Abstract
This study reports loop‐mediated isothermal amplification (LAMP) for rapid detection of methicillin‐resistant Staphylococcus aureus from direct clinical specimens. Four primers including outer and inner primers were specifically designed on the two target sequences—femB to identify S. aureus and mecA to identify antibiotic‐resistant gene. Reference strains including various species of gram‐positive/gram‐negative isolates were used to evaluate and optimize LAMP assays. The optimum LAMP condition was found at 63°C within 70 min assay time (include hybridization with FITC probe for 5 min and further 5 min for reading the results on the lateral flow dipstick). The detection limits of LAMP for mecA was 10 pg of total DNA or 100 CFU/ml. The LAMP assays were applied to a total of 155 samples of direct DNA extraction from sputum and hemoculture bottles. The sensitivity of LAMP for mecA detection in sputum and hemoculture bottles was 93.3% (28/30) and 100% (52/52), respectively. In conclusion, LAMP assay is an alternative technique for rapid detection of MRSA infection with a technical simplicity and cost‐effective method in a routine diagnostic laboratory.
Keywords: loop‐mediated isothermal amplification, lateral flow dipstick, methicillin‐resistant Staphylococcus aureus, MRSA, clinical specimens
INTRODUCTION
Methicillin‐resistant Staphylococcus aureus (MRSA) strains have emerged as a major epidemiological problem in hospital worldwide and resulted in significant mortalities 1, 2, 3, 4. This is due to the effect of β‐lactam resistance in S. aureus, which is mediated by the production of penicillin‐binding protein 2a (PBP2a or PBP2′) encoded by mecA gene 5. In Southeast Asia, MRSA was observed in more than 50% of patients 6. A rapid and efficient technique is needed to identify hidden reservoirs of MRSA patients and appropriate application of isolation precautions should be considered. Screening method for MRSA is a key component of the successful infection‐control strategies.
Conventional method for detection of MRSA has been the susceptibility tests, including disk diffusion or broth dilution test. This method is not suitable for programs that implement rapid screening where required time to identify MRSA is at least 24–48 hr 7. To fasten the screening process, the molecular techniques such as polymerase chain reaction (PCR), multiplex, or real‐time fluorescence PCR have been investigated for direct detection of MRSA from blood hemoculture in routine laboratories 8, 9, 10, 11, 12. Requirement of an expensive thermal cycle machine, high cost and time needed are few drawbacks of these techniques. The time to detection of MRSA should be of the major concern because the delayed MRSA treatment directly leads to prolonged duration of hospitalization, increased morbidity, and mortality rates 13. Thus, it is necessary to develop a rapid and sensitive method for MRSA detection. Loop‐mediated isothermal amplification (LAMP), as alternative assay, is a technique for nucleic acid amplification with high specificity, sensitivity, and less time consumption 14. A target nucleotide sequence is amplified on the basis of strand displacement activity by Bst DNA polymerase large fragment. A set of four primers, two inner and two outer primers, recognized on six different target sequence regions, indicate high specificity 15. The reaction is conducted under isothermal condition by a water bath or a heating block. LAMP‐amplified products were traditionally detected by gel electrophoresis, followed by an ethidium bromide staining, which is a carcinogenic substance. To avoid these drawbacks and speed up the total time for LAMP amplicons detection, a chromatrographic, lateral flow dipstick (LFD) was applied to LAMP‐amplified products detection rather than gel electrophoresis. These strips detect biotin‐labeled LAMP amplicons that have been hybridized with FITC‐labeled DNA probe complex with gold‐labeled anti‐FITC antibody 16.
In this study, a detection platform for the rapid diagnosis of MRSA is investigated. We simulated our LAMP assay for use in routine clinical laboratories. In general, mecA detection is insufficient for therapeutic decision with antibiotics against MRSA, for example, glycopeptides, lipopeptides, and oxazolidinone 17. It should be combined with the test for identification of staphylococcal species because mecA was found in coagulase‐negative staphylococcal (CNS) 18. Therefore, it is necessary to confirm the S. aureus in parallel to the detection of mecA gene. The femB gene is one of the markers that can be used to identify S. aureus species 19 and was selected to use in our assay. First, clinical specimens were collected from sterile and nonsterile samples, including hemoculture bottles and sputum. These specimens were verified species and were resistance to methicillin by coagulase and antimicrobial susceptibility test, as a gold standard from the Laboratory of Clinical Microbiology, Ramathibodi Hospital, Bangkok, Thailand. After that, samples are transferred to our detection system as unknown samples. Second, all the samples were screened for S. aureus species by femB‐LAMP before mecA‐LAMP detection. If samples show a negative femB result, it will be taken out of the detection system. Next, LAMP assay was used to detect mecA gene and compared to the conventional PCR. Then, all of results will be checked against clinical results from a laboratory of clinical microbiology.
MATERIALS AND METHODS
Clinical Strains
Twelve clinically relevant and nonrelevant MRSA standard strains were used to evaluate and optimize the specificity and sensitivity of LAMP assays (Table 1). To evaluate LAMP assay, 155 direct clinical specimens was obtained from positive hemoculture bottles and sputum, including 82 MRSA, 36 methicillin‐susceptible S. Aureus (MSSA), 15 methicillin‐resistant coagulase negative staphylococcus (MRCNS), and 22 methicillin‐susceptible coagulase negative staphylococcus (MSCNS). LAMP results were validated with PCR assays. All the samples were obtained from the Laboratory of Clinical Microbiology, Ramathibodi Hospital.
Table 1.
Validating Bacterial List for Specificity of mecA‐ and femB‐LAMP
| LAMPa | ||
|---|---|---|
| Reference strains | mecA | femB |
| Methicillin‐resistant S. aureus RA.024121 | + | + |
| Methicillin‐susceptible S. aureus RA.024122 | − | + |
| Methicillin‐resistant coagulase negative staphylococci RA.024123 | + | − |
| Methicillin‐susceptible coagulase negative staphylococci | − | − |
| RA.024124 | − | − |
| RA.024125 | − | − |
| RA.024126 | − | − |
| Streptococcus pneumoniae RA.024127 | − | − |
| Streptococcus pyogenes RA.024128 | − | − |
| Streptococcus agalactiae RA.024129 | − | − |
| Enterococcus faecalis RA.024130 | − | − |
| Escherichia coli RA.024131 | − | − |
| Pseudomonas aeruginosa RA.024132 | − | − |
| Total | 2 | 2 |
+, positive; −, negative.
DNA Extraction
The entire standard culture was used in a simple boiling method for DNA extraction by picking one to two colonies from the blood agar plate and then dissolving it in 200 μl ultrapure water grade. The sample was incubated at 100°C for 15 min and centrifuged at 12,000 × g for 10 min, 400 μl ultrapure water grade was added to the sample and mixed well until the solution was homogenized. The supernatant was transferred to a new tube and the DNA concentration was measured by ND‐1000 spectrophotometer analysis (Nanodrop Technologies, USA) at 260 and 280 nm. As part of direct clinical specimens, all of clinical specimens were processed by PrepMan Extraction (Invitrogen, USA) according to manufacturer's protocol.
PCR Amplification
The mecA gene was amplified as previously described 20. A set of PCR primers was mecA1 5′‐TGCTATCCACCCTCAAACAGG‐3′ and mecA2 5′‐AACGTTGTAACCACCCCAAGA‐3′, producing a fragment of 285 base pair (bp). The PCR was performed in a final volume of 25 μl master mix, containing 0.2 μM each primer mecA1 and mecA2, 1.4 mM of dNTPs mix (Promega, USA), 6 mM MgCl2 (Invitrogen, USA), 5 unit Taq DNA polymerase (Invitrogen, USA) in 10× of supplied buffer. The amplification condition was conducted using an initial denaturation step at 94°C for 5 min, followed by 30 cycles of 94°C for 1 min, 54°C for 1 min, 72°C for 1 min, and a final extension step at 72°C for 7 min. The PCR products were detected by 2% agarose gels electrophoresis.
Primers and Condition of LAMP Reaction
LAMP primers for MRSA detection were designed according to the published nucleotide sequence of mecA and femB genes (the Genbank accession no. BA000017) by Primer Explorer version 3 (Eiken Chemical, Japan). The details of the primers are listed in Figure 1a and b and Table 2, respectively. The mecA‐ and femB‐LAMP were carried out in a final volume of 25 μl of reaction mixture containing: 2 μM each of inner primers FIP and BIP, 0.2 μM each of outer primers F3 and B3, 1.4 mM of dNTP mix (Promega, USA), 60 mM betaine (Sigma‐Aldrich, USA), 6 mM MgSO4 (Sigma‐Aldrich, USA), 8 U of Bst DNA polymerase large fragment (New England Biolabs, USA), 1× of the supplied buffer, and a template DNA extracted from MRSA and MSSA. The reaction temperature and time were optimized at 63°C for 60 min to make specific and rapid amplification of MRSA detection. LAMP products were analyzed by 2% agarose gels electrophoresis.
Figure 1.
Nucleotide sequences of MRSA genome (Genbank accession no. BA000017). The sequence used to design primers F3, B3, FIP (F1c/TTTT/F2), and BIP (B2c/TTTT/B2) for (a) mecA and (b) femB are shown by shaded boxes and arrows. The underlined sequence in bold typeface was used for FITC‐labeled probe design.
Table 2.
Oligonucleotide Primers for mecA‐ and femB‐LAMP Detection
| Primers and probe name | Position | Sequences (5′ to 3′) |
|---|---|---|
| mecA | ||
| F3 | 46384‐46406 | CCAATTTTGATCCATTTGTTGTT |
| B3 | 46595‐46614 | CATAGCGTCATTATTCCAGG |
| Biotin‐FIP | 46426‐46440/TTTT/46466‐46488 | Biotin‐ATAGGCATCGTTCCAAAGAATGT‐TTTT‐ACTTAGTTCTTTAGCGATTGC |
| BIP | 46525‐46549/TTTT/46576‐46594 | GTTTCGGTCTAAAATTTTACCACGT‐TTTT‐AATGCAGAAAGACCAAAGC |
| FITC‐probe | 46447–46465 | FITC‐TTTATAATCTTTTTTAGAT |
| femB | ||
| F3 | 1457224‐1457241 | ATCACATGGTTACGAGCA |
| B3 | 1457394‐1457406 | TCACGTTCAAGGAATCTGA |
| FIP | 1457242‐1457263/TTTT/1457288‐1457312 | TACCTTCAAGGTTTAATACGCCCAT‐TTTT‐TCATGGCTTTACAACTGAGT |
| BIP | 1457314–1457338/TTTT/1457370‐1457393 | ACACCCGAAACATTGAAAAAGACA‐TTTT‐CTTTAACACCATAGTTTATCGCTT |
LFD for LAMP‐Amplified Product Detection
Oligonucleotide probe was designed on the sequence spanned between FIP and BIP regions, and labeled with FITC at the 5′‐end (Table 2). Five microliters of 20 pmol labeled DNA probe was hybridized to the LAMP amplicon at 63°C for 5 min, then 8 μl of hybridization mixture was added to 100 μl assay buffer in a new tube. LFD strip was immersed in the mixture for 5 min to obtain a result (positive band).
RESULTS
Screening for S. aureus by LAMP Assay Using femB Primer Set
The identification of femB gene by LAMP assay was applied to confirm that the clinical specimen is S. aureus. LAMP assay for femB primer set was conducted using 100 ng total DNA of MRSA/MSSA, MRCNS/MSCNS, and nonrelevant bacterial species extracted from colony. The results showed that femB is positive in S. aureus only (Fig. 2). The direct clinical specimens were tested on femB. On the basis of femB detection, 118 of 155 from sputum and hemoculture bottles were positive for S. aureus, which concordant to clinical results. The results indicated that the LAMP assay can identify S. aureus from direct clinical specimens.
Figure 2.
Specification of the femB by LAMP method. The reactions were carried out using different species of bacterial pathogens and analyzed by 2% agarose gel electrophoresis. Lane M, molecular marker; lane N, negative control; lanes 1–2, 100 ng total DNA of MRSA and MSSA; lanes 3, MRCNS; lane 4–6, MSCNS; lane 7, Streptococcus pyogenes; lane 8, Streptococcus agalactiae; lane 9, Streptococcus pneumoniae; lane 10, Enterococcus faecalis; lane 11, Escherichia coli; lane 12, Pseudomonas aeruginosa.
Specificity of mecA‐LAMP Detection by Gel Electrophoresis and LFD
Specificity of mecA‐LAMP was calculated using 100 ng total DNA from MRSA, MSSA, MRCNS, MSCNS, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Enterococcus faecalis, Escherichia Coli, and Pseudomonas aeruginosa. The mecA‐LAMP was amplified only by DNA from MRSA followed by electrophoresis as shown in Figure 3a and LFD as shown in Figure 3b. No cross‐amplification was observed with other bacteria. This result indicated that combination of LAMP–LFD method was specific for MRSA detection.
Figure 3.
Cross‐amplification test results of a biotin labeled mecA‐LAMP detection method. The reactions were performed using 100 ng total DNA from various types of bacteria and were analyzed by (a) 2% agarose gel electrophoresis and (b) LFD. Lane M, molecular marker; lane N, negative control; lane 1, methicillin‐resistant Staphylococcus aureus; lane 2, Streptococcus pyogenes; lane 3, Streptococcus agalactiae; lane 4, Streptococcus pneumoniae; lane 5, Enterococcus faecalis; lane 6, Escherichia coli; lane 7, Pseudomonas aeruginosa; lane 8, methicillin‐susceptible Staphylococcus aureus.
Comparison of Detection Limit Between LAMP and PCR
LAMP using 10‐fold serial dilution (10 ng to 100 fg) was able to detect template at 10 pg total DNA or equivalent 102 CFU/ml as shown in Figure 4a and LFD, which gave identical sensitivity to gel electrophoresis shown in Figure 4b. The conventional PCR was able to detect template at 100 pg total DNA or equivalent 103 CFU/ml (data were not shown). Therefore, the mecA‐LAMP was 10 times more sensitive than the PCR method.
Figure 4.
Sensitivity of mecA‐LAMP detection combined with (a) gel electrophoresis and (b) LFD. Lane M, molecular marker; lane 1–6, 10−1 to 10−6 dilution of total DNA extracted from MRSA (equivalent to 10 ng to 100 fg); lane P, 100 ng plasmid DNA containing mecA gene, lane N1, total DNA of MSSA, and lane N2, negative control.
Evaluation of LAMP‐LFD Assay for Direct Clinical Specimens Detection
The applicability of LAMP‐LFD assay for S. aureus from clinical specimens was assessed by comparing with those of PCR. A total of 118 staphylococcus from clinical specimens were identified as S. aureus, containing 46 sputum, and 72 blood hemoculture samples were tested by LAMP and PCR. In detecting mecA from 46 sputum, the sensitivity of LAMP assay was 93.3% (28/30), whereas the PCR assay was 86.7% (26/30). The negative predictive value (NPV) of LAMP and PCR was 88.9% and 80.0%, respectively. The detection of mecA was carried out on 72 blood hemoculture samples. The sensitivity of LAMP assay for mecA was 100% (52/52), whereas the PCR assay was 98.1% (51/52). The NPV of LAMP and PCR were 100% and 95.2%, respectively (Table 3). Based on these data, the false‐positive amplification was not observed. When LFD was applied to detect the LAMP amplicons from clinical specimens, it shows a positive band that is confirmed by gel electrophoresis.
Table 3.
Sensitivity and Specificity of the LAMP/PCR Assay for the Detection of Methicillin‐Resistant Staphylococcus aureus From Sputum and Hemoculture Bottles
| Types of assay | |||||||
|---|---|---|---|---|---|---|---|
| Source of specimens | Conventionala | LAMP | PCR | Sensitivity | Specificity | PPVb | NPVb |
| Sputum (n = 46) | 30 | 28 | 26 | 93.3/86.7 | 100/100 | 100/100 | 88.9/80.0 |
| Hemoculture (n = 72) | 52 | 52 | 51 | 100/98.1 | 100/100 | 100/100 | 100/95.2 |
Conventional culture, catalase/coagulase test, and drug susceptibility test.
PPV, positive predictive values; NPV, negative predictive values.
DISCUSSION
MRSA is a serious problem in nosocomial and community‐acquired infections. In Thailand, the infections from MRSA are still a growing problem in public healthcare, especially for rural regions. The infection control strategy is not good due to resource‐limited laboratories, leading to increased patient risk. The identification of infected patients is the first step in the containment of MRSA spreading. In evaluating detection methodologies for epidemiologic situation, the factors to consider for the choice of a MRSA screening should be taken into account, including sensitivity, specificity, time, assay cost, and ease of interpretation.
Susceptibility testing is usually performed to check an expression of resistance by measuring growth inhibition. The susceptibility test is time‐consuming and has some flaws when used with heterogeneous strains because of a low level of expression protein to resistance drug 21, 22, 23, which has given an ambiguous result. Then, PCR‐based assay was used to confirm MRSA infection, which led to increase in assay time and costs.
Here, we can directly detect MRSA from direct clinical specimens using two set of primers, mecA and femB. The mecA in S. aureus is the main focus in this study. Thus, the samples to be tested in this system were identified S. aureus by femB. The identification of S. aureus from clinical specimens by LAMP is all concordant with the results from Clinical Microbiology Laboratory, Ramathibodi Hospital, and false‐positive amplification was not observed. The detection of mecA from direct clinical specimen, including sputum and blood hemoculture bottles, using LAMP yielded result comparable with PCR techniques. The results showed that LAMP can detect mecA in good agreement with clinical results from clinical microbiology laboratory, especially from hemoculture bottles with 100% sensitivity and specificity. Nevertheless, we also found a false‐negative result in sample that was obtained from sputum, which can be attributed to the presence of MRSA in nonsterile sample such as low or contaminate sputum of inhibitory substances. The high NPV in this study especially in blood hemoculture sample suggests that LAMP assay provides a rapid method to identify person who are not infected with MRSA. It seems to be useful for epidemiologic or surveillance activities. LAMP assays had showed a higher sensitivity and lower detection limits with 10 pg or equivalent to 100 CFU/ml for mecA, compared to PCR. The results were identical with previously reported LAMP assay for MRSA detection 24, 25, in which 100 copies were required for detection of mecA. However, LAMP assay has some flaws for the direct detection of MRSA from clinical specimens because these assays are again unable to differentiate between MSSA and MRCNS in a mixed condition. This combine use of mecA and femB‐LAMP assays can support a healthcare worker and help preventing a further outbreak or led to designing of treatment plans. In LAMP amplicons analysis, positive LAMP products showed turbidity that came from a magnesium pyrophosphate 26, which could be observed by a naked eye, but the nonspecific amplification gave the same results with positive amplification. To solve this problem and speed up total time for mecA‐LAMP assay, an LFD was used instead of gel electrophoresis as shown in the timeline for sample processing (Fig. 5). Although LFD is used to confirm specificity of LAMP amplicons in resource‐limited laboratories, we suggested that turbidity is sufficient for interpretation results since nonspecific amplifications hardly occur. In addition, we also calculated cost of LAMP assay compared to the conventional method in our hospital. The cost for a negative culture for MRSA was US$6.2 (exchange rate: 33 Thai baht per US$) and US$8.1 for positive culture with a simple test (a Catalase and Coagulase test). If additional test is performed using PCR method, it increases the cost by at least US$24.6, while LAMP reactions (for reagents and supplies only) are approximately US$4.2/test (not included LFD). Therefore, LAMP assay is an alternative technique for current rapid detection of MRSA.
Figure 5.
Timeline of LAMP‐LFD processing for methicillin‐resistant Staphylococcus aureus detection. (a) Clinical specimens were extracted by commercial reagent kit as mentioned in DNA extraction part. (b) Prepare master mix for LAMP reactions and the templates were added in this step. (c) LAMP reaction was performed at 63°C for 60 min. (d) LAMP product will be analyzed by LFD.
In conclusion, LAMP–LFD was highly sensitive and specific for the identification of S. aureus and antibiotic‐resistant gene (mecA) directly from hemoculture bottles and sputum samples. The use of LAMP–LFD enabled detection of MRSA within a short time (1 hr) compared to the conventional method with a simple test (catalase and coagulase test) for confirmatory MRSA. In the current study, LAMP assay obtained great advantages in simplicity and cost‐effectiveness. This technology may serve as a powerful tool for rapid diagnosis of MRSA in clinical diagnostic laboratories, especially for resource‐limited laboratories or medical field worker in a rural area.
CONFLICT OF INTEREST
The authors declare that they have no conflict of interest.
ACKNOWLEDGMENTS
The authors thank Thanwa Wongsuk and Narong Chaihongsa for preparing the samples and for technical support. This research was funded by Center of Excellence (COE) of National Nanotechnology Center (NANOTEC).
Grant sponsor: Center of Excellence (COE).
Correction added on 29th March, after first online publication: Please correct the spelling in author name Pitak Santanirund to Pitak Santanirand.
REFERENCES
- 1. Pittet D, Tarara D, Wenzel RP. Nosocomial bloodstream infection in critically III patients excess length of stay, extra costs, and attributable mortality. J Am Med Assoc 1994;271(20):1598–1601. [DOI] [PubMed] [Google Scholar]
- 2. Whitby M, McLaws M‐L, Berry G. Risk of death from methicillin‐resistant Staphylococcus aureus bacteraemia: A meta‐analysis. Med J Aust 2001;175:264–267. [DOI] [PubMed] [Google Scholar]
- 3. Chamber HF. The changing epidemiology of Staphylococcus aureus ? Emerg Infect Dis 2001;7(2):178–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Zetola N, Francis JS, Nuermberger EL, et al. Community‐acquired meticillin‐resistant Staphylococcus aureus: An emerging threat. Lancet Infect Dis 2005;5(5):275–286. [DOI] [PubMed] [Google Scholar]
- 5. Katayama Y, Ito T, Hiramatsu K. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus . Antimicrob Agents Chemother 2000;44(6):1549–1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Stefani S, Chung DR, Lindsay JA, et al. Meticillin‐resistant Staphylococcus aureus (MRSA): Global epidemiology and harmonisation of typing methods. Int J of Antimicrob Agents 2012;39(4):273–282. [DOI] [PubMed] [Google Scholar]
- 7. Cosgrove SE, Fowler J. Management of methicillin‐resistant Staphylococcus aureus bacteremia. Clin Infect Dis 2008;46:386–393. [DOI] [PubMed] [Google Scholar]
- 8. Mason WJ, Blevins JS, Beenken K, et al. Multiplex PCR protocol for the diagnosis of staphylococcal infection. J Clin Microbiol 2001;39(9):3332–3338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Tan TY, Corden S, Barnes R, et al. Rapid identification of methicillin‐resistant Staphylococcus aureus from positive blood cultures by real‐time fluorescence PCR. J Clin Microbiol 2001;39(12):4529–4531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Louie L, Goodfellow J, Mathieu P, et al. Rapid detection of methicillin‐resistant staphylococci from blood culture bottles by using a multiplex PCR assay. J Clin Microbiol 2002;40(8):2786–2790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Hallin M, Maes N, Byl B, et al. Clinical impact of a PCR assay for identification of Staphylococcus aureus and determination of methicillin resistance directly from blood cultures. J Clin Microbiol 2003;41(8):3942–3944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Palomares C, Torres MJ, Torres A, et al. Rapid detection and identification of Staphylococcus aureus from blood culture specimens using real‐time fluorescence PCR. Diagn Microbiol Infect Dis 2003;45(3):183–189. [DOI] [PubMed] [Google Scholar]
- 13. Beekmann SE, Diekema DJ, Chapin KC, et al. Effects of rapid detection of bloodstream infections on length of hospitalization and hospital charges. J Clin Microbiol 2003; 41(7):3119–3125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Notomi T, Okayama H, Masubuchi H, et al. Loop‐mediated isothermal amplification of DNA. Nucl Acids Res 2000; 28(12):e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Tomita N, Mori Y, Kanda H, et al. Loop‐mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc 2008;3(5):877–882. [DOI] [PubMed] [Google Scholar]
- 16. Nimitphak T, Kiatpathomchai W, Flegel TW. Shrimp hepatopancreatic parvovirus detection by combining loop‐mediated isothermal amplification with a lateral flow dipstick. J Virol Methods 2008;154(1–2):56–60. [DOI] [PubMed] [Google Scholar]
- 17. Liu C, Bayer A, Cosgrove SE, et al. Clinical practice guidelines by the infectious diseases society of America for the treatment of methicillin‐resistant Staphylococcus aureus infections in adults and children. Clin Infect Dis 2011;52(3):e18–e55. [DOI] [PubMed] [Google Scholar]
- 18. Widerstrom M, Wistrom J, Sjostedt A, et al. Coagulase‐negative staphylococci: Update on the molecular epidemiology and clinical presentation, with a focus on Staphylococcus epidermidis and Staphylococcus saprophyticus . Eur J Clin Microbiol 2012;31(1):7–20. [DOI] [PubMed] [Google Scholar]
- 19. Kobayashi N, Wu H, Kojima K, et al. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epidemiol Infect 1994;113:259–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Hiramatsu K, Kihara H, Yokota T. Analysis of borderline‐resistant strains of methicillin‐resistant Staphylococcus aureus using polymerase chain reaction. Microbiol Immunol 1992;36:445–453. [DOI] [PubMed] [Google Scholar]
- 21. Finan JE, Rosato AE, Dickinson TM, et al. Conversion of oxacillin resistant staphylococci from heterotypic to homotypic resistance expression. Antimicrob Agents Chemother 2002;46:24–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Brown DFJ, Edwards DI, Hawkey PM, et al. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin‐resistant Staphylococcus aureus (MRSA). J Antimicrob Chemother 2005;56:1000–1018. [DOI] [PubMed] [Google Scholar]
- 23. Baddour MM, AbuEIKheir MM, Fatani AJ. Comparison of mecA polymerase chain reaction with phenotypic methods for the detection of methicillin‐resistant Staphylococcus aureus . Curr Microbiol 2007;55:473–479. [DOI] [PubMed] [Google Scholar]
- 24. Misawa Y, Yoshida A, Saito R, et al. Application of loop‐mediated isothermal amplification technique to rapid and direct detection of methicillin‐resistant Staphylococcus aureus (MRSA) in blood cultures. J Infect Chemother 2007;13(3):134–140. [DOI] [PubMed] [Google Scholar]
- 25. Koide Y, Maeda H, Yamabe K, et al. Rapid detection of mecA and spa by the loop‐mediated isothermal amplification (LAMP) method. Lett Appl Microbiol 2010;50(4):386–392. [DOI] [PubMed] [Google Scholar]
- 26. Mori Y, Notomi T. Loop‐mediated isothermal amplification (LAMP): A rapid, accurate, and cost‐effective diagnostic method for infectious diseases. J Infect Chemother 2009;15(2):62–69. [DOI] [PMC free article] [PubMed] [Google Scholar]