Abstract
Background
Single nucleotide polymorphisms (SNPs) accumulated in the mitochondrial DNA (mtDNA) is susceptible to the tumor formation. We discovered previously that SNPs in the mitochondrial displacement loop (D‐loop) was associated with the risk of hepatocellular carcinoma (HCC).
Methods
The cytochrome c oxidase (COX) genes of mtDNA were sequenced between 107 HCC patients and 100 matched healthy controls. The χ2 test was used to analyze single SNPs’ statistical difference between HCC patients and healthy controls.
Results
In this study, cancer risk‐associated SNPs in the COX genes of mtDNA coding region were assessed in HCC patients and health controls. The nucleotide position at site 9545A/G (P=.036) was identified its association for HCC with the 9545G allele susceptible to cancer risk.
Conclusions
The SNPs in the COX genes may help us to evaluate the cancer risk of HCC.
Keywords: cytochrome c oxidase genes, hepatocellular carcinoma, mitochondrial DNA, single nucleotide polymorphisms
1. INTRODUCTION
Hepatocellular carcinoma (HCC) is the fifth most frequent cancer and is responsible for more than half a million deaths each year, which makes it the third leading cause of cancer deaths worldwide.1 In China, the incidence of HCC is increasing and now accounts for 55% of all HCC cases in the world.2, 3 This disease is strongly associated with several risk factors, including chronic hepatitis B virus (HBV), chronic hepatitis C virus (HCV) infection, and alcohol abuse.4 HBV infection is a challenging health issue in China, where about 93 million peoples are HBV carries and 30 million have chronic B hepatitis.5 Alcohol abuse is also on the rise in China with about 6.6% of males and 0.1% of females diagnosed with alcohol dependence.6 Many of these patients develop liver disease such as alcoholic hepatitis and cirrhosis thereby to subsequent carcinogenesis.
The human mitochondrial genome is a 16‐kb closed circular duplex molecule that contains 37 genes, including two ribosomal RNAs and a complete set of 22 tRNAs. Because of its lack of the protection of histone protein, inefficient repaired mechanism, and generation of reactive oxygen species (ROS), mtDNA has high susceptibility to mutations and polymorphisms.7, 8, 9
Oxygen species production could cause oxidative damage that lead to mutations and polymorphisms in the mitochondrial genes as well as affect the process of oxidative phosphorylation (OXPHOS), which might ultimately initiate carcinogenesis.7, 10, 11, 12, 13 However, the mechanism of dysfunction of OXPHOS in HCC remains unclear. It is reported that abnormal level of ROS could induce HCC by affecting the process of oxidative phosphorylation (OXPHOS) and downregulation of the tumor suppressor genes in vitro.14
We found that the highly polymorphic sequence in D‐loop that might be related to the breast cancer risk, esophageal squamous cell carcinoma, non‐Hodgkin lymphoma, kidney cancer, and lung cancer.15, 16, 17, 18, 19, 20 But few studies focused on the relationships between coding region of mtDNA and HCC. COX genes codes three subunits of respiratory complex IV, a key enzyme as the third and final enzyme of the electron transport chain of mitochondrial oxidative phosphorylation in aerobic metabolism.21 Gene polymorphisms of COX genes (including COXI, COXII, and COXIII) contributed to the dysfunction of mitochondrial respiratory function and associated with susceptibility of prostate cancer.22 In this study, we sequenced a region of approximately 3010 bp flanking the majority of the COX genes (including COXI, COXII, and COXIII) in mtDNA coding region from the blood DNA of HCC patients to identify cancer risk‐associated single nucleotide polymorphisms (SNPs).
2. MATERIALS AND METHODS
2.1. Tissue specimens and DNA extraction
Blood samples were collected at the Fourth hospital of Hebei Medical University including 107 patients with HCC who underwent tumor resection in the Department of Hepatobiliary Surgery between Feb 2008 and Dec 2009. Blood samples were also collected from 100 healthy controls. mtDNA extraction was carried out by using the TIANamo Genomic DNAki (TIANGEN, Beijing, China). All procedures were supervised and approved by the hospital's Human Tissue Research Committee. All patients provided written informed consent for the collection of samples and subsequent analysis.
2.2. Sequencing the mtDNA COXI, COX II, and COX III genes
The primer pairs used to amplify the COXI (5530~6050 bps), COXI (6040~6530 bps), COXI (6550~7130 bps), COXII (7120~7600 bps), COXII (7640~8180 bps), COXII (8200~8770 bps), COXIII (8870~9320 bps), COXIII (9320~9810 bps), and COXIII (9640~10090 bps) genes were listed in Table 1, PCR was performed with the PCR Green Master Mix (Thermo, Billerica, MA, USA) and PCR production was purified prior to sequencing. Cycle sequencing was carried out with the Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and separated using the ABI PRISM Genetic Analyzer 3100 (Applied Biosystems).
Table 1.
Primer pairs used to amplify the COX region
| Gene ID | Forward primer Reverse primer |
|---|---|
| COX1 (5530‐6050) | 5ˊ‐GCTACTCCTACCTATCTCCC ‐3ˊ |
| 5ˊ‐ TGTGGTCGTTACCTAGAAGG‐3ˊ | |
| COX1 (6040‐6530) | 5ˊ‐ CTATTATTCGGCGCATGAGC ‐3ˊ |
| 5ˊ‐ TTGAGGTTGCGGTCTGTTAG ‐3ˊ | |
| COX1 (6550‐7130) | 5ˊ‐ CCTATCTCTCCCAGTCCTAG ‐3ˊ |
| 5ˊ‐ GGATTTTGGCGTAGGTTTGG ‐3ˊ | |
| COX2 (7120‐7600) | 5ˊ‐ GCCATCATAGGAGGCTTCAT‐3ˊ |
| 5ˊ‐ AGACCTACTTGCGCTGCATG ‐3ˊ | |
| COX2 (7640‐8180) | 5ˊ‐ ACATGCAGCGCAAGTAGGTC‐3ˊ |
| 5ˊ‐ AACTGTGGTTTGCTCCACAG ‐3ˊ | |
| COX2 (8200‐8770) | 5ˊ‐ CACTTTCACCGCTACACGAC ‐3ˊ |
| 5ˊ‐ TCCGAGGAGGTTAGTTGTGG ‐3ˊ | |
| COX3 (8870‐9320) | 5ˊ‐ CCACAACTAACCTAATCGGA‐3ˊ |
| 5ˊ‐ AGCGTTATGGAGTGGAAGTG ‐3ˊ | |
| COX3 (9320‐9810) | 5ˊ‐ TCTCAGCCCTCCTAATGACC‐3ˊ |
| 5ˊ‐ TGACGTGAAGTCCGTGGAAG ‐3ˊ | |
| COX3 (9640‐10090) | 5ˊ‐GTCCCACTCCTAAACACATC ‐3ˊ |
| 5ˊ‐GTAAGGCTAGGAGGGTGTTG ‐3ˊ |
2.3. Statistical analysis
The χ2 test (P value of < .05 was considered statistically significant) was used to analyze single SNPs’ statistical difference between different groups, such as the presence or absence of an individual SNP between HCC patients and healthy controls. Two groups Kruskal‐Wallis H test (P value of <.0126 was considered statistically significant) was used to compare SNPs frequency (ratio between number of SNPs per person and the length of target genes) and assisted by Nemenyi grammar to do the comparison among groups. All of the statistical analysis was done with the SPSS version21 software package (SPSS Company, Chicago, IL, USA).
3. RESULTS
A total of 107 HCC patients were enrolled in this study. The clinical characteristics of the HCC patients and healthy controls are listed in Table 2, the age and gender showed no statistical difference between the HCC and healthy control.
Table 2.
The age and gender of HCC and controls
| Group | HCC cancer (n=107)a | Control (n=100) | t/χ2 | P‐value |
|---|---|---|---|---|
| Age (y) | 54.860±9.767 b | 56.360±10.437 | −1.068 | .287 |
| Gender (M/F) | 94/13 | 91/9 | 0.540 | .463 |
Sample size.
Mean±standard deviation.
We firstly analyzed mitochondrial COXI (nucleotide 5904~7445), COXII (nucleotide 7586~8269), COXIII (nucleotide 9207~9990) sequences in 30 HCC and healthy controls. A total of eight SNPs were identified in the COX coding region (Table 3). Kruskal‐Wallis H test assisted by Nemenyi grammar was used to evaluate SNPs frequency in different groups (the sum of SNPs per person/length of target genes). Higher SNPs frequency was found in the HCC comparing with that of normal controls. A tendency toward an increased SNP frequency was observed in HCC patients, but did not reach statistical significance (Data not shown).
Table 3.
The associations of the eight SNPs with HCC risk
| SNP | Genetype | Number (HCC) | Number (Control) | χ2 | P (value) |
|---|---|---|---|---|---|
| (6962) | G/G | 28 | 30 | 2.069 | .492 |
| A/A | 2 | 0 | |||
| (7196) | C/C | 25 | 27 | 0.577 | .706 |
| A/A | 5 | 3 | |||
| (7853) | G/G | 28 | 29 | 0.351 | 1.000 |
| A/A | 2 | 1 | |||
| (8414) | C/C | 26 | 27 | 0.162 | 1.000 |
| T/T | 4 | 3 | |||
| (8584) | G/G | 23 | 29 | 5.192 | .052 |
| A/A | 7 | 1 | |||
| (8701) | A/A | 15 | 12 | 0.606 | .436 |
| G/G | 15 | 18 | |||
| (9540) | T/T | 13 | 13 | 0.000 | 1.000 |
| C/C | 17 | 17 | |||
| (9545) | A/A | 26 | 30 | 4.286 | .112 |
| G/G | 4 | 0 |
The P value of two sites (8584G/A P=.052, 9545A/G P=.112) was found near to the P value of .05 by a case‐control study with HCC patients and controls using χ2 test, so we genotyped the two sites in more patients and controls (Table 4). As shown in Table 4, the 9545 nucleotide was identified for its association with HCC risk with G allele susceptible to cancinogenesis. These data demonstrated that 9545 allele was responsible for HCC susceptibility.
Table 4.
SNP site showing frequency difference between HCC and controls
| SNP | Genetype | HCC (n=107) a | Control (n=100) | χ2 | P‐value |
|---|---|---|---|---|---|
| 9545 | A/A | 99 | 99 | 5.214 | .036 |
| G/G | 8 | 1 | |||
| 8584 | G/G | 88 | 82 | 0.002 | .962 |
| A/A | 19 | 18 |
Sample size.
4. DISCUSSION
The relationships between mitochondrial DNA variation and oncogenesis were demonstrated in many kinds of tumor.23, 24, 25, 26 We previously focused on the role of mitochondrial D‐loop variation in tumor development.27, 28 In this study, we sequenced the whole COXI, COXII, and COXIII genes in the coding region of mitochondiral DNA and identified the association of 9545 nucleotide with HCC risk by χ2 analysis.
At the evolution process, more somatic mutation occurred in mtDNA that was transferred to daughter cells as SNP, an increased proliferation rate of tumor cells and an decreased apoptotic ability of tumor cells might give rise to accumulation of mutations and polymorphisms,13 the higher SNPs frequency accumulations might influence the mitochondrial function. Consisted with our results, the higher SNP frequency in the mitochondrial COX gene was found in prostate cancer and pilocytic astrocytoma,22, 29, 30 which may induce increased ROS level and subsequent impaired OXPHOS. The decreased aerobic respiration in cancer cell cloud induces the abnormal mitochondrial function so as to initiate carcinogenesis.12 A study on colon cancer also showed that decreased expression of cytochrome c oxidase subunit I, which was coded by COXI gene, was significantly correlated with apoptosis resistance and increases the level of ROS.31 The amino acid substituted somatic mutation which have potential to cause mitochondrial dysfunction was found in the HCC patients, the COXIII could colocalize with HBx to upregulate the mitochondrial function and HBx‐induced ROS generation thereby to initiate the oncogenesis of HBV‐associated HCC.32, 33
Polymorphisms in mtDNA coding region have recently been reported being association with human cancer.29, 31 One cancer risk‐related SNP 9545A/G was found in HCC patients, however, it is a silent variant (9545A/G) which meant that it did not induce amino acid substitution. The site might effect tRNA or other cotranscription genes to modulate the function of mitochondria so as to contributed to the tumor occurrence and development. So the functional study of this site needs to be performed. The genes variation linked to the different haplotype that was divided by 9545 SNP also need further analysis.
In conclusion, analysis of the genetic polymorphisms in the mitochondrial coding region (COXI, COXII, and COXIII) may help identify patients at a higher risk for developing HCC. Further researches will be essential to clear and identify the role of these changes.
CONFLICTS OF INTEREST
All authors disclose any financial, consulting, and personal relationships with other people or organizations that could influence their work.
ACKNOWLEDGMENTS
This work was supported by Key basic research program of Hebei (15277706D).
Wang H, Xu J, Li D, Zhang S, Guo Z. Identification of sequence polymorphisms in the mitochondrial cytochrome c oxidase genes as risk factors for hepatocellular carcinoma. J Clin Lab Anal. 2018;32:e22299 10.1002/jcla.22299
Contributor Information
Shenglei Zhang, Email: lei06352511@126.com.
Zhanjun Guo, Email: zjguo5886@aiyun.com.
REFERENCES
- 1. Yong KJ, Chai L, Tenen DG. Oncofetal gene SALL4 in aggressive hepatocellular carcinoma. N Engl J Med. 2013;369:1171‐1172. [DOI] [PubMed] [Google Scholar]
- 2. Zhang SW, Zheng RS, Li N, et al. Analysis and prediction of liver cancer incidence in China. Zhonghua Yu Fang Yi Xue Za Zhi. 2012;46:587‐592. [PubMed] [Google Scholar]
- 3. McGuire S. World Cancer Report 2014. Geneva, Switzerland: world Health Organization, International Agency for Research on Cancer, WHO Press, 2015. Adv Nutr. 2016;7:418‐419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Su L, Zhou T, Zhang Z, et al. Optimal staging system for predicting the prognosis of patients with hepatocellular carcinoma in China: a retrospective study. BMC Cancer. 2016;16:424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Yao GB. Management of hepatitis B in China. J Med Virol. 2000;61:392‐397. [DOI] [PubMed] [Google Scholar]
- 6. Guo WJ, Xu XF, Lee S. More alcohol dependence than abuse in rural China. Addiction. 2009;104:2118‐2119. [DOI] [PubMed] [Google Scholar]
- 7. Chatterjee A, Dasgupta S, Sidransky D. Mitochondrial subversion in cancer. Cancer Prev Res (Phila). 2011;4:638‐654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Maynard S, Schurman SH, Harboe C, de Souza‐Pinto NC, Bohr VA. Base excision repair of oxidative DNA damage and association with cancer and aging. Carcinogenesis. 2009;30:2‐10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Larsen NB, Rasmussen M, Rasmussen LJ. Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion. 2005;5:89‐108. [DOI] [PubMed] [Google Scholar]
- 10. Yadav N, Chandra D. Mitochondrial DNA mutations and breast tumorigenesis. Biochim Biophys Acta. 2013;1836:336‐344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Feeley KP, Bray AW, Westbrook DG, et al. Mitochondrial genetics regulate breast cancer tumorigenicity and metastatic potential. Cancer Res. 2015;75:4429‐4436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Warburg O. On the origin of cancer cells. Science. 1956;123:309‐314. [DOI] [PubMed] [Google Scholar]
- 13. Polyak K, Li Y, Zhu H, et al. Somatic mutations of the mitochondrial genome in human colorectal tumours. Nat Genet. 1998;20:291‐293. [DOI] [PubMed] [Google Scholar]
- 14. Shen YC, Ou DL, Hsu C, et al. Activating oxidative phosphorylation by a pyruvate dehydrogenase kinase inhibitor overcomes sorafenib resistance of hepatocellular carcinoma. Br J Cancer. 2013;108:72‐81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Bai Y, Guo Z, Xu J, et al. The 9‐bp deletion at position 8272 in region V of mitochondrial DNA is associated with renal cell carcinoma outcome. Mitochondrial DNA A DNA Mapp Seq Anal. 2016;27:1973‐1975. [DOI] [PubMed] [Google Scholar]
- 16. Xu J, Guo Z, Zhang J, Cui L, Zhang S, Bai Y. Single nucleotide polymorphisms in the mitochondrial displacement loop and age‐at‐onset of renal cell carcinoma. Sci Rep. 2013;3:2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Cheng M, Guo Z, Li H, Li Z, Li C, Geng C. Identification of sequence polymorphisms in the mitochondrial displacement loop as risk factors for sporadic and familial breast cancer. Tumor Biol. 2014;35:4773‐4777. [DOI] [PubMed] [Google Scholar]
- 18. Zhang R, Wang R, Zhang F, et al. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma. J Exp Clin Cancer Res. 2010;29:155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Fan H, Wang C, Guo Z. Single nucleotide polymorphisms in the mitochondrial displacement loop and age at onset of non‐Hodgkin lymphoma. Onco Targets Ther. 2013;6:1041‐1045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Ding C, Li R, Wang P, Fan H, Guo Z. Sequence polymorphisms of the mitochondrial displacement loop and outcome of non‐small cell lung cancer. Exp Ther Med. 2012;3:861‐864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Zhang YM, Gu QH, Huang J, et al. Clinical significance of IgM and C3 glomerular deposition in primary focal segmental glomerulosclerosis. Clin J Am Soc Nephrol. 2016;11:1582‐1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ray AM, Zuhlke KA, Levin AM, Douglas JA, Cooney KA, Petros JA. Sequence variation in the mitochondrial gene cytochrome c oxidase subunit I and prostate cancer in African American men. Prostate. 2009;69:956‐960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Jeronimo C, Nomoto S, Caballero OL, et al. Mitochondrial mutations in early stage prostate cancer and bodily fluids. Oncogene. 2001;20:5195‐5198. [DOI] [PubMed] [Google Scholar]
- 24. Dasgupta S, Hoque MO, Upadhyay S, Sidransky D. Mitochondrial cytochrome B gene mutation promotes tumor growth in bladder cancer. Cancer Res. 2008;68:700‐706. [DOI] [PubMed] [Google Scholar]
- 25. Bonner MR, Shen M, Liu CS, Divita M, He X, Lan Q. Mitochondrial DNA content and lung cancer risk in Xuan Wei, China. Lung Cancer. 2009;63:331‐334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Carew JS, Huang P. Mitochondrial defects in cancer. Mol Cancer. 2002;1:9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Wang C, Zhang F, Fan H, et al. Sequence polymorphisms of mitochondrial D‐loop and hepatocellular carcinoma outcome. Biochem Biophys Res Comm. 2011;406:493‐496. [DOI] [PubMed] [Google Scholar]
- 28. Zhang R, Zhang F, Wang C, Wang S, Shiao Y‐H, Guo Z. Identification of sequence polymorphism in the D‐Loop region of mitochondrial DNA as a risk factor for hepatocellular carcinoma with distinct etiology. J Exp Clin Cancer Res. 2010;29:130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Scott TA, Arnold R, Petros JA. Mitochondrial cytochrome c oxidase subunit 1 sequence variation in prostate cancer. Scientifica (Cairo). 2012;2012:701810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Lueth M, Wronski L, Giese A, et al. Somatic mitochondrial mutations in pilocytic astrocytoma. Cancer Genet Cytogenet. 2009;192:30‐35. [DOI] [PubMed] [Google Scholar]
- 31. Payne CM, Holubec H, Bernstein C, et al. Crypt‐restricted loss and decreased protein expression of cytochrome C oxidase subunit I as potential hypothesis‐driven biomarkers of colon cancer risk. Cancer Epidemiol Biomarkers Prev. 2005;14:2066‐2075. [DOI] [PubMed] [Google Scholar]
- 32. Zou LY, Zheng BY, Fang XF, et al. HBx co‐localizes with COXIII in HL‐7702 cells to upregulate mitochondrial function and ROS generation. Oncol Rep. 2015;33:2461‐2467. [DOI] [PubMed] [Google Scholar]
- 33. Yin PH, Wu CC, Lin JC, Chi CW, Wei YH, Lee HC. Somatic mutations of mitochondrial genome in hepatocellular carcinoma. Mitochondrion. 2010;10:174‐182. [DOI] [PubMed] [Google Scholar]