stool PCR.
Then, DNA of H. pylori spiked stool samples was extracted using a kit, and LAMP was performed using urease C specific primers for H. pylori according to previous conditions.
To determine the minimum amount of H. pylori DNA detected by LAMP (limit of detection), the tenfold serial dilution of the purified H. pylori DNA with known concentration was prepared and subjected to the LAMP reaction. Different concentrations of a known concentration of purified H. pylori DNA were prepared including 10, 1, 0.1, 0.01 ng (10 pg); 1, 0.1, 0.01 pg (10 fg); and 1, 0.1, and 0.01 fg. To calculate the copy number in the reaction, H. pylori genome size was considered as 1.6 × 107 bp.
Determining Analytical Specificity of the LAMP Primers
To determine the analytical specificity of the primers, the LAMP reaction was carried out on pure DNA of several bacteria, which were present in the stool. These bacteria were Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, clinical isolates of Shigella dysenteriae, Staphylococcus epidermidis, Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis, Yersinia enterocolitica, and Salmonella typhi. All the bacteria were confirmed by biochemical tests.
Stool Antigen Test
The presence of H. pylori antigen in stool was determined using a specific commercial kit (H pylori Ag test; Intex Diagnostika, Switzerland) according to the manufacturer's instruction. All components of the kit and fecal samples were kept at room temperature (18–25°C) before running the test. Finally, the results of the test were compared on the basis of results obtained from the two gold standards.
LAMP Reaction
For designing the primers used in the LAMP method, first conserved region of ureC gene was determined by alignment of ureC sequence from multiple strains of H. pylori using ClustalW2 software. Alignment file was subjected to primer design using Primer explorer version 4. Three pairs of primers used in this study are shown in Table 1.
Table 1.
Primers Used in the LAMP Method
| Primer name | Sequences (5′ to 3′) |
|---|---|
| HP‐ureCBIP | CTCGCCTCCAAAATTGGCTTGCGATTGGGGATAAGTTTG |
| HP‐ureCFIP | GCATATCATTTTTAGCGATTACGCTCACTAACGCGCTCACTTG |
| HP‐ureCB3 | TCCCAAGATTTGGAATTGAAG |
| HP‐ureCF3 | GCTTACCTGCTTGCTTTC |
| HP‐ureCLB | TCAATTGCATGCATTCGCTCA |
| HP‐ureCLF | CAGGCGATGGTTTGGTGTG |
The LAMP reaction was carried out as described previously with some modifications 23. In brief, the optimal reaction was performed in a total volume of 30 μl, consisting of 20 mM Tris‐HCl (pH 8.8 at 25°C), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X‐100, 2 Mm dNTPs, 12 Mm MgSO4, 0.8 M Betaine (Sigma‐Aldrich), primers including 1.6 μM HP‐ureCFIP and HP‐ureCBIP, 0.2 μM HP‐ureCB3 and HP‐ureCF3, 0.8 μM HP‐ureCLB and HP‐ureCLF, 8U Bst DNA polymerase, and 3 μl DNA, extracted from stool samples. Initial heat denaturation of the target DNA was carried out at 96°C for 3 min, and then the reaction mixture was placed on ice for 30 s to add 8 U Bst DNA polymerase (New England Biolabs, Bishop's Stortford, UK) followed by incubation at optimal temperature of 65°C for 60 min. Finally, the reaction was terminated at 90°C for 2 min. Positive and negative controls were included in each sample run 24. Amplification was detected using visual detection of white turbidity of the amplification by‐products (magnesium pyrophosphate salts) or a white pellet following centrifugation with the naked eyes.
Statistical Analysis
The clinical sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of LAMP and fecal antigen tests for diagnosis of H. pylori in stool sample of the patients suffering from gastroduodenal diseases were calculated using SPSS. Positive culture and/or positive RUT were considered as the “gold standard.” Statistical analysis was conducted using StatsDirect 2.7.2 (StatsDirect Ltd, Cheshire, UK) and the McNemar's chi‐square test. The value of P < 0.05 was considered statistically significant. The agreement between the methods was calculated using the Cohen's kappa coefficient.
RESULTS
Patients
The age of enrolled patients was between 17 and 87 years with a mean age of 50.5 ± 17.61 years. A total of 100 patients including 42 female (42%) with a mean age of 49.09 ± 18.44 and 58 men (58%) with a mean age of 50.64 ± 16.64 were included. Among the patients, 64 patients (64%) were outpatients and 36 patients (36%) were hospitalized in the internal medicine ward and other departments.
Culture and RUT
Among the 100 biopsy specimens taken from patients with gastroduodenal diseases, 53 patients (53%) were positive for H. pylori in RUT and 44 patients (44%) were positive for H. pylori in culture of biopsy specimens.
Analytical Sensitivity of LAMP and Stool Antigen Test
The analytical sensitivity of fecal antigen test for detecting H. pylori in fecal samples was 100 bacteria per 200 mg of feces (500 bacteria per gram of feces). The evaluation of analytical sensitivity of LAMP using spiked stool sample with the known number of H. pylori shown in this test was able to detect as low as two bacteria per 200 mg of feces or in other words ten bacteria per gram of feces. The detection limit of the H. pylori purified DNA was determined using the LAMP assay; the ureC‐specific primers were able to detect as low as 10 fg DNA per reaction, which is equal to six copy number of H. pylori genome.
Analytical Specificity of the Primers
None of the extracted DNA from non‐H. pylori microorganisms resulted in positive amplification in LAMP, and the positive result was shown only in H. pylori DNA. This means that analytical specificity of the LAMP assay for H. pylori diagnosis was 100%.
Fecal Antigen Test
The overall detection rate of the fecal antigen test was 58% (58/100), and 42% (42/100) of the samples were negative for H. pylori. It means that 16 and 25 samples, which have been negative in urease and cultures, were positive in the fecal antigen test.
The sensitivity, specificity, PPV, and NPV of the fecal antigen test were 79.3%, 71.4%, 79.3%, and 71.4%, respectively. The observed agreement between the fecal antigen test and gold standard was 76% and the κ coefficient of 0.5074 suggested a moderate agreement between two diagnostic tests.
LAMP Reaction
The rate of positivity for the LAMP assay was 82% (82/100). The data showed that the LAMP assay had a higher positive rate than that of fecal antigen test and gold standard methods. Twenty‐nine out of 47 RUT were negative, whereas 38 out of 56 culture negative biopsy specimens were positive in the LAMP assay.
The sensitivity, specificity, PPV, and NPV of the LAMP assay were 100%, 42.8%, 70.7%, and 100%, respectively. The observed agreement between the LAMP test and gold standard was 76% and the κ coefficient of 0.4652 suggested a moderate agreement between two diagnostic tests.
DISCUSSION
H. pylori is a curved, microaerophilic, and Gram‐negative rod bacterium, which is etiologically associated with gastritis, peptic ulcer disease, MALT lymphoma, and gastric cancer 3. The stomach cancer is the most common cancer among Iranian men and third common cancer in women 25. The age‐standardized death rate (per 100,000 person year) of stomach cancer in Iran is 26.1 and 11.1 in male and female, respectively 5.
Because of the high clinical importance of H. pylori infection, numerous diagnostic methods based on nucleic acid technology for its detection in clinical, biological, and environmental samples have been developed 22, 26, 27, 28, 29, 30, 31, 32, 33, 34.
Stool specimen has been considered and used as a sample for the development of a direct method of H. pylori detection by many investigators because it is easy to collect by noninvasive access 35. A lot of studies have been conducted for detecting H. pylori in stool samples based on PCR with target sequences such as ureA, ureC, and 16S rRNA genes from different populations. Different sensitivity and specificity have been reported ranging from 25% to 100% and 80% to 100%, respectively 33, 36, 37, 38, 39, 40, 41, 42. However, the result of these tests depend on the quality and amount of DNA recovered, the target sequences, differences in the specificity and sensitivity of the primers used, and the nature of the amplification protocol 43. As a consequence of the mentioned obstacles, the frequency of the H. pylori DNA detection in stool specimen also varies from 25% to 100%.
In addition to improved sensitivity and specificity, a diagnostic test for H. pylori detection must be rapid in performance, cost effective, and have potential of standardization and specially noninvasiveness. Since endoscopy as an invasive procedure is not necessary in many patients unless in patients with alarming symptoms, the development of diagnostic test for H. pylori detection has traditionally focused on a noninvasive test 11.
LAMP, as a novel nucleic acid isothermal amplification technique, has been described by Notomi et al. 44, and nowadays known as a rapid, specific, sensitive, cost‐effective, easy‐operating, and most promising molecular diagnostic test for infectious pathogens 23, 30, 44, 45.
The aim of this study was to evaluate the LAMP reaction as a fast noninvasive method and its diagnostic value for the detection of H. pylori in stool of patients.
The overall detection rate of the fecal antigen test was 58% (58/100). The sensitivity, specificity, PPV, and NPV of the fecal antigen test were comparable to other studies, which were 79.3%, 71.4%, 79.3%, and 71.4%, respectively. The sensitivity and specificity of the fecal antigen test, which have been reported in previous studies, range from 67% to 100% and 83% to 99%, respectively. While the sensitivity and specificity were significantly higher when the monoclonal fecal antigen test has been used 43, 46, 47, it must be emphasized that monoclonal kits are not affordable in terms of price 48, 49. In addition, the sensitivity of the stool antigen test will decrease in frozen fecal sample. The analytical sensitivity of the stool antigen test kit used in this study was 500 bacteria per gram of feces, whereas in other studies the analytical sensitivity was not checked.
The overall detection rate of the LAMP method was 82% samples (82/100). The sensitivity, specificity, PPV, and NPV were 100%, 42.8%, 70.7%, and 100%, respectively. The LAMP test was positive in 24 stool specimens, which were negative in the fecal antigen test. This is because the H. pylori is present at a low number in fecal samples and only a test with sufficient limit of detection or high analytical sensitivity can detect it. The LAMP method has a detection limit as low as ten H. pylori cell per gram of feces, which is 50 times more sensitive than the fecal antigen test. In addition, the inhibitors, which are present in extracted DNA from stool, were tolerated by Bst DNA polymerase in the LAMP reaction 35.
However, the analytical sensitivity was not evaluated in many studies, but the analytical sensitivity of the LAMP for detection of H. pylori in stool samples achieved in this study was more than earlier studies using other molecular tests 50.
The sensitivity and specificity that have been reported in previous studies ranged from 42.6% to 93.7% and 92.3% to 100%, respectively (42, 48, 50).
For example, in a study using a real‐time PCR technique the sensitivity and specificity of H. pylori detection in feces have been reported as 69% and 100%, respectively 33. These values for EIA were 88.9% and 94.6% 50. Low specificity of the mentioned methods is due to low limit of detection or high analytical sensitivity. Thus, it is suggested that the gold standard for H. pylori diagnosis should be revised.
The limit of detection was also determined using pure DNA. The minimum amount of the pure H. pylori DNA, which was detected by the LAMP method, was 10 fg. This amount of DNA is approximately equal to six H. pylori genome. This means the limit of detection of pure DNA was equal to the one achieved by 16SrRNA‐PCR (29, 42) and ten times more sensitive than the earlier study 30.
CONCLUSIONS
LAMP technique has been characterized by high sensitivity and low detection limits for the detection of H. pylori in stool specimens, and the clinical diagnostic performance was better than the stool antigen test.
CONFLICT OF INTEREST
The authors have declared no conflict of interest.
ACKNOWLEDGMENTS
The authors gratefully acknowledge funding supported by grant from Iran National Science Foundation (INSF) with grant No. 91002272. The authors also thank the clinical research development center, Imam Khomeini Hospital, Kermanshah University of Medical Sciences, Kermanshah, Iran.
REFERENCES
- 1. Bornschein J, Malfertheiner P. Helicobacter pylori and Gastric Cancer. Dig Dis 2014;32(3):249–264. [DOI] [PubMed] [Google Scholar]
- 2. Havaei SA, Mohajeri P, Khashei R, Salehi R, Tavakoli H. Prevalence of Helicobacter pylori vacA different genotypes in Isfahan, Iran. Adv Biomed Res 2014;3:48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Walker MM, Talley NJ. Review article: bacteria and pathogenesis of disease in the upper gastrointestinal tract ‐ beyond the era of Helicobacter pylori . Aliment Pharmacol Ther 2014;39(8):767–779. [DOI] [PubMed] [Google Scholar]
- 4. Qiu HB, Zhang LY, Keshari RP, et al. Relationship between H. pylori infection and clinicopathological features and prognosis of gastric cancer. BMC Cancer 2010;10:374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Malekzadeh R, Derakhshan MH, Malekzadeh Z. Gastric cancer in Iran: Epidemiology and risk factors. Arch Iran Med 2009;12(6):576–583. [PubMed] [Google Scholar]
- 6. Wang F, Meng W, Wang B, Qiao L. Helicobacter pylori‐induced gastric inflammation and gastric cancer. Cancer Lett 2014;345(2):196–202. [DOI] [PubMed] [Google Scholar]
- 7. Guarner J, Kalach N, Elitsur Y, Koletzko S. Helicobacter pylori diagnostic tests in children: Review of the literature from 1999 to 2009. Eur J Pediatr 2010;169(1):15–25. [DOI] [PubMed] [Google Scholar]
- 8. McColl KE. Clinical practice. Helicobacter pylori infection. N Engl J Med 2010;362(17):1597–1604. [DOI] [PubMed] [Google Scholar]
- 9. Nguyen TV, Bengtsson C, Yin L, et al. Eradication of Helicobacter pylori in children in Vietnam in relation to antibiotic resistance. Helicobacter 2012;17(4):319–325. [DOI] [PubMed] [Google Scholar]
- 10. Abbas Z, Yakoob J, Usman MW, Shakir T, Hamid S, Jafri W. Effect of Helicobacter pylori and its virulence factors on portal hypertensive gastropathy and interleukin (IL)‐8, IL‐10, and tumor necrosis factor‐alpha levels. Saudi J Gastroenterol 2014;20(2):120–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Malfertheiner P, Megraud F, O'Morain CA, et al. Management of Helicobacter pylori infection—The Maastricht IV/Florence Consensus Report. Gut 2012;61(5):646–664. [DOI] [PubMed] [Google Scholar]
- 12. Kasper D, Braunwald E, Fauci A, Hauser S. HARRISON'S Manual of Medicine. New York: McGraw‐Hill; 2005. [Google Scholar]
- 13. Ogata SK, Godoy AP, da Silva Patricio FR, Kawakami E. High Helicobacter pylori resistance to metronidazole and clarithromycin in Brazilian children and adolescents. J Pediatr Gastroenterol Nutr 2013;56(6):645–648. [DOI] [PubMed] [Google Scholar]
- 14. Seo JH, Jun JS, Yeom JS, et al. Changing pattern of antibiotic resistance of Helicobacter pylori in children during 20 years in Jinju, South Korea. Pediatr Int 2013;55(3):332–336. [DOI] [PubMed] [Google Scholar]
- 15. Deguchi R, Matsushima M, Suzuki T, et al. Comparison of a monoclonal with a polyclonal antibody‐based enzyme immunoassay stool test in diagnosing Helicobacter pylori infection after eradication therapy. J Gastroenterol 2009;44(7):713–716. [DOI] [PubMed] [Google Scholar]
- 16. Chiu HM, Lee YC, Tu CH, et al. Association between early stage colon neoplasms and false‐negative results from the fecal immunochemical test. Clin Gastroenterol Hepatol 2013;11(7):832–838, e831–e832. [DOI] [PubMed] [Google Scholar]
- 17. Soltani J, Amirzadeh J, Nahedi S, et al. Prevalence of Helicobacter pylori infection in children, a population‐based cross‐sectional study in west of Iran. Iran J Pediatr 2013;23(1):8–13. [PMC free article] [PubMed] [Google Scholar]
- 18. Yamazaki W, Taguchi M, Ishibashi M, et al. Development and evaluation of a loop‐mediated isothermal amplification assay for rapid and simple detection of Campylobacter jejuni and Campylobacter coli . J Med Microbiol 2008;57(Pt 4):444–451. [DOI] [PubMed] [Google Scholar]
- 19. Zhao X, Li Y, Wang L, et al. Development and application of a loop‐mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol Biol Rep 2010;37(5):2183–2188. [DOI] [PubMed] [Google Scholar]
- 20. Zullo A, Hassan C, Lorenzetti R, Winn S, Morini S. A clinical practice viewpoint: To culture or not to culture Helicobacter pylori? Dig Liver Dis 2003;35(5):357–361. [DOI] [PubMed] [Google Scholar]
- 21. O'Connor A, Taneike I, Nami A, et al. Helicobacter pylori resistance rates for levofloxacin, tetracycline and rifabutin among Irish isolates at a reference centre. Ir J Med Sci 2013;182(4):693–695. [DOI] [PubMed] [Google Scholar]
- 22. Amirhooshang A, Ramin A, Ehsan A, Mansour R, Shahram B. High frequency of Helicobacter pylori DNA in drinking water in Kermanshah, Iran, during June–November 2012. J Water Health 2014;12(3):504–512. [DOI] [PubMed] [Google Scholar]
- 23. Aryan E, Makvandi M, Farajzadeh A, et al. Clinical value of IS6110‐based loop‐mediated isothermal amplification for detection of Mycobacterium tuberculosis complex in respiratory specimens. J Infect 2013;66(6):487–493. [DOI] [PubMed] [Google Scholar]
- 24. Aryan E, Makvandi M, Farajzadeh A, et al. A novel and more sensitive loop‐mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex. Microbiol Res 2010;165(3):211–220. [DOI] [PubMed] [Google Scholar]
- 25. Mousavi SM, Gouya MM, Ramazani R, Davanlou M, Hajsadeghi N, Seddighi Z. Cancer incidence and mortality in Iran. Ann Oncol 2009;20(3):556–563. [DOI] [PubMed] [Google Scholar]
- 26. Ho SA, Hoyle JA, Lewis FA, et al. Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals. J Clin Microbiol 1991;29(11):2543–2549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Clayton CL, Kleanthous H, Coates PJ, Morgan DD, Tabaqchali S. Sensitive detection of Helicobacter pylori by using polymerase chain reaction. J Clin Microbiol 1992;30(1):192–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Bamford KB, Lutton DA, O'Loughlin B, Coulter WA, Collins JS. Nested primers improve sensitivity in the detection of Helicobacter pylori by the polymerase chain reaction. J Infect 1998;36(1):105–110. [DOI] [PubMed] [Google Scholar]
- 29. Lu JJ, Perng CL, Shyu RY, et al. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol 1999;37(3):772–774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Minami M, Ohta M, Ohkura T, et al. Use of a combination of brushing technique and the loop‐mediated isothermal amplification method as a novel, rapid, and safe system for detection of Helicobacter pylori . J Clin Microbiol 2006;44(11):4032–4037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Gill P, Alvandi AH, Abdul‐Tehrani H, Sadeghizadeh M. Colorimetric detection of Helicobacter pylori DNA using isothermal helicase‐dependent amplification and gold nanoparticle probes. Diagn Microbiol Infect Dis 2008;62(2):119–124. [DOI] [PubMed] [Google Scholar]
- 32. Medina ML, Medina MG, Martin GT, Picon SO, Bancalari A, Merino LA. Molecular detection of Helicobacter pylori in oral samples from patients suffering digestive pathologies. Medicina oral, patologia oral y cirugia bucal 2010;15(1):e38–e42. [PubMed] [Google Scholar]
- 33. Scaletsky IC, Aranda KR, Garcia GT, et al. Application of real‐time PCR stool assay for Helicobacter pylori detection and clarithromycin susceptibility testing in Brazilian children. Helicobacter 2011;16(4):311–315. [DOI] [PubMed] [Google Scholar]
- 34. Wisessombat S, Meethai C, Hamgo S. A new biphasic test for the detection of Helicobacter pylori in gastric biopsies. J Microbiol Methods 2014;96:19–24. [DOI] [PubMed] [Google Scholar]
- 35. MacKay WG, Williams CL, McMillan M, Ndip RN, Shepherd AJ, Weaver LT. Evaluation of protocol using gene capture and PCR for detection of Helicobacter pylori DNA in feces. J Clin Microbiol 2003;41(10):4589–4593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Li C, Ha T, Ferguson DA, Jr. , et al. A newly developed PCR assay of H. pylori in gastric biopsy, saliva, and feces. Evidence of high prevalence of H. pylori in saliva supports oral transmission. Dig Dis Sci 1996;41(11):2142–2149. [DOI] [PubMed] [Google Scholar]
- 37. Schabereiter‐Gurtner C, Hirschl AM, Dragosics B, et al. Novel real‐time PCR assay for detection of Helicobacter pylori infection and simultaneous clarithromycin susceptibility testing of stool and biopsy specimens. J Clin Microbiol 2004;42(10):4512–4518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Zambon CF, Basso D, Navaglia F, et al. Non‐invasive diagnosis of Helicobacter pylori infection: Simplified 13C‐urea breath test, stool antigen testing, or DNA PCR in human feces in a clinical laboratory setting? Clin Biochem 2004;37(4):261–267. [DOI] [PubMed] [Google Scholar]
- 39. Booka M, Okuda M, Shin K, et al. Polymerase chain reaction–restriction fragment length polymorphism analysis of clarithromycin‐resistant Helicobacter pylori infection in children using stool sample. Helicobacter 2005;10(3):205–213. [DOI] [PubMed] [Google Scholar]
- 40. Sen N, Yilmaz O, Simsek I, Kupelioglu AA, Ellidokuz H. Detection of Helicobacter pylori DNA by a simple stool PCR method in adult dyspeptic patients. Helicobacter 2005;10(4):353–359. [DOI] [PubMed] [Google Scholar]
- 41. Vecsei A, Innerhofer A, Binder C, et al. Stool polymerase chain reaction for Helicobacter pylori detection and clarithromycin susceptibility testing in children. Clin Gastroenterol Hepatol 2010;8(3):309–312. [DOI] [PubMed] [Google Scholar]
- 42. Smith SI, Fowora MA, Lesi OA, et al. Application of stool‐PCR for the diagnosis of Helicobacter pylori from stool in Nigeria—A pilot study. Springerplus 2012;1(1):78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Leal YA, Cedillo‐Rivera R, Simon JA, Velazquez JR, Flores LL, Torres J. Utility of stool sample‐based tests for the diagnosis of Helicobacter pylori infection in children. J Pediatr Gastroenterol Nutr 2011;52(6):718–728. [DOI] [PubMed] [Google Scholar]
- 44. Notomi T, Okayama H, Masubuchi H, et al. Loop‐mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28(12):E63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Yano A, Ishimaru R, Hujikata R. Rapid and sensitive detection of heat‐labile I and heat‐stable I enterotoxin genes of enterotoxigenic Escherichia coli by loop‐mediated isothermal amplification. J Microbiol Methods 2007;68(2):414–420. [DOI] [PubMed] [Google Scholar]
- 46. Pourakbari B, Mirsalehian A, Maleknejad P, et al. Evaluation of a new antigen for diagnosis of Helicobacter pylori infection in stool of adult and children. Helicobacter 2011;16(1):42–46. [DOI] [PubMed] [Google Scholar]
- 47. Zhou X, Su J, Xu G, Zhang G. Accuracy of stool antigen test for the diagnosis of Helicobacter pylori infection in children: A meta‐analysis. Clin Res Hepatol Gastroenterol 2014;38(5):629–638. [DOI] [PubMed] [Google Scholar]
- 48. Falsafi T, Valizadeh N, Sepehr S, Najafi M. Application of a stool antigen test to evaluate the incidence of Helicobacter pylori infection in children and adolescents from Tehran, Iran. Clin Diagn Lab Immunol 2005;12(9):1094–1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Guven MA, Ertas IE, Coskun A, Ciragil P. Serologic and stool antigen assay of Helicobacter pylori infection in hyperemesis gravidarum: which test is useful during early pregnancy? Taiwan J Obstet Gynecol 2011;50(1):37–41. [DOI] [PubMed] [Google Scholar]
- 50. Makristathis A, Pasching E, Schutze K, Wimmer M, Rotter ML, Hirschl AM. Detection of Helicobacter pylori in stool specimens by PCR and antigen enzyme immunoassay. J Clin Microbiol 1998;36(9):2772–2774. [DOI] [PMC free article] [PubMed] [Google Scholar]