Molecular Detection of Trisomy 21 by Bicolor Competitive Fluorescent PCR

Abstract

Objective

To develop a reliable and specific method for rapid prenatal diagnosis of Trisomy 21 (Down syndrome).

Methods

We established a dual color competitive fluorescent Polymerase Chain Reaction (PCR) to measure the gene dosage of Down syndrome critical region (DSCR), a single copy sequence in chromosome 21. Another unique single copy sequence located on chromosome 2 (USC2) but not glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was chose as reference gene.

Results

The DSCR3/USC2 ratio of peripheral blood in trisomy 21 syndrome patients to normal subjects was 1.41∼1.74 to 0.93∼1.15, respectively (p < 0.01). Dual color competitive fluorescent PCR technique effectively differentiates the normal subjects from the Down syndrome patients. Next, according to the dual color competitive fluorescence quantitative PCR, among the 46 pregnant women, 3 cases were Down syndrome and 43 cases were normal, and these were confirmed by cytogenetic karyotype analysis.

Conclusion

This indicated that the new technique may be a reliable and specific method for the rapid prenatal diagnosis of Trisomy 21.

INTRODUCTION

Trisomy 21, also known as Down Syndrome, is the most frequent trisomy, one case of it could be found in 60–800 newborns 1. Kids with Down syndrome tend to share certain physical features, such as a flat facial profile, an upward slant of the eyes, small ears, a single crease across the center of the palms, and an enlarged tongue 2. Down syndrome is the major purpose for prenatal diagnosis, it is usually performed by means of karyotype analysis of amniotic cells obtained in the 11th to 18th week of gestation 3. High cost and the lengthy culture procedure of karyotyping test results in a significant delay (the fetus cells are obtained in 13th to 20th week of gestation) before the diagnosis can be made. In addition, karyotyping is not always feasible, especially when the number of amniotic cells obtained is limited or the culture of amniotic cells fails. Maternal contamination rate, which is 10–14%, has been reported even in the most experienced laboratories 4, 5. Therefore, an alternative method providing rapid diagnosis of small number of amniotic cells would be extremely valuable. One technique, which is both rapid and inexpensive, is the quantitative fluorescent PCR amplification of short tandem repeats (STRs). This method uses STRs specifically for chromosome 21 and has been used to diagnose trisomy 21 previously 6, 7. The quantitative fluorescent PCR is a powerful and available method that could improve the calculation of the target gene dosage accurately and rapidly. It could be used to tell the dosage ratio of target genes located on chromosome 21 to the other genes on different chromosomes, which are gained from the genomic DNA samples abstracted from different cases. Down syndrome critical region (DSCR) is a single copy sequence in chromosome 21 8, and this nervous system development–associated gene is also overexpressed in the brain of Down syndrome fetuses. As a result, the critical gene DSCR in a critical region—an extra copy of the major portion of human chromosome 21—has been widely used as a marker for the detection of trisomy 21. According to the whole genome sequence alignment, a unique sequence in DSCR and another unique single copy sequence (USC2) located in chromosome 2 were selected. At the same time, a pair of PCR primers suitable for both DSCR as well as USC2 was designed as they share some similarities in the sequence. Thus, a more accurate method based on nucleic acid sequence analysis, named dual color competitive fluorescence quantitative PCR, for detecting the gene dosage ratio between DSCR and a unique single copy sequence in chromosome 2 but not glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was established, and the following experiments demonstrated that the novel detection method for trisomy 21 was simple, fast, and reliable.

MATERIALS AND METHODS

Primers and Probes of the Dual Color Competitive Fluorescent PCR

Primers for amplification of both DSCR and USC2 were designed according to the blast result between DSCR sequence in exon 7 of ubquitin‐conjugating enzyme E2G 2 (BE2G2, NM_003343.5) located on chromosome 21q22.3, and the USC2 sequence located within human genomic contig NW_001838769.1 of chromosome 2. Then, the probes were also designed according to DSCR and USC2 sequences, respectively (Table 1). The sequences of PCR products are shown in Table 2.

Table 1.

Sequences and Product Size of the DSCR/USC2 Primers and Probes

Name		Primers and probes (5′–3′)	Reporter dye (5′–3′)	Product size
DSCR	Sense	AAAGTTTCTTCTGGATCTACAG	None	171bp
	Antisense	TCCTCTGTGCTCTGAGCTAAG	None
	Probe	ACATTTTGGATGCACTGGGA	FAM‐TAMRA
USC2	Sense	AAAGTTTCTTCTGGATCTACAG	None	169bp
	Antisense	TCCTCTGTGCTCTGAGCTAAG	None
	Probe	CAAAACTCACAGAGGGACTC	HEX‐TAMRA

FAM, 6‐carboxyfluorescein; TAMRA, 6‐carbox‐tetramethyl‐rhodamine; HEX, hexachlorofluorescein.

Table 2.

DNA Sequence of PCR Product for DSCR/USC2

Name	The sequence of PCR product (5′–3′)
DSCR	AAAGTTTCTTCTGGATCTACAGAAAAAATTTTTTTTTTTCAATCTAAAAAC
	Sense primer
	TGGAAATTCTAGGGTTTTTGTACATTTTGGATGCACTGGGAATTTATTAGC
	Probe
	ACAAAATCATTCTTTGCAACTCAAAATTCAGAAGGGACTCTACCATAT CTTAGCTCAGAGCACAGAGGA
	CTTAGCTCAGAGCACAGAGGA
	Antisense primer
USC2	AAAGTTTCTTCTGGATCTACAGGAGTTTTTCATTTCCAATCTAAAAACTAG
	Sense primer
	AAGCTCTAGCATTTTGTACATTTTTTGTTGTTGCACTGGAAGTTTAACTATTGGCACAAAATCATTCTTCAAAACTCACAGAGGGACTCTGCCATTA
	Probe
	CTTAGCTCAGAGCACAGAGGA
	Antisense primer

Primers and probes annealing sites are indicated by an underline.

Genomic DNA Isolation

Peripheral blood samples were obtained from 21 Down syndrome patients and 30 normal subjects, and the amniotic cells were collected from 46 pregnant women. Genomic DNA was extracted using a standard method 9 using a genomic DNA isolation kit (Invitrogen, Carlsbad, CA). The karyotyping of all of the samples was performed by conventional cytogenetic analysis previously.

PCR Conditions

The dual color competitive fluorescence quantitative PCR was performed in triplicate in 96‐well plates; each 50 μl reaction consisted of 12.5 μl of Taqman Master Mix (Invitrogen), 1.0 μl of 10 umol/l forward and reverse primers of DSCR, and USC2, 0.6 μl of 10 μmol/l Taqman probes of both genes and 100 ng genomic DNA. Thermocycling proceeded as follows: 96°C for 2 min and then 10 sec at 94°C followed by 45 cycles of 94°C for 10 sec, 50°C for 30 sec, and 60°C for 40 sec, real‐time monitoring of the released fluorescence at 60°C. The amplification of both DSCR and USC2 genes was performed simultaneously, and the thermal cycles were done in a FTC‐2000 detection system (Funglyn Biotech Inc., Toronto, Canada).

Standard Curve Generation

In order to calculate the dual color competitive fluorescent PCR efficiencies of DSCR/USC2 sequences, a serial of a known concentration of genomic DNA (10, 100, 1,000, 10,000 times dilution) was prepared to construct standard curves of each sequence. A calculation for estimating the efficiency (E) of a real‐time PCR assay is: E = 10^[−1/slope].

Calculating the Relative Dosage Ratio of DSCR/USC2

The copy number of target DNA of each sample was calculated according to the real‐time PCR efficiencies (E _DSCR and E _USC2) and the Ct values (Ct _DSCR and Ct _USC2). The relative dosage ratio (R) of DSCR/USC2 is calculated based on real‐time PCR efficiency (E) and the Ct value of each sample according to the following formula: $R=E_{\mathrm{USC}2}C{t}_{\mathrm{USC}2}/E_{\mathrm{DSCR}}C{t}_{\mathrm{DSCR}}$. And the R value was used to predict 21 trisomy.

Statistics

Results are shown as mean ± SEM. One‐way analysis of variance (ANOVA) was used to compare groups using SPSS software (SPSS, Chicago, IL). A P‐value <0.05 was considered statistically significant.

RESULTS

The slope of a standard curve provides an indication of the efficiency of the real‐time PCR. A slope of −3.33 and −3.34 means that the PCR has an efficiency of 1.998 and 1.995 for DSCR and USC2, respectively (r ² = 1.0). Next, based on the dual color competitive fluorescence quantitative PCR results (see Table 3 and Fig. 1), the gene dosage ratio of DSCR/USC2 for 60 normal subjects was 0.93∼1.15 with variation coefficient (CV) of 5.7%, which was significantly lower than that of Down syndrome patients (1.41∼1.74, with CV of 5.9%).

Table 3.

DSCR/USC2 Ratio of Peripheral Blood

	n	Mean ± SEM	Range	t‐Test
NS	60	1.03 ± 0.094	0.93∼1.15	P < 0.01
DS	30	1.63 ± 0.097	1.41∼1.74

DS, Down syndrome; NS, normal subjects.

Figure 1.

The calculated ratio of Down syndrome critical region/USC2 in Down syndrome patients and in normal subjects.

The aim of this study was to establish an available and rapid diagnosis method for trisomy 21 syndrome. As we have detected and calculated the relative gene expression of DSCR/USC2 both for normal subjects as well as Down syndrome patients, the results indicated that the ratios of the two groups were significantly different. More importantly, the DSCR/USC2 ratio over a range of 1.41–1.74 could predict the fetus with a high risk of Down syndrome. Then we also measured the DSCR/USC2 ratio in amniotic cells from 46 pregnant women, and the results are shown in Table 4. According to the dual color competitive fluorescence quantitative PCR, among the 46 pregnant women, 3 cases were Down syndrome and 43 cases were normal, and these results were accordingly consistent with those of the cytogenetic karyotype analysis.

Table 4.

DSCR/USC2 Ratio of Amniocytes

	n	DSCR/USC2
NS	43	0.93∼1.15
		1.61
DS	3	1.64
		1.54

DS, Down syndrome; NS, normal subjects.

DISCUSSION

Trisomy 21 is the most prevalent chromosomal abnormality in human beings. Karyotype analysis of amniotic fluid cells was applied to prenatal diagnosis of Down syndrome, but this classical method is extremely labor‐ and time‐consuming, and expensive in clinical practice. In the present, rapid and simple molecular methods involving fluorescence in situ hybridization (FISH) as well as real‐time PCR for prenatal diagnosis of chromosomal disorders have been reported 10, 11, 12, 13, 14. In fact, although the risk for misdiagnosis by either FISH or real‐time PCR is relatively small, FISH requires larger samples and is more labor‐intensive than real‐time PCR.

The selection of housekeeping genes is critical for gene expression studies. Generally speaking, GAPDH is usually used as a reference gene in reverse transcription PCR and in real‐time PCR. In our previous study, unsatisfactory amplification efficiency (1.83) of amplification for DSCR and GAPDH simultaneous in one reaction was observed. Furthermore, the real‐time PCR results showed that DSCR3/GAPDH ratio of lymphocytes in 30 Down syndrome and in 60 normal people were 1.35～1.94 (CV = 10.6%) and 0.94～1.39 (CV = 11.2%), respectively. In contrast, results from dual color competitive fluorescent PCR suggested that the novel Down syndrome diagnosis method we established was more sensitive and reliable as the ratio of DSCR/USC2 was 1.41∼1.74 (CV = 5.7%) in Down syndrome patients and 0.93∼1.15 (CV = 5.9%) in normal controls. Furthermore, the applicability of dual color competitive fluorescent PCR in the prediction of Down syndrome were confirmed by the measurement of amniotic fluid fetal cells from 46 pregnant mother as well as karyotyping analysis with the same samples.

In conclusion, this approach offers some advantages for prenatal diagnosis. (1) The test is simple and rapid and could be finished in 2–3 hours; (2) The reaction tubes stay closed so that the PCR products will not be contaminated; (3) The assay is reliable even when few cells are available, as low as 100 ng DNAs were enough for a reaction; (4) Results are attained after a short time, which allows the parents to decide about the termination of a pregnancy without unnecessary delay.