Skip to main content
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2012 Sep 21;26(5):321–324. doi: 10.1002/jcla.21525

Association of Genetic Variations in X‐Ray Repair Cross‐Complementing Group 1 and Tourette Syndrome

Wei‐Yong Lin 1,2,, Cheng‐Chun Lee 2,3,, Hsin‐Ping Liu 4, I‐Ching Chou 1,5, Jim Jinn‐Chyuan Sheu 2,6, Lei Wan 2,6, Ying‐Ju Lin 2,6, Yuhsin Tsai 6, Fuu‐Jen Tsai 2,5,6,7,
PMCID: PMC6807472  PMID: 23001975

Abstract

Background

X‐ray repair cross‐complementing group 1 (XRCC1) plays a central role in mammalian DNA repair process. The polymorphism rs25487 (Arg>Gln at codon 399) of this gene is common in Han Chinese population.

Objectives

The objective of this study was to analyze the association between this functional SNP of XRCC1 and Tourette syndrome (TS) in Han Taiwan Chinese population.

Methods

Genotyping was performed by using PCR–RFLP method on 73 TS patients and 158 normal controls.

Results

Our data indicated that genotype frequency of A/G polymorphism at codon 399 of the patients differed from the controls (P = 0.026, OR: 2.22, 95% CI: 1.22–4.03). The allele frequency analysis also showed significant differences with higher A allele frequency in patients (P = 0.015, OR: 1.70, 95% CI: 1.11–2.62).

Conclusion

Our study indicates that the functional SNP at codon 399 of XRCC1 is associated with TS development. J. Clin. Lab. Anal. 26:321‐324, 2012. © 2012 Wiley Periodicals, Inc.

Keywords: X‐ray repair cross‐complementing group 1, XRCC1, Tourette syndrome (TS), polymorphism

INTRODUCTION

Tourette syndrome (TS) is an inherited neuropsychiatric disorder, which is defined as a part of a spectrum of tic disorders that includes transient and chronic tics. The most common, first‐presenting tics are eye blinking, facial movements, sniffing, and throat clearing. Previous studies on the tics of TS indicated sensory phenomena as the core symptom of the syndrome, even though they are not included in the diagnostic criteria 1, 2, 3. As compared to other movement disorders, e.g., choreas, dystonias, myoclonus, and dyskinesias, the tics of TS are stereotypic, temporarily suppressible, nonrhythmic, and often preceded by an unwanted premonitory urge 4. These abnormal behaviors are believed to result from dysfunction in cortical and subcortical regions in the brain, including the thalamus, basal ganglia, and frontal cortex 5, 6.

Genetic and environmental factors have been proposed to play roles in the etiology of TS, although the exact causes are largely unknown 7. Patients with TS syndrome could be found in all ethnic groups, genders, as well as in children and adults. Environmental factors, including smoking, stress, and infections, also have been implicated in the increased incidence of TS development. Family tree analyses have shown that the overwhelming majority of cases of TS are inherited and more efforts are needed to identify the key genes involved in the pathogenesis of this syndrome 8. Due to lack of understanding of the molecular mechanisms, no specific screening test can be used in the diagnosing TS and the medication is usually not effective 9. Functional magnetic resonance imaging (fMRI) studies suggested that TS may be caused by impaired modulation of a neural circuit involved in behavioral inhibition 10, 11, 12. Since bioactivity of neuron cells determines the formation and function, genes involved in regulation of neuron death may play certain roles in pathogenesis of TS.

In particular, neurons have been shown to be more vulnerable than other cell types to DNA‐damaging conditions such as oxidative stress. Increasing evidence suggests that the accumulation of damaged DNA may contribute to neuronal loss in neurodegenerative disorders 13, 14, 15. There are three major mechanisms involved in the repair of DNA damages, the base excision repair (BER), nucleotide excision repair (NER), and double‐strand break (DSB) repair by the homologous recombination or nonhomologous end joining pathways. Recent studies further indicate that chromosomal fragility and translocations have been found in some TS patients 16, 17, 18, suggesting the crucial roles of genome instability during TS development. X‐ray repair cross‐complementing group 1 (XRCC1) is an important component to regulate BER pathways, because it operates as a scaffold protein to interact with other key proteins, such as DNA ligase III and DNA polymerase β, to synthesize and rejoin the DNA strand break site 19. It is possible that repair capability of XRCC1 in BER may influence the accumulation of damaged DNA, which results in neuronal death and deficiency of brain function. Therefore, since XRCC1 is a critical single‐strand break repair protein that orchestrates efficient damage repair at DNA break points, the main goal of this study is to know whether genetic variations in XRCC1 gene determine the susceptibility to TS.

MATERIALS AND METHODS

Patients

The study subjects with a total of 73 TS patients were recruited from China Medical University Hospital in Taiwan. The 158 healthy controls were selected from the general population with similar age profile who had regular health examination at the same hospital. This study was approved by the Institutional Review Board (IRB) at China Medical University Hospital prior to patient enrollment. All the individuals including patients and healthy controls signed a consent form, and blood samples were collected by venipuncture for genomic DNA isolation and preparation.

Genomic DNA Extraction and XRCC1 Genotyping

Peripheral venous blood samples from patients and healthy controls were collected in ethylenediaminetetraacetic acid (EDTA) tubes. After blood cell separation by centrifugation, genomic DNA was then purified from the buffy coat using Qiagen genomic DNA isolation kit (Valencia, CA). DNA fragments containing the rs25487 polymorphism was amplified by Polymerase chain reaction (PCR) and detected by Restriction fragment length polymorphism (RFLP) by digesting DNA with MspI restriction enzyme digestion. The conditions for PCR were initial denaturation at 95°C for 5 min; 40 cycles for DNA amplification by denaturation at 95°C for 10 sec, followed by annealing at 58°C for 10 sec, and extension at 72°C for 20 sec; and then one cycle of final extension at 72°C for 5 min. The sequences of the primers for RFLP analyses were forward 5′‐CCCCAAGTACAGCCAGGTC‐3′ and reverse 5′‐TGTCCCGCTCCTCTCAGTAG‐3′.

Statistical Analysis and Clinical Association

Statistical analysis was performed by the Chi‐square method using SPSS software (version 10.0) to study the genotype and allelic frequency distributions for this functional polymorphism in both TS patients and controls. A P value less than 0.05 was considered statistically significant. Significance was calculated with the use of 2 × 2 and 2 × 3 contingency tables to contingency table to obtain P values, odds ratios (OR), and 95% confidence intervals (95% CI).

RESULTS

Genotype analyses indicated a significant difference between TS patients and the controls in the frequency of A/G at codon 399 of XRCC1 (P = 0.026, OR: 2.22, 95% CI: 1.22–4.03) (Tables 1 and 2). In addition, allele frequency analyses revealed a significant difference at codon 399 between the patients and controls (P = 0.015, OR: 1.70, 95% CI: 1.11–2.62) (Tables 1 and 2). TS patients tended to have a higher frequency to carry an A allele at this locus. Interestingly, our data indicate that A/G genotype at codon 399 is very unique in TS patients as compared to other genotypes. Individuals with A/A genotype did not show statistically higher risk of TS development than people with A/G or G/G genotypes (Table 1).

Table 1.

Distribution of Genotypes among the Tourette Syndrome Patients and Healthy Control Subjects

Tourette syndrome patients n (%) Normal controls n (%) P a
Genotype 0.026
A/A 8 (10.96) 13 (8.22)
A/G 34 (46.58) 48 (30.38)
G/G 31 (42.47) 97 (61.39)
Allelic frequency 0.015
Allele A 50 (34.25) 74 (23.42)
Allele G 96 (65.75) 242 (76.58)
a

P values were calculated by χ 2 test.

Table 2.

Odds Ratio and 95% Confidence Interval of XRCC1 Gene 399A/G Polymorphism

Genotype Odds ratio (95% CI)
A/A 1.93 (0.72–5.15)
A/G 2.22 (1.22–4.03)
G/G 1 (reference)
Per copy of Allele A 1.70 (1.11–2.62)
Per copy of Allele G 1 (reference)

CI = confidence interval.

DISCUSSION

This study is the first assay of the XRCC1 gene Single‐nucleotide polymorphism (SNP) (rs25487) in TS patients. It is demonstrated that XRCC1 SNP is associated with TS in the Chinese population in Taiwan. The XRCC1 gene SNP substitution caused Arg to Gln change at codon 399 is one of the most extensively studied SNPs of XRCC1 gene and reported to highly correlate with the progression of some diseases, including cancer 20 and end‐stage renal disease (ESRD) 21. Thus, we chose codon 399 to perform an associative study to explore the etiology of TS.

On the basis of mRNA level study, XRCC1 gene polymorphism at codon 399 did not change the XRCC1 gene expression 22. However, individuals with A allele rather than G allele seem to have higher risk to development of carcinoma 23, suggesting that G to A substitution of XRCC1 gene, which causes Arg to Gln amino acid change at codon 399, may alter DNA repair activity of XRCC1 and thus modulate cancer susceptibility 24. Other studies in DNA repair activity of XRCC1 showed that individuals with homozygous carriers of A allele for XRCC1 polymorphism at codon 399 had higher tendency to accumulate DNA adducts after the treatment of DNA damage‐inducing agents 25. Lunn et al. also demonstrated that XRCC1 polymorphism at codon 399 was associated with higher levels of DNA damage and A allele homozygotes showed significant association with higher levels of aflatoxin B1–DNA adducts and glycophorin‐A somatic variants, suggesting that codon change might alter the XRCC1 function and result in deficiency of DNA repair 26. Our data showed that A allele is a risk allele that is highly correlated with having TS and individuals with A/G genotype at codon 399 presented higher risk of TS development than people with A/A or G/G genotypes. One possible explanation for these findings would be that the SNP analyzed in this study is in tight linkage disequilibrium with other unknown allele variants that impart an opposite effect. Therefore, only in the heterozygote A/G individual, the compound phenotype can be observed. Although this interpretation favors our finding, more detailed studies are needed to further investigate the molecular mechanisms controlled by XRCC1 genetic variants.

In recent years, TS has been defined as one kind of autoimmune diseases induced by a series of immunopathogenic mechanisms 27, 28. Autoantibodies (Abs) against brain self‐epitopes could be detected in the sera of TS patients 27, 29, 30. Notably, it has been known that DNA breaks mixed with nuclear proteins are strong immunogens for eliciting autoreactive Abs 31, 32, suggesting that DNA repair efficiency in cells is a determining factor for the development of autoimmune diseases. Several components involved in DNA repair systems, such as XRCC5 and XRCC4 in recombinational repair, have been found to trigger auto‐Abs. This study is the first attempt to understand whether a DNA repair protein such as XRCC1 could play important roles during TS development. Our data indicated the involvement of genetic variations of XRCC1 in the susceptibility to TS. It is therefore interesting to further study the associations of other DNA repair proteins and TS development.

Grant sponsor: National Science Council in Taiwan; Grant numbers: NSC 97–2320‐B‐039–021‐MY3; NSC 99–2320‐B‐039–024; Grant sponsor: China Medical University & Hospital; Grant numbers: CMU97‐CMC‐018; CMU97‐CMC‐003; CMU97–301; CMU97–265; CMU97–157; DMR‐98–063; DMR‐95–015; DMR‐93–001; Grant sponsor: Taiwan Department of Health Clinical Trial and Research Center of Excellence; Grant number: DOH101‐TD‐B‐111–004.

REFERENCES

  • 1. Bliss J. Sensory experiences of Gilles de la Tourette syndrome. Arch Gen Psychiatry 1980;37:1343–1347. [DOI] [PubMed] [Google Scholar]
  • 2. Scahill LD, Leckman JF, Marek KL. Sensory phenomena in Tourette's syndrome. Adv Neurol 1995;65:273–280. [PubMed] [Google Scholar]
  • 3. Miguel EC, do Rosario‐Campos MC, Prado HS, et al. Sensory phenomena in obsessive‐compulsive disorder and Tourette's disorder. J Clin Psychiatry 2000;61:150–156. [DOI] [PubMed] [Google Scholar]
  • 4. Jankovic J. Differential diagnosis and etiology of tics. Adv Neurol 2001;85:15–29. [PubMed] [Google Scholar]
  • 5. Singer HS, Walkup JT. Tourette syndrome and other tic disorders. Diagnosis, pathophysiology, and treatment. Medicine (Baltimore) 1991;70:15–32. [DOI] [PubMed] [Google Scholar]
  • 6. Peterson B, Riddle MA, Cohen DJ, et al. Reduced basal ganglia volumes in Tourette's syndrome using three‐dimensional reconstruction techniques from magnetic resonance images. Neurology 1993;43:941–949. [DOI] [PubMed] [Google Scholar]
  • 7. McNaught KS, Mink JW. Advances in understanding and treatment of Tourette syndrome. Nat Rev Neurol 2011;7:667–676. [DOI] [PubMed] [Google Scholar]
  • 8. Walkup JT, LaBuda MC, Singer HS, Brown J, Riddle MA, Hurko O. Family study and segregation analysis of Tourette syndrome: Evidence for a mixed model of inheritance. Am J Hum Genet 1996;59:684–693. [PMC free article] [PubMed] [Google Scholar]
  • 9. Swain JE, Scahill L, Lombroso PJ, King RA, Leckman JF. Tourette syndrome and tic disorders: A decade of progress. J Am Acad Child Adolesc Psychiatry 2007;46:947–968. [DOI] [PubMed] [Google Scholar]
  • 10. Marsh R, Zhu H, Wang Z, Skudlarski P, Peterson BS. A developmental fMRI study of self‐regulatory control in Tourette's syndrome. Am J Psychiatry 2007;164:955–966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Peterson BS, Skudlarski P, Anderson AW, et al. A functional magnetic resonance imaging study of tic suppression in Tourette syndrome. Arch Gen Psychiatry 1998;55:326–333. [DOI] [PubMed] [Google Scholar]
  • 12. Jankovic J. Tourette's syndrome. N Engl J Med 2001;345:1184–1192. [DOI] [PubMed] [Google Scholar]
  • 13. Brasnjevic I, Hof PR, Steinbusch HW, Schmitz C. Accumulation of nuclear DNA damage or neuron loss: Molecular basis for a new approach to understanding selective neuronal vulnerability in neurodegenerative diseases. DNA Repair (Amst) 2008;7:1087–1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Fishel ML, Vasko MR, Kelley MR. DNA repair in neurons: So if they don't divide what's to repair? Mutat Res 2007;614:24–36. [DOI] [PubMed] [Google Scholar]
  • 15. Barzilai A. The contribution of the DNA damage response to neuronal viability. Antioxid Redox Signal 2007;9:211–218. [DOI] [PubMed] [Google Scholar]
  • 16. Matsumoto N, David DE, Johnson EW, et al. Breakpoint sequences of a 1;8 translocation in a family with Gilles de la Tourette syndrome. Eur J Hum Genet 2000;8:875–883. [DOI] [PubMed] [Google Scholar]
  • 17. Petek E, Windpassinger C, Vincent JB, et al. Disruption of a novel gene (IMMP2L) by a breakpoint in 7q31 associated with Tourette syndrome. Am J Hum Genet 2001;68:848–858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. State MW, Greally JM, Cuker A, et al. Epigenetic abnormalities associated with a chromosome 18(q21‐q22) inversion and a Gilles de la Tourette syndrome phenotype. Proc Natl Acad Sci USA 2003;100:4684–4689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Altieri F, Grillo C, Maceroni M, Chichiarelli S. DNA damage and repair: From molecular mechanisms to health implications. Antioxid Redox Signal 2008;10:891–937. [DOI] [PubMed] [Google Scholar]
  • 20. Cui Z, Yin Z, Li X, Wu W, Guan P, Zhou B. Association between polymorphisms in XRCC1 gene and clinical outcomes of patients with lung cancer: A meta‐analysis. BMC Cancer 2012;12:71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Trabulus S, Guven GS, Altiparmak MR, et al. DNA repair XRCC1 Arg399Gln polymorphism is associated with the risk of development of end‐stage renal disease. Mol Biol Rep 2012;39:6995–7001. [DOI] [PubMed] [Google Scholar]
  • 22. Wang P, Tang JT, Peng YS, Chen XY, Zhang YJ, Fang JY. XRCC1 downregulated through promoter hypermethylation is involved in human gastric carcinogenesis. J Dig Dis 2010;11:343–351. [DOI] [PubMed] [Google Scholar]
  • 23. Roszak A, Lianeri M,Jagodzinski PP. Involvement of the XRCC1 Arg399Gln gene polymorphism in the development of cervical carcinoma. Int J Biol Markers 2011;26:216–220. [DOI] [PubMed] [Google Scholar]
  • 24. Abdel‐Rahman SZ, El‐Zein RA. The 399Gln polymorphism in the DNA repair gene XRCC1 modulates the genotoxic response induced in human lymphocytes by the tobacco‐specific nitrosamine NNK . Cancer Lett 2000;159:63–71. [DOI] [PubMed] [Google Scholar]
  • 25. Duell EJ, Wiencke JK, Cheng TJ, et al. Polymorphisms in the DNA repair genes XRCC1 and ERCC2 and biomarkers of DNA damage in human blood mononuclear cells. Carcinogenesis 2000;21:965–971. [DOI] [PubMed] [Google Scholar]
  • 26. Lunn RM, Langlois RG, Hsieh LL, Thompson CL, Bell DA. XRCC1 polymorphisms: Effects on aflatoxin B1‐DNA adducts and glycophorin A variant frequency. Cancer Res 1999;59:2557–2561. [PubMed] [Google Scholar]
  • 27. Martino D, Dale RC, Gilbert DL, Giovannoni G, Leckman JF. Immunopathogenic mechanisms in tourette syndrome: A critical review. Mov Disord 2009;24:1267–1279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Hoekstra PJ, Kallenberg CG, Korf J, Minderaa RB. Is Tourette's syndrome an autoimmune disease? Mol Psychiatry 2002;7:437–445. [DOI] [PubMed] [Google Scholar]
  • 29. Yeh CB, Wu CH, Tsung HC, Chen CW, Shyu JF, Leckman JF. Antineural antibody in patients with Tourette's syndrome and their family members. J Biomed Sci 2006;13:101–112. [DOI] [PubMed] [Google Scholar]
  • 30. Morer A, Lazaro L, Sabater L, Massana J, Castro J, Graus F. Antineuronal antibodies in a group of children with obsessive‐compulsive disorder and Tourette syndrome. J Psychiatr Res 2008;42:64–68. [DOI] [PubMed] [Google Scholar]
  • 31. Lee KJ, Dong X, Wang J, Takeda Y, Dynan WS. Identification of human autoantibodies to the DNA ligase IV/XRCC4 complex and mapping of an autoimmune epitope to a potential regulatory region. J Immunol 2002;169:3413–3421. [DOI] [PubMed] [Google Scholar]
  • 32. Takeda Y, Dynan WS. Autoantibodies against DNA double‐strand break repair proteins. Front Biosci 2001;6:D1412–D1422. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES