Abstract
Objectives
The aim of this study was to evaluate the association between environmental factors and colon or rectal cancer after adjusting for N‐acetyl transferase 2 (NAT2) phenotypes.
Methods
Ninety‐six patients with sporadic colon cancer, 54 with sporadic rectal cancer and 162 control subjects were genotyped for NAT2‐T341C, G590A, G857A, A845C, and C481T using sequencing and PCR‐RFLP analysis.
Results
The risk for colon cancer was increased in carriers of the homozygous negative genotypes for NAT2*5C‐T341C, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, and NAT2*5A‐C481T. The risk for rectal cancer was increased in carriers of the homozygous negative genotypes for NAT2*5C‐T341C, NAT2*7B‐G857A, and NAT2*5A‐C481T. High fried red meat intake associated with NAT2‐T341C, G590A, G857A, A845C, and C481T rapid acetylator allele determines a risk of 2.39 (P=.002), 2.39 (P=.002), 2.37 (P=.002), 2.28 (P=.004), and 2.51 (P=.001), respectively, for colon cancer, whereas in the case of rectal cancer, the risk increased to 7.55 (P<.001), 7.7 (P<.001), 7.83 (P<.001), 7.51 (P<.001), and 8.62 (P<.001), respectively. Alcohol consumption associated with the NAT2 ‐T341C, G590A, G857A, A845C, and C481T rapid acetylator allele induces a risk of 10.63 (P<.001), 12.04 (P<.001), 9.76 (P<.001), 10.25 (P<.001), and 9.54 (P<.001), respectively, for colon cancer, whereas the risk for rectal cancer is 9.72 (P<.001), 11.24 (P<.001), 13.07 (P<.001), 10.04 (P<.001), and 9.43 (P<.001), respectively. Smokers with NAT2‐T341C, G590A, G857A, A845C, and C481T rapid acetylator allele have a risk of 4.87, 4.25, 4.18, 3.81, and 3.82, respectively, to develop colon cancer.
Conclusions
Fried red meat, alcohol, and smoking increase the risk of sporadic CRC, especially of colon cancer, in the case of rapid acetylators for the NAT2 variants.
Keywords: alcohol consumption, fried red meat intake, genetic analysis, NAT2 rapid acetylators, smoking behavior
1. Introduction
Sporadic colorectal cancer (CRC) is considered to be a multifactorial disorder that occurs due to the exposure of individuals with specific genetic variants to compounds with a carcinogenic effect.1
Unlike family CRC, which occurs with a high frequency in the relatives of the affected patient, having a hereditary transmission, sporadic CRC involves interactions between external chemical factors and the genetic susceptibility of the persons concerned to develop colorectal cancer.2 Environmental risk factors in colorectal cancer are unanimously recognized, the following being cited: high lipid consumption, high consumption of red meat, particularly fried red meat with the release of fecopentanes and heterocyclic amines, alcohol.3, 4, 5, 6 The role of smoking in colorectal cancer is also suggested, classical studies showing an increased risk of colorectal cancer in smokers. Initially, meat consumption was associated with the risk of carcinoma due to the fat content, but a series of studies suggest that it is the preparation of meat that probably influences the mutagenic content of meat preparations, the type of meat also playing an important role. It is also suggested that meat consumption, particularly meat fried for a long time at high temperatures, is one of the nutrition risk factors studied in relation to sporadic colorectal cancer.5, 7, 8 The majority of the environmental factors require activation before interacting with the DNA and resulting in its alteration.9 An important role in the formation of heterocyclic aromatic amines and polycyclic aromatic hydrocarbons with a carcinogenic potential is played by N‐acetyltransferases 1 and 2 (NAT1 and NAT2), located extrahepatic (NAT1), in the liver and colorectal mucosa (NAT2), as a result of their implication in N‐ and O‐esterification reactions of the hydroxy aromatic amines and the formation of N‐acetoxyaryl amines.10, 11, 12 This type of compounds bind to the DNA strand and can induce gene alterations, followed by the appearance of the cancer cell. The gene encoding NAT2, located on chromosome 8p21.3‐23.1, presents 10 possible genetic variants associated with different biochemical phenotypes varying from the slow acetylator to the rapid acetylator.13 For five of these genetic variants, the point substitutions NAT2*5C‐T341C (Ile114thr), NAT2*6A‐G590A (Arg197Gln), NAT2*7B‐G857A (Gly286Glu), NAT2*18‐A845C (Lsy282Thr), and NAT2*5A‐C481T (Leu161leu), normal alleles are associated with a high enzyme activity, whereas mutated alleles are associated with a low enzyme activity. Thus, individuals are characterized to be slow acetylators if they are homozygous for the mutant allele and rapid acetylators if they are homozygous or heterozygous for the normal allele.13
Starting from the contradictory results regarding the presence of the NAT2 rapid/slow acetylator allele associated with environmental factors (dietary meat intake, alcohol consumption, smoking behavior) and the risk of colorectal cancer,14, 15, 16, 17, 18 the objectives of this study were the following: To perform a differentiated genetic analysis depending on tumor location in order: 1. To investigate the association between environmental factors and the presence of colon or rectal cancer; 2. To examine the association between NAT2 genotypes and the presence of colon or rectal cancer; 3. To evaluate the association between environmental factors (hypercaloric diet, alcohol consumption, and smoking behavior) and colon or rectal cancer after adjusting for N‐acetyl transferase 2 (NAT2) phenotypes.
2. Methods
2.1. Patient groups
The study included 96 randomly selected patients with sporadic colon cancer and 54 with rectal cancer, from the 3rd Surgical Clinic, Cluj‐Napoca. The selection criteria were the following: histologically confirmed colorectal cancer, patient operated in the 3rd Surgical Clinic. The exclusion criteria were as follows: a personal or family history of familial adenomatous polyposis or hereditary non‐polyposis cancer, a history of inflammatory intestinal disease. All patients with sporadic colorectal cancer underwent surgery depending on tumor location. Also, adenocarcinomas were confirmed by histopathological examination.
The control group included 162 patients admitted to the 3rd Surgical Clinic Cluj or to the 3rd Medical Clinic Cluj. The criteria of inclusion in the control group were the following: age over 50, performance of total colonoscopy evidencing no colonic or rectal lesions (the only accepted lesions were diverticula and hemorrhoids). The criteria of exclusion from the control group were: a personal or family history of familial adenomatous polyposis or hereditary non‐polyposis cancer, a history of inflammatory intestinal disease, a history of colorectal surgery, non‐performance of total colonoscopy, age under 50 years.
The personal data of the participants in the study were obtained using a standard questionnaire. In these groups of patients, the investigation consisted of the following: (1) paraclinical examination: plain X‐ray (irrigoscopy, rectosigmoidoscopy, abdominal ultrasound or colonoscopy); (2) synthesis of anamnestic data (age, tumor location, presence of objective symptoms: rectorrhagia, transit disorders, anemia, subocclusion, occlusion, perforation/peritonitis); and (3) the presence of risk factors for sporadic CRC was mentioned (hypercaloric diet, based on increased amounts of meat prepared by prolonged processing at high temperatures, alcohol consumption, smoking behavior). Anamnestic data suggested that 31.3% of patients had right colon cancer, 58.3% had left colon cancer, whereas 10.4% of patients had transverse colon cancer. Also, rectorrhagia was present in 20.8% of patients with colon cancer and 77.8% of patients with rectal cancer, transit disorders were present in 60.4% of patients with colon cancer and 48.1% of cases with rectal cancer, anemia was present in 16.7% of patients with colon cancer and 14.8% of patients with rectal cancer. A disease onset <12 months was observed in 74% of colon cancer patients and 53.7% of rectal cancer patients. A diet rich in red meat prepared by pyrolysis was considered to be the consumption of this type of preparation more than 5 days a week. We considered smokers the individuals with a history of smoking and who smoked more than 20 cigarettes/d over the past 5 years. Also, the subjects were divided into drinkers and non‐drinkers.
All patients diagnosed with sporadic colorectal cancer and control subjects were interviewed regarding their participation in the study and signed an informed consent form, and the study was approved by the Ethics Commission of the University.
2.2. Method
2.2.1. I. Identification of NAT2*5C‐T341C, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, and NAT2*5A‐C481T genetic variants
PCR reaction
To determine the NAT2 genetic variants, 2 mL venous blood were collected on EDTA. Genomic DNA was isolated using a Qiagen extraction kit, and the samples were stored at −20°C. PCR amplification of the fragments of interest was performed using the method described by Osian et al.19 25 μL mixture contained 40 ng DNA, 0.2 μmol/L specific primers, 200 μmol/L dNTP, 2.0 mmol/L MgCl2, 2 U Taq polymerase. Reagents were provided by Sigma, except for primers, which were provided by Sigma Genosys (Steinheim, Germany). For PCR amplification, we used a program in an Eppendorf thermocycler. The specificity and efficacy of the amplification reaction were verified by the migration of DNA fragments in 2% agarose gel stained with ethidium bromide (ETB; Table 1).
Table 1.
PCR amplification conditions
| Genetic variant | Primer sequences | Annealing temperature | PCR fragment |
|---|---|---|---|
| NAT2*5C‐T341C | 5′‐ TGGTGTCTCCAGGTCAATCA‐3′ | 60°C | 361 bp |
| 5′‐ GGTGTTTCTTCTTTGGCAGG‐3′ | |||
| NAT2*6B‐G590A | 5′‐GGACCAAATCAGGAGAGAGCAG‐3′ | 60°C | 159 bp |
| 5′‐GTTGGAGACGTCTGCAGGTATG‐3′ | |||
| NAT2*7B‐G857A | 5′‐GCTGGGTCTGGAAGCTCCTC‐3′ | 62°C | 547 bp |
| NAT2*18‐A845C | 5′‐TTGGGTGATACATACACAAGGG‐3′ | ||
| NAT2*5A‐C481T | 5′‐AAGGATCAGCCTCAGGTGCCTT‐ 3′ | 60°C | 84 bp |
| 5′‐ CTGCTCTCTCCTGATTTGGTCC‐3′ |
2.2.1.1. Sequencing
For the sequencing of the DNA fragment, an ABI PRISM 377, Sequence Detection Systems (Applied Biosystems, Foster City, CA, USA) using TaqMan assay was employed. Sequencing was performed in a 20 μL mixture volume and included 1 μL TaqMan Universal PCR Master Mix, 5 μL buffer, 2.4 pmol/15 μL forward and reverse primer reaction, and 5 μL PCR product. The amplification program included 25 amplification cycles at 96°C for 45 seconds, at 50°C for 30 seconds, at 60°C for 4 minutes. The purification of the product obtained by the amplification of the forward and reverse strands was done by precipitation with isopropanol 75%. The fluorescence level was measured with the ABI sequence detector. Allele frequencies were determined using the ABI software (Applied Biosystems).
2.2.1.2. PCR‐RFLP analysis
Genotyping was also done using PCR‐RFLP methods (data not shown).
2.2.1.3. Statistical analysis
Categorical variables were described as absolute and relatives frequencies (%). The NAT2 phenotype was expressed both as genotype and rapid acetylator (patients carrying at least one NAT2*5C‐T341, NAT2*6B‐G590, NAT2*7B‐G857, NAT2*18‐A845, or NAT2*5A‐C481 allele) or slow acetylator (patients homozygous for the NAT2*5C‐C341, NAT2*6B‐A590, NAT2*7B‐A857, NAT2*18‐C845, or NAT2*5A‐T481 allele).
To evaluate significant associations between the NAT2 phenotypes, environmental factors (hypercaloric diet rich in red meat prepared by frying, alcohol consumption, smoking behavior) and the presence of colon and rectal cancer, we used the Chi‐square or Fisher's exact test. The individual effect of NAT2 phenotypes or environmental factors was expressed using the odds ratio (OR) and 95% confidence intervals for OR determined by case‐control analysis or univariate binomial logistic regression. The potential confounding effect of genetic factors was tested by Mantel‐Haenszel test. Because all results of Breslow‐Day test was insignificant, we used the Mantel‐Haenszel OR estimate as a reliable effect size for association between genetic factors and colon or rectal cancer based on exposure to environmental factors.
Statistical significance for all two‐sided tests was considered when the estimated significance level P<.05.
Statistical analysis was performed with the IBM SPSS v.19 (IBM Corp, Armonk, NY, USA).
3. Results
The study investigated 96 patients diagnosed with sporadic colon cancer and 54 patients diagnosed with sporadic rectal cancer (80 females and 70 males) and 162 control subjects (100 females and 62 males) who were not related to the affected patients, for the presence of five genetic variants in the NAT2 gene, NAT2*5C‐C341T, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, and NAT2*5A‐C481T. 31.2% of the cases (30 of 96) were diagnosed with right colon cancer, 58.2% (56 of 96) with left colon cancer, 10.4% (10 of 96) with transverse colon cancer. Our study found a high consumption of red meat prepared by pyrolysis in the case of patients diagnosed with sporadic colon or rectal cancer (64.6% and 85.2%) compared to control subjects (43.2%). Patients whose diet included a higher amount of fried red meat had a 2.39 (P=.001) and 7.58 (P<.001), respectively, increased risk to develop colon and rectal cancer. Results were significant and differentiated analysis according to sex showed that both females and males with colon and rectal cancer were consumers of red meat prepared by pyrolysis to a greater extent than subjects of the control group (data not shown). Alcohol consumption analysis revealed a higher number of drinkers in both the colon (43.8%) and the rectal (44.4%) cancer group compared to controls (7.4%). Patients whose diet included consumption of alcohol had a 9.72 (P<.001) and 10 (P<.001), respectively, increased risk to develop colon and rectal cancer. Regarding smoking behavior, 27.1% of patients with sporadic colon cancer and 14.8% of patients with sporadic rectal cancer were smokers compared to 8.6% of controls. Smoking is associated with 3.93‐fold (P<.001) increased risk to develop colon cancer. Environmental risk factors and associated risk for both colon and rectal cancer are presented in Table 2.
Table 2.
The association between the environmental risk factors and type of cancer
| Environmental factors | Colon cancer group (no, %) | Control group (no, %) | Crude OR [95%CI] | P b |
|---|---|---|---|---|
| Fried red meat intake | ||||
| High | 62 (64.6%) | 70 (43.2%) | 2.39 [1.42‐4.04] | .001 |
| Lowa | 34 (35.4%) | 92 (56.8%) | ||
| Alcohol consumption | ||||
| Yes | 42 (43.8%) | 12 (7.4%) | 9.72 [4.76‐19.83] | <.001 |
| Noa | 54 (56.3%) | 150 (92.6%) | ||
| Smoking behavior | ||||
| Yes | 26 (27.1%) | 14 (8.6%) | 3.93 [1.93‐7.98] | <.001 |
| Noa | 70 (72.9%) | 148 (91.4%) | ||
| Environmental factors | Rectal cancer group (no, %) | Control group (no, %) | Crude OR [95%CI] | P b |
|---|---|---|---|---|
| Fried red meat intake | ||||
| High | 46 (85.2%) | 70 (43.2%) | 7.58 [3.35‐17.03] | <.001 |
| Lowa | 8 (14.8%) | 92 (56.8%) | ||
| Alcohol consumption | ||||
| Yes | 24(44.4%) | 12 (7.4%) | 10 [4.51‐22.17] | <.001 |
| Noa | 30 (55.6%) | 150 (92.6%) | ||
| Smoking behavior | ||||
| Yes | 8 (14.8%) | 14 (8.6%) | 1.84 [0.73‐4.66] | NS |
| Noa | 46 (85.2%) | 148 (91.4%) | ||
Reference category.
Statistical significance if P<.05; crude P‐values from Chi‐square or Fisher's Exact test.
3.1. NAT2 phenotypes and the risk of sporadic colon and rectal cancer
Differentiated analysis depending on the location of the tumor process shows that the risk of colon and rectal cancer was increased in carriers of the heterozygous or homozygous negative genotypes for NAT2 variants. The risk for colon cancer and rectal cancer in association with different NAT2 genotypes are presented in Table 3.
Table 3.
The association between the NAT2 genotypes and type of cancer
| Genotype | Colon cancer group (no, %) | Control group (no, %) | Crude OR [95%CI] | P f |
|---|---|---|---|---|
| T341Ca | ||||
| TT | 29 (30.2%) | 44 (27.2%) | 2.31 [1.17‐4.57] | .016 |
| TC | 47 (49%) | 48 (29.6%) | 3.43 [1.81‐6.5] | <.001 |
| G590Ab | ||||
| GG | 38 (39.6%) | 44 (27.2%) | 2.91 [1.53‐5.53] | .001 |
| GA | 36 (37.5%) | 44 (27.2%) | 2.75 [1.44‐5.26] | .002 |
| G857Ac | ||||
| GG | 41 (42.7%) | 46 (28.4%) | 2.35 [1.23‐4.5] | .01 |
| GA | 33 (34.4%) | 58 (35.8%) | 1.5 [0.78‐2.88] | NS |
| A845Cd | ||||
| AA | 33 (34.4%) | 32 (19.8%) | 3.13 [1.66‐5.89] | <.001 |
| AC | 32 (33.2%) | 36 (22.2%) | 2.7 [1.44‐5.04] | .002 |
| C481Te | ||||
| CC | 47 (49%) | 56 (40.7%) | 2 [1.01‐3.96] | .046 |
| CT | 33 (34.4%) | 51 (31.5%) | 1.82 [0.89‐3.74] | NS |
| Genotype | Rectal cancer group (no, %) | Control group (no, %) | Crude OR [95%CI] | P f |
|---|---|---|---|---|
| T341Ca | ||||
| TT | 22 (40.7%) | 44 (27.2%) | 3.18 [1.41‐7.2] | .005 |
| TC | 21 (38.9%) | 48 (29.6%) | 2.78 [1.23‐6.3] | .014 |
| G590Ab | ||||
| GG | 15 (27.8%) | 44 (27.2%) | 1.8 [0.8‐4.09] | NS |
| GA | 25 (46.3%) | 44 (27.2%) | 3.0 [1.41‐6.38] | .004 |
| G857Ac | ||||
| GG | 31 (57.4%) | 46 (28.4%) | 7.81 [2.82‐21.7] | <.001 |
| GA | 18 (33.3%) | 58 (35.8%) | 3.6 [1.25‐10.35] | .017 |
| A845Cd | ||||
| AA | 12 (22.2%) | 32 (19.8%) | 1.47 [0.66‐3.27] | NS |
| AC | 18 (33.3%) | 36 (22.2%) | 1.95 [0.95‐4.03] | NS |
| C481Te | ||||
| CC | 21 (38.9%) | 56 (40.7%) | 3.58 [1.15‐11.11] | .028 |
| CT | 29 (53.7%) | 51 (31.5%) | 6.39 [2.09‐19.6] | .001 |
CC=Reference category;
TT=Reference category;
AA=Reference category;
AA=Reference category;
TT=Reference category;
Statistical significance if P<.05; crude P‐values from univariate binary logistic regression.
3.2. Analysis of the association of the rapid acetylators and hypercaloric diet, alcohol consumption, and smoking behavior depending on the location of the tumor process
The influence of the NAT2*5C‐T341C, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, or NAT2*5A‐C481T rapid acetylator allele and diet behavior (hypercaloric diet, alcohol consumption, smoking habit) on colon and rectal cancer risk is presented in Tables 4, 5, 6.
Table 4.
The association between genetic polymorphism and type of cancer at the time of exposure to fried red meat intake
| Genetic polymorphism | Environmental factors | Colon cancer cases (no, %) | Control Group (no, %) | P b | OR [95%CI]a | Rectal cancer cases (no, %) | Control Group (no, %) | P b | OR [95%CI]a |
|---|---|---|---|---|---|---|---|---|---|
| T341C | Fried red meat intake | ||||||||
| Slow acetylator | High | 50 (65.8) | 39 (42.4) | .002 | 2.39 [1.40; 4.07] | 37 (86.0) | 39 (42.4) | <.001 | 7.55 [3.32; 17.16] |
| Slow acetylator | Low | 26 (34.2) | 53 (57.6) | 6 (14.0) | 53 (57.6) | ||||
| Rapid acetylator | High | 12 (60.0) | 31 (44.3) | 9 (81.8) | 31 (44.3) | ||||
| Rapid acetylator | Low | 8 (40.0) | 39 (55.7) | 2 (18.2) | 39 (55.7) | ||||
| G590A | Fried red meat intake | ||||||||
| Slow acetylator | High | 48 (64.9) | 37 (42.0) | .002 | 2.39 [1.40; 4.07] | <.001 | 7.70 [3.38;17.54] | ||
| Slow acetylator | Low | 26 (35.1) | 51 (58.0) | 6 (15.0) | 51 (58.0) | ||||
| Rapid acetylator | High | 14 (63.6) | 33 (44.6) | 12 (85.7) | 33 (44.6) | ||||
| Rapid acetylator | Low | 8 (36.4) | 41 (55.4) | 2 (14.3) | 41 (55.4) | ||||
| G857A | Fried red meat intake | ||||||||
| Slow acetylator | High | 49 (66.2) | 45 (43.3) | .002 | 2.37 [1.40; 3.99] | 41 (83.7) | 45 (43.3) | <.001 | 7.83 [3.38;18.16] |
| Slow acetylator | Low | 25 (33.8) | 59 (56.7) | 8 (16.3) | 59 (56.7) | ||||
| Rapid acetylator | High | 13 (59.1) | 25 (43.1) | 5 (100.0) | 25 (43.1) | ||||
| Rapid acetylator | Low | 9 (40.9) | 33 (56.9) | 0 (0.00) | 33 (56.9) | ||||
| A845C | Fried red meat intake | ||||||||
| Slow acetylator | High | 45 (69.2) | 29 (42.6) | .004 | 2.28 [1.34; 3.89] | 26 (86.7) | 29 (42.6) | <.001 | 7.51 [3.33;16.96] |
| Slow acetylator | Low | 20 (30.8) | 39 (57.4) | 4 (13.3) | 39 (57.4) | ||||
| Rapid acetylator | High | 17 (54.8) | 41 (43.6) | 20 (83.3) | 41 (43.6) | ||||
| Rapid acetylator | Low | 14 (45.2) | 53 (56.4) | 4 (16.7) | 53 (56.4) | ||||
| C481T | Fried red meat intake | ||||||||
| Slow acetylator | High | 51 (63.8) | 47 (40.2) | .001 | 2.51 [1.48; 4.26] | 42 (84.0) | 47 (40.2) | <.001 | 8.62 [3.72;19.95] |
| Slow acetylator | Low | 29 (36.3) | 70 (59.8) | 8 (16.0) | 70 (59.8) | ||||
| Rapid acetylator | High | 11 (68.8) | 23 (51.1) | 4 (100.0) | 23 (51.1) | ||||
| Rapid acetylator | Low | 5 (31.3) | 22 (48.9) | 0 (0.0) | 22 (48.9) |
Adjusted odds ratio for specified polymorphism;
Statistical significance if P<.05; P‐values from Mantel‐Haenszel test.
Table 5.
The association between genetic polymorphism and type of cancer at the time of exposure to alcohol consumption
| Genetic polymorphism | Environmental factors | Colon cancer cases (no, %) | Control Group (no,%) | P b | OR [95%CI]a | Rectal cancer cases (no, %) | Control Group (no,%) | P b | OR [95%CI]a |
|---|---|---|---|---|---|---|---|---|---|
| T341C | Alcohol consumption | ||||||||
| Slow acetylator | Yes | 34 (44.7) | 5 (5.4) | <.001 | 10.63 [4.98;22.69] | 23 (53.5) | 5 (5.4) | <.001 | 9.72 [4.32; 21.90] |
| Slow acetylator | No | 42 (55.3) | 87 (94.6) | 20 (46.5) | 87 (94.6) | ||||
| Rapid acetylator | Yes | 8 (40.0) | 7 (10.0) | 1 (9.1) | 7 (10.0) | ||||
| Rapid acetylator | No | 12 (60.0) | 63 (90.0) | 10 (90.9) | 63 (90.0) | ||||
| G590A | Alcohol consumption | ||||||||
| Slow acetylator | Yes | 28 (37.8) | 5 (5.7) | <.001 | 12.04 [5.49;26.39] | 17 (42.5) | 5 (5.7) | <.001 | 11.24 [4.84;26.10] |
| Slow acetylator | No | 46 (62.2) | 83 (94.3) | 23 (57.5) | 83 (94.3) | ||||
| Rapid acetylator | Yes | 14 (63.6) | 7 (9.5) | 7 (50.0) | 7 (9.5) | ||||
| Rapid acetylator | No | 8 (36.4) | 67 (90.5) | 7 (50.0) | 67 (90.5) | ||||
| G857A | Alcohol consumption | ||||||||
| Slow acetylator | Yes | 35 (47.3) | 6 (5.8) | <.001 | 9.76 [4.74; 20.12] | 20 (40.8) | 6 (5.8) | <.001 | 13.07 [5.20;32.85] |
| Slow acetylator | No | 39 (52.7) | 98 (94.2) | 29 (59.2) | 98 (94.2) | ||||
| Rapid acetylator | Yes | 7 (31.8) | 6 (10.3) | 4 (80.0) | 6 (10.3) | ||||
| Rapid acetylator | No | 15 (68.2) | 52 (89.7) | 1 (20.0) | 52 (89.7) | ||||
| A845C | Alcohol consumption | ||||||||
| Slow acetylator | Yes | 29 (44.6) | 4 (5.9) | <.001 | 10.25 [4.82;21.79] | 15 (50.0) | 4 (5.9) | <.001 | 10.04 [4.49;22.45] |
| Slow acetylator | No | 36 (55.4) | 64 (94.1) | 15 (50.0) | 64 (94.1) | ||||
| Rapid acetylator | Yes | 13 (41.9) | 8 (8.5) | 9 (37.5) | 8 (8.5) | ||||
| Rapid acetylator | No | 18 (58.1) | 86 (91.5) | 15 (62.5) | 86 (91.5) | ||||
| C481T | Alcohol consumption | ||||||||
| Slow acetylator | Yes | 36 (45.0) | 9 (7.7) | <.001 | 9.54 [4.65; 19.57] | 24 (48.0) | 9 (7.7) | <.001 | 9.43 [4.15;21.43] |
| Slow acetylator | No | 44 (55.0) | 108 (92.3) | 26 (52.0) | 108 (92.3) | ||||
| Rapid acetylator | Yes | 6 (37.5) | 3 (6.7) | 0 (0.0) | 3 (6.7) | ||||
| Rapid acetylator | No | 10 (62.5) | 42 (93.3) | 4 (100.0) | 42 (93.3) |
Adjusted odds ratio for specified polymorphism;
Statistical significance if P<.05; P‐values from Mantel‐Haenszel test.
Table 6.
The association between genetic polymorphism and type of cancer at the time of exposure to smoking
| Genetic polymorphism | Environmental factors | Colon cancer cases (no, %) | Control Group (no, %) | P b | OR [95%CI]a | Rectal cancer cases (no, %) | Control Group (no, %) | P b | OR [95%CI]a |
|---|---|---|---|---|---|---|---|---|---|
| T341C | Smoking | ||||||||
| Slow acetylator | Yes | 19 (25) | 5 (20.8) | <.001 | 4.87 [2.26; 10.5] | 8 (18.6) | 5 (5.4) | NS | 2.05 [0.76; 5.47] |
| Slow acetylator | No | 57 (75) | 87 (94.6) | 35 (81.4) | 87 (94.6) | ||||
| Rapid acetylator | Yes | 7 (43.8) | 9 (12.9) | 0 (0) | 9 (12.9) | ||||
| Rapid acetylator | No | 13 (17.6) | 61 (87.1) | 11 (100) | 61 (87.1) | ||||
| G590A | Smoking | ||||||||
| Slow acetylator | Yes | 22 (29.7) | 5 (5.7) | <.001 | 5.25 [2; 9.01] | 6 (15) | 5 (5.7) | NS | 2.1 [0.79; 5.52] |
| Slow acetylator | No | 52 (70.3) | 83 (94.3) | 34 (85) | 83 (94.3) | ||||
| Rapid acetylator | Yes | 4 (18.2) | 9 (12.2) | 2 (14.3) | 9 (12.2) | ||||
| Rapid acetylator | No | 18 (81.8) | 65 (87.8) | 12 (85.7) | 65 (87.8) | ||||
| G857A | Smoking | ||||||||
| Slow acetylator | Yes | 20 (27) | 7 (6.7) | <.001 | 4.18 [2.02; 8.65] | 8 (16.3) | 7 (6.7) | NS | 2.09 [0.76; 5.68] |
| Slow acetylator | No | 54 (73) | 97 (93.3) | 41 (83.7) | 97 (93.3) | ||||
| Rapid acetylator | Yes | 6 (27.3) | 7 (12.1) | 0 (0) | 7 (12.1) | ||||
| Rapid acetylator | No | 16 (72.7) | 51 (87.9) | 5 (100) | 51 (87.9) | ||||
| A845C | Smoking | ||||||||
| Slow acetylator | Yes | 16 (24.6) | 7 (10.3) | <.001 | 3.81 [1.84;7.87] | 8 (26.7) | 7 (10.3) | NS | 1.66 [0.64; 4.34] |
| Slow acetylator | No | 49 (75.4) | 61 (89.7) | 22 (73.3) | 61 (89.7) | ||||
| Rapid acetylator | Yes | 10 (32.3) | 7 (7.4) | 0 (0) | 7 (7.4) | ||||
| Rapid acetylator | No | 21 (67.7) | 87 (92.6) | 24 (100) | 87 (92.6) | ||||
| C481T | Smoking | ||||||||
| Slow acetylator | Yes | 24 (30) | 10 (8.5) | <.001 | 3.82 [1.87; 7.84] | 8 (16) | 10 (8.5) | NS | 1.8 [0.69; 4.7] |
| Slow acetylator | No | 56 (70) | 107 (91.5) | 42 (84) | 107 (91.5) | ||||
| Rapid acetylator | Yes | 2 (12.5) | 4 (66.7) | 0 (0) | 4 (8.9) | ||||
| Rapid acetylator | No | 14 (87.5) | 41 (91.1) | 4 (100) | 41 (91.1) |
Adjusted odds ratio for specified polymorphism;
Statistical significance if P<.05; P‐values from Mantel‐Haenszel test.
4. Discussions
N‐acetyl transferase 2 is an important phase II enzyme in detoxification processes, and at the same time, in the activation of dietary procarcinogens.20 For these reasons, both hypercaloric diet and the polymorphisms in the gene encoding NAT2 may have important implications in the susceptibility to colorectal cancer, as well as therapy.14
Starting from the premise that NAT2 rapid acetylators' subjects are exposed to higher amounts of carcinogens, we investigated hypercaloric diet (hypercaloric diet caused by the consumption of increased amounts of red meat prepared by pyrolysis), alcohol consumption, and smoking behavior on the one hand, and on the other hand, five genetic variants, NAT2*5C‐T341C, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, and NAT2*5A‐C481T, in association with the risk of sporadic colon and rectal cancer. We also aimed to analyze the relationship between the two NAT2 rapid and slow acetylator alleles and environmental factors as modulating risk factors for sporadic colon and rectal cancer. We mention that two studies carried out by Osian et al. in 2006 and 2010 analyzed the relationship between different NAT2 genotypes and the histological forms, staging and prognosis of colorectal cancer, and also, the survival rate of patients with sporadic CRC.19, 21
Inconsistent results have been obtained regarding the role of diet in the development and recurrence of colorectal cancer, such as those of the studies performed by Gunter et al. (2005), Sinha et al. (2005), Mathew et al. (2004), Robertson et al. (2005), Ishibe et al. (2002).22, 23, 24, 25, 26 There are controversial opinions regarding meat consumption as a risk factor for sporadic colorectal cancer. It is not completely understood whether the association of meat consumption and sporadic colorectal cancer is due to the increased amount of dietary meat or is caused by the way in which meat is prepared, which generates high amounts of heterocyclic amines, polycyclic aromatic hydrocarbons or other compounds with a carcinogenic potential. Some studies have shown that regular consumption of pork or beef meat prepared at high temperatures was associated with a 2‐3‐fold increased risk for sporadic colorectal cancer.25 Also, Lilla et al. (2006) showed 74% increased risk for colorectal cancer in people who consume red meat at least once per day as compared with people who eat red meat less than once per week. People who eat well‐done red meat have 2.6 increased risk for colorectal cancer compared to people who eat medium cooked.27 Moreover, Wang et al.28 showed 1.09‐fold and 1.11‐fold increased risk for colon and rectal cancer, respectively, in patients who eat higher amount of fried red meat. In our study, the frequency of patients diagnosed with sporadic colon and rectal cancer whose diet included high amounts of meat prepared at high temperatures was higher than the frequency of patients whose diet included low fried red meat amount. Our results proved that fried red meat intake was associated with an significant increased risk for colon (OR=2.39, 95% IC: [1.42‐4.04] and rectal cancer (OR=7.58, 95% IC: [3.35‐17.03]). Smokers whose diet included frequently red meat had 3.11‐fold increased risk to develop colorectal cancer compared with non‐smokers whose diet included lower amount of red meat.27 Our study confirms that alcohol consumptions was a significant risk factor for colon (OR=9.72, 95% IC: [4.76‐19.83]) and rectal cancer (OR=10, 95% IC: [4.51‐22.17). Regarding tobacco use, our results confirmed that it was a significant risk factor for colon (OR=3.93, 95% IC: [1.93‐7.98]) but there was no enough evidence for rectal cancer (OR=1.84, 95% IC: [0.73‐4.66]). We confirmed the results obtained by Slattery et al.29 who showed that patients who smoke more than a pack of cigarettes a day have ~40% increased risk of colon cancer compared to those who were never smokers.
Controversial results have also been obtained regarding the role of the NAT2 gene in the development of colorectal cancer. Some studies have evidenced an increase in colorectal cancer risk in individuals with a NAT2 rapid acetylator allele (presence of at least one normal allele), such as the studies performed by Andesersen et al. in 2013, Ashwin et al., 2014, Frazier et al. in 2001, Tamer et al. in 2004 or Kiss et al. in 2004.14, 30, 31, 32, 33 Other studies such as that of Tiemersma et al. in 2002, or Lilla et al. in 2006 do not confirm these results.27, 34 The studies conducted by Slattery et al.35 revealed the influence of the NAT2 gene on colon cancer. Higher frequency of the NAT2*6B‐G590A genetic variation in control as compared to patients with colon cancer (45.6% vs 22.9%) were observed in our study as well as in the study conducted by Borlack et al. (2006). In the same study the NAT2*5A‐C481T genetic variation offer protection against colon cancer.36
Similarly, slow acetylators (characterized by the presence of two mutant alleles), particularly patients with hereditary non‐polyposis cancer, would have a low risk to develop colorectal cancer. Our results, depending on the presence of one or two mutated alleles, suggest the fact that the homozygous negative genotypes NAT2*5C‐T341C (OR=2.31, 95% IC: [1.17‐4.57]), NAT2*6B‐G590A (OR=2.91, 95% IC: [1.53‐5.53]), NAT2*7B‐G857A (OR=2.35, 95% IC:[1.23‐4.50]), NAT2*18‐A845C (OR=3.13, 95% IC:[1.66‐5.89]), and NAT2*5A‐C481T (OR=2, 95% IC:[1.01‐3.96]) are significantly risk factors for sporadic colon cancer. The heterozygous genotypes for NAT2*7B‐G857A and NAT2*5A‐C481T do not represent risk factors for colon cancer. Regarding rectal cancer, the homozygous negative genotypes for NAT2*6B‐G590A and NAT2*18‐A845C were not identified as risk factors. However, carriers of the homozygous genotypes for NAT2*5C‐T341C (OR=3.18, 95% IC:[1.41‐7.20]), NAT2*7B‐G857A (OR=7.81, 95% IC:[2.82‐21.70]), and NAT2*5A‐C481T (OR=3.58, 95% IC:[1.15‐11.11]) had a significantly increased risk to develop rectal cancer. Nevertheless, the presence of the rapid acetylator alleles (homozygous negative or heterozygous carriers) for all five NAT2 genetic variants could influence the increased risk for both sporadic colon and rectal cancer. Our results confirm the partial results obtained by our team.21
A possible explanation for the association between colon and rectal cancer and the rapid NAT2 acetylator alleles refers to the fact that carriers of at least one negative allele are associated with an increased activity of NAT2. In this case, NAT2 transforms at a higher speed procarcinogens such as N‐hydroxylated heterocyclic amines present in the colon into carcinogenic compounds, which could predispose individuals to colon or rectal cancer.37
There is a discordance between the results presented by various studies regarding the relationship between NAT2 variants and colorectal cancer, many results depending on the exposure to associated toxic environmental factors: fried red meat, alcohol consumption, or smoking.15, 28, 38 Such studies carried out by Tamer et al.32 show a 3.03 risk in the case of the presence of the rapid acetylator alleles in patients with a protein‐rich diet. Also, the study conducted by Hou et al.39 revealed the interaction between NAT2 genotypes and environmental exposure such as alcohol consumption as a risk factor for different carcinomas. Lilla et al.27 showed that smokers carriers of the NAT2 fast acetylators have 2.6 increased risk to develop colorectal cancer. Regarding tobacco use, our results confirmed that it remained a significant risk factor for colon cancer after adjusting for each of gene polymorphism (with estimated values for adjusted OR comprised between 3.81 and 5.25).
Slattery et al.35 revealed that patients <55 years old whose diet included higher amount of fried red meat and carriers of the NAT2 rapid acetylator phenotypes had 4.7‐fold increased risk to develop colon cancer. The risk is also increased in older patients but the results were not statistically significant. Influence of the diet rich in red meat intake and NAT2 rapid acetylator phenotypes on colon cancer was supported by the study of Willet et al. (1990) and Giovannucci et al. (1994).40, 41 The results obtained in this study show that even in the presence of selected gene polymorphisms, fried red meat intake was associated with an significant increased risk for colon and rectal cancer (estimated values for adjusted OR comprised between 2.28 and 2.51 for colon cancer and 7.51 and 8.62 for rectal cancer.
Lilla et al.27 also investigated the effect of the NAT2 acetylator phenotypes on rectal cancer risk in association with tobacco smoke. Although we observed an association between tobacco use and presence of rectal cancer in our sample, there was no enough evidence to highlight tobacco use as an significant risk factor for rectal cancer in population of interest. Regarding rectal cancer, a higher risk was found in smokers with the NAT2 rapid acetylator alleles, but the results were without statistical significance. So, in rectal cancer the risk is increased in association with rapid acetylator alleles even in the absence of smoking as an environmental risk factor. Our results confirm the results obtained by Lilla et al. (2006) and Shin et al. (2008).27, 42
Differentiated analysis depending on the location of the tumor process shows that the risk for colon and rectal cancer is increased in drinkers carrying the rapid acetylator alleles for all five NAT2 variants.
However, our results regarding the effect of the NAT2 phenotypes associated with environmental exposures on colon and rectal cancer should be interpreted with caution because of the relatively small number of patients with colon and rectal cancer included in the study. At the same time, our results were different from other studies because of the different ethnic, geographic, and dietary differences among populations. A diet based on fried red meat is a specific diet for population who live in Nord of Transylvania.
A possible explanation of the association between fried red meat consumption and sporadic colon and rectal cancer is that during the preparation of the meat by prolonged frying, carcinogenic chemical compounds such as heterocyclic aromatic amines (HAA) and polycyclic aromatic hydrocarbons (PAH) are formed, suggesting the fact that the way in which the meat is prepared by exposure to high temperatures favors the production of these carcinogens.6 These HAA and PAH such as PhIP (2‐amino‐1‐methyl‐6‐phenylimidazol[4,5‐b] pyridine) are also present in tobacco smoke and represent the substrate for NAT2 activity implicated in colorectal carcinogenesis. In addition, there are studies certifying the presence of an increased NAT2 acetylation activity in colon tumors, which suggests the association between the NAT2 rapid acetylators and colorectal carcinoma.43 Our results confirm this hypothesis.
5. Conclusions
The results obtained suggest that the genetic variants located in the NAT2 gene (NAT2*5C‐T341C, NAT2*6B‐G590A, NAT2*7B‐G857A, NAT2*18‐A845C, and NAT2*5A‐C481T), which is involved in the metabolism of dietary carcinogens, can influence the risk of sporadic colon and rectal cancer. The consumption of a higher amount of fried red meat, alcohol and tobacco use considerably increase the risk of sporadic colon and rectal cancer in the case of rapid acetylators for the NAT2 variants, which supports the presence of an interaction between environmental factors and genetic factors in the modulation of risk for colorectal cancer.
Acknowledgments
We are grateful to Prof. Sue Povey, MD, FMedSci, at the Research Department of Genetics, Evolution and Environment, University College London, for all support and suggestions during NAT2 sequencing analysis. We also thank Mrs. Denisa Marineanu for English expertise during manuscript preparation.
Funding Information
This work was supported by the Romanian Ministry of Education and Research [grant VIASAN number 363, 2004].
References
- 1. Hutter CM, Chang‐Claude J, Slattery ML, et al. Characterization of gene‐environment interactions for colorectal cancer susceptibility loci. Cancer Res. 2012;72:2036–2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. de Kok TM, van Maanen JM. Evaluation of fecal mutagenicity and colorectal cancer risk. Mutat Res. 2000;463:53–101. [DOI] [PubMed] [Google Scholar]
- 3. Alexander DD, Weed DL, Cushing CA, Lowe KA. Meta‐analysis of prospective studies of red meat consumption and colorectal cancer. Eur J Cancer Prev. 2011;20:293–307. [DOI] [PubMed] [Google Scholar]
- 4. Wang J, Joshi AD, Corral R, et al. Carcinogenmetabolism genes, red meat and poultry intake, and colorectal cancer risk. Int J Cancer. 2012;130:1898–1907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Williams CD, Satia JA, Adair LS, et al. Associations of red meat, fat, and protein intake with distal colorectal cancer risk. Nutr Cancer. 2010;62:701–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Huxley RR, Ansary‐Moghaddam A, Clifton P, Czernichow S, Parr CL, Woodward M. The impact of dietary and lifestyle risk factors on risk of colorectal cancer: a quantitative overview of the epidemiological evidence. Int J Cancer. 2009;125:171–180. [DOI] [PubMed] [Google Scholar]
- 7. Chan DS, Lau R, Aune D, et al. Red and processed meat and colorectal cancer incidence: meta‐analysis of prospective studies. PLoS ONE. 2011;6:e20456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Cross AJ, Ferrucci LM, Risch A, et al. A large prospective study of meat consumption and colorectal cancer risk: an investigation of potential mechanisms underlying this association. Cancer Res. 2010;70:2406–2414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Liu J, Ding D, Wang X, et al. N‐acetyltransferase polymorphism and risk of colorectal adenoma and cancer: a pooled analysis of variations from 59 studies. PLoS ONE. 2012;7:e42797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Windmill KF, Gaedigk A, Hall PM, Samaratunga H, Grant DM, McManus ME. Localization of N‐acetyltransferases NAT1 and NAT2 in human tissues. Toxicol Sci. 2000;54:19–29. [DOI] [PubMed] [Google Scholar]
- 11. Pande JN, Pande A, Singh SP. Acetylator status, drug metabolism and disease. Natl Med J India. 2003;16:24–26. [PubMed] [Google Scholar]
- 12. Santarelli RL, Pierre F, Corpet DE. Processed meat and colorectal cancer: a review of epidemiologic and experimental evidence. Nutr Cancer. 2008;60:131–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Walker K, Ginsberg G, Hattis D, Johns DO, Guyton KZ, Sonawane B. Genetic polymorphism in N‐Acetyltransferase (NAT): population distribution of NAT1 and NAT2 activity. J Toxicol Environ Health B Crit Rev. 2009;12:440–472. [DOI] [PubMed] [Google Scholar]
- 14. Andersen V, Hols R, Vogel U. Systematic review: diet–gene interactions and the risk of colorectal cancer. Aliment Pharmacol Ther. 2013;37:383–391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Sørensen M, Autrup H, Olsen A, Tjønneland A, Overvad K, Raaschou‐Nielsen O. Prospective study of NAT1 and NAT2 polymorphisms, tobacco smoking and meat consumption and risk of colorectal cancer. Cancer Lett. 2008;266:186–193. [DOI] [PubMed] [Google Scholar]
- 16. Yoshida K, Osawa K, Kasahara M, et al. Association of CYP1A1, CYP1A2, GSTM1 and NAT2 gene polymorphisms with colorectal cancer and smoking. Asian Pac J Cancer Prev. 2007;8:438–444. [PubMed] [Google Scholar]
- 17. Shin A, Kim J. Effect modification of meat intake by genetic polymorphisms on colorectal neoplasia susceptibility. Asian Pac J Cancer Prev. 2010;11:281–287. [PubMed] [Google Scholar]
- 18. Nothlings U, Yamamoto JF, Wilkens LR, et al. Meat and heterocyclic amine intake, smoking, NAT1 and NAT2 polymorphisms, and colorectal cancer risk in the multiethnic cohort study. Cancer Epidemiol Biomarkers Prev. 2009;18:2098–2106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Osian G, Procopciuc L, Vlad L. NAT2 gene polymorphism and sporadic colorectal cancer. Prevalence, tumor stage and prognosis. A preeeliminary studddy in 70 patients. J Gastrointestin Liver Dis. 2006;15:347–353. [PubMed] [Google Scholar]
- 20. Nowell SA, Ahn J, Ambrosone CB. Gene‐nutrient interactions in cancer etiology. Nutr Rev. 2004;62:427–438. [DOI] [PubMed] [Google Scholar]
- 21. Osian G, Procopciuc L, Vlad L, et al. NAT2. Polymorphisms and sporadic colorectal cancer survival. J Gastrointestin Liver Dis. 2010;19:361–368. [PubMed] [Google Scholar]
- 22. Gunter MJ, Probst‐Hensch NM, Cortessis VK, Kulldorff M, Haile RW, Sinha R. Meat intake, cooking‐related mutagens and risk of colorectal adenoma in a sigmoidoscopy‐based case‐control study. Carcinogenesis. 2005;26:637–642. [DOI] [PubMed] [Google Scholar]
- 23. Sinha R, Peters U, Cross AJ, et al. Meat, meat cooking methods and preservation, and risk for colorectal adenoma. Cancer Res. 2005;65:8034–8041. [DOI] [PubMed] [Google Scholar]
- 24. Mathew A, Sinha R, Burt R, et al. Meat intake and the recurrence of colorectal adenomas. Eur J Cancer Prev. 2004;13:159–164. [DOI] [PubMed] [Google Scholar]
- 25. Robertson DJ, Sandler RS, Haile R, et al. Fat, fiber, meat and the risk of colorectal adenomas. Am J Gastroenterol. 2005;100:2789–2795. [DOI] [PubMed] [Google Scholar]
- 26. Ishibe N, Sinha R, Hein DW, et al. Genetic polymorphisms in heterocyclic amine metabolism and risk of colorectal adenomas. Pharmacogenetics. 2002;12:145–150. [DOI] [PubMed] [Google Scholar]
- 27. Lilla C, Verla‐Tebit E, Risch A, et al. Effect of NAT1 and NAT2 genetic polymorphisms on colorectal cancer risk associated with exposure to tobacco smoke and meat consumption. Cancer Epidemiol Biomarkers Prev. 2006;15:99–107. [DOI] [PubMed] [Google Scholar]
- 28. Wang H, Yamamoto JF, Caberto C, et al. Genetic variation in the bioactivation pathway for polycyclic hydrocarbons and heterocyclic amines in relation to risk of colorectal neoplasia. Carcinogenesis. 2011;32:203–209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Slattery ML, Potter JD, Samowitz W, Bigler J, Caan B, Leppert M. NAT2, GSTM‐1, cigarette smoking, and risk of colon cancer. Cancer Epidemiol Biomarkers Prev. 1998;7:1079–1084. [PubMed] [Google Scholar]
- 30. Ashwin N, Ananthakrishnan NA, Mengmeng D, et al. Red meat intake, NAT2, and risk of colorectal cancer: a pooled analysis of 11 studies. Cancer Epidemiol Biomarkers Prev. 2015;24:198–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Frazier M, O'Donnell FT, Kong S. Age‐associated risk of cancer among individuals with N‐acetyltransferase 2 (NAT2) mutations and mutations in DNA mismatch repair genes. Cancer Res. 2001;61:1269–1271. [PubMed] [Google Scholar]
- 32. Tamer L, Ercan B, Ateş NA, et al. N‐acetyltransferase 2 gene polymorphism in patients with colorectal carcinoma. Cell Biochem Funct. 2006;24:131–135. [DOI] [PubMed] [Google Scholar]
- 33. Kiss I, Nemeth A, Bogner B. Polymorphiama of glutathione‐S‐transferase and arylamine N‐acetyltransferase enzymes and susceptibility to colorectal cancer. Anticancer Res. 2004;24:3965–3970. [PubMed] [Google Scholar]
- 34. Tiemersma EW, Kampman E, Bueno de Mesquita HB. Meat consumption, cigarette smoking, and genetic susceptibility in the etiology of colorectal cancer: results from a Dutch prospective study. Cancer Causes Control. 2002;13:383–393. [DOI] [PubMed] [Google Scholar]
- 35. Slattery ML, Potter JD, Ma KN, Caan BJ, Leppert M, Samowitz W. Western diet, family history of colorectal cancer, NAT2, GSTM‐1 and risk of colon cancer. Cancer Causes Control. 2000;11:1–8. [DOI] [PubMed] [Google Scholar]
- 36. Brockton N, Little J, Sharp L, Cotton SC. N‐Acetyltransferase polymorphisms and colorectal cancer: a HuGE review. Am J Epidemiol. 2000;151:846–861. [DOI] [PubMed] [Google Scholar]
- 37. Ambrosone CB, Abrams SM, Gorlewska‐Roberts K, Kadlubar FF. Hair dye use, meat intake, and tobacco exposure and presence of carcinogen‐DNA adducts in exfoliated breast ductal epithelial cells. Arch Biochem Biophys. 2007;464:169–175. [DOI] [PubMed] [Google Scholar]
- 38. da Silva TD, Felipe AV, de Lima JM, Oshima CT, Forones NM. N‐Acetyltransferase 2 genetic polymorphisms and risk of colorectal cancer. World J Gastroenterol. 2011;17:760–765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Hou YY, Ou HL, Chu ST, et al. NAT2 slow acetylation haplotypes are associated with the increased risk of betel quid–related oral and pharyngeal squamous cell carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2011;112:484–492. [DOI] [PubMed] [Google Scholar]
- 40. Willett WC, Stampfer MJ, Colditz GA, Rosner BA, Speizer FE. Relation of meat, fat, and ber intake to the risk of colon cancer in a prospective study among women. N Engl J Med. 1990;323:1664–1672. [DOI] [PubMed] [Google Scholar]
- 41. Giovannucci E, Rimm EB, Stampfer MJ, Colditz GA, Ascherio A, Willett WC. Intake of fat, meat, and fiber in relation to risk of colon cancer in men. Cancer Res. 1994;54:2390–2397. [PubMed] [Google Scholar]
- 42. Shin A, Shrubsole MJ, Rice JM, et al. Meat intake, heterocyclic amine exposure, and metabolizing enzyme polymorphisms in relation to colorectal polyp risk. Cancer Epidemiol Biomarkers Prev. 2008;17:320–329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Turesky RJ, Lang NP, Butler MA, et al. Metabolic activation of carcinogenic heterocyclic aromatic amines by human liver and colon. Carcinogenesis. 1991;12:1839–1845. [DOI] [PubMed] [Google Scholar]