The first case of congenital blood chimerism in two of the triplets in Korea

Abstract

Background

Chimeras are composed of two or more different populations that originated from different zygotes. Blood chimerism arising from twins have been reported in the literature. Herein, we report the first blood group chimerism in triplets.

Methods

ABO blood grouping was carried out by manual tile methods (Merck Millipore, UK) and micro‐column agglutination method (Bio‐Rad, Cressier sur Morat, Switzerland). Flow cytometric analysis was performed with Anti‐A‐PE conjugated monoclonal antibodies (BD Biosciences, San Jose, CA, USA) and FACS Canto II (BD Biosciences). Molecular analysis was performed with allele‐specific polymerase chain reaction (AS‐PCR) and direct sequencing of the exons 6 and 7.

Results

Mixed‐field agglutination and weak agglutination against anti‐A were revealed by ABO blood grouping. Flow cytometric analysis revealed the presence of both A cells and O cells. AS‐PCR and sequencing showed two neonates with chimerism, with each neonate`s genotype being A102/O01/O02.

Conclusion

This is the first recorded case of blood chimera from a triplet in Korea. We recommend full investigation of blood group chimerism in neonates with ABO discrepancy, as blood chimerism is subject to certain caution in the clinical environment.

1. INTRODUCTION

Chimeras are defined as individuals with cells are derived from two or more zygotes. While blood chimerism was usually an issue of detecting engraftment in hematopoietic stem cell transplantation,1 recent advances in artificial fertilization have resulted in increased detection of congenital blood chimerism.2 Congenital blood chimerism arises from the exchange of hematopoietic cells through communicating blood vessels between multiple births.3 As the rise in multiple pregnancies has been attributed to the increase in in vitro fertilization pre‐embryo transfer and ovulation‐inducing drugs, there has been an increase in the reported cases of blood chimerism in twins in Korea.4 Congenital blood chimerism is of immunologic interest, as it sheds light on mechanisms of immune tolerance. Furthermore, it is of clinical importance, as it is a cause of ABO blood grouping discrepancy,5 and an issue in enrolling as donors in blood donation.6

Chimerism of three different cell lines can also be theoretically possible. This would make diagnosis more complicated compared to chimerism from two different cell lines. Herein, we report the first blood group chimerism in triplets by demonstrating the presence of two populations of blood cells (both A and O blood type), with three different ABO blood group alleles and display our methods in making this diagnosis.

2. MATERIALS AND METHODS

2.1. ABO/D grouping

The samples of newborn dizygotic dichorionic triamniotic triplets were assessed for ABO/D grouping. ABO blood grouping was carried out using manual tile method using anti‐A, ‐B, ‐ AB antisera (Merck Millipore, UK) along with the micro‐column agglutination technique (Bio‐Rad, Cressier sur Morat, Switzerland). The process in ABO grouping can be referred to our previous study,7 regarding the use of tile methods for detecting mixed‐field agglutination.

2.2. Flow cytometric analysis

We used tubes with 1% paraformaldehyde and used control O cells, control A1 cells and the neonate`s cells in diluted concentrations of 10⁷ cells/mL. Each diluted specimen was placed in a new tube with quantities of 50 μL each and incubated 20 minutes with 2 μL of anti‐A‐PE conjugated monoclonal antibodies (BD Biosciences, San Jose, CA, USA). Flow cytometry analysis was performed with FACS Canto II (BD Biosciences). A minimal of 10 000 events were collected for analysis. Gating was performed with Caluza software version 1.4 (Beckman Coulter, Brea, CA, USA).

2.3. Molecular analysis

DNA samples were collected from whole blood from EDTA tubes. DNA was extracted with Wizard Genomic DNA purification kits (Promega, Madison, WI, USA). Allele‐specific polymerase chain reaction (AS‐PCR) was carried out with forward primers targeted to have its 3’ end at the position NM_020469.2:c.261 for discrimination of O and the other two major alleles (A and B). Forward primers were comprised of two sets; detection of O allele was carried out with 5′‐GTGTAGGAAGGATGTCCTCGTGGC‐3′, and detection of non‐O alleles with 5′‐GTGTAGGAAGGATGTCCTCGTGGC‐3′. Reverse primers were designed to target at NM_202469.2:c.803, for discrimination of A and B alleles. Reverse primers were designed according to a study by Fukumori and colleagues; primers GA13R and GA14R, were used, each for detection of B and A alleles, respectively.8 Amplified products were purified with Quaquick gel extraction kits (Quagen, Hilden, Germany) and sequenced by chain termination method with identical primers described above. Sequencing was performed with Big dye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and analyzed with ABI PRISM 310 Genetic Analyser (Applied Biosystems). ABO typing was carried out with manual analysis by the software Sequencher version 5.0 (Gene Codes, Ann Arbor, MI, USA). Genotyping nomenclature was performed according to databases BGMUT9 and Erythrogene.10 Overall methods are similar to methods applied in our previously published methods.11

3. RESULTS AND DISCUSSION

Mixed‐field agglutination and weak agglutination against anti‐A were revealed by both methods, manual tile method and micro‐column agglutination technique (Figure 1, upper figures), in two neonates of the triplets. Flow cytometric results revealed the presence of both O cells and A cells (Figure 1, lower). In Allele‐specific polymerase chain reaction (AS‐PCR) revealed that the presence of A and O alleles, and with further sequencing with the product of O specific PCR, we found that both O01 and O02 were present. This was the same case in both neonates. The sequencing result on the A allele product showed that it was A102. Familial study of the remaining members was performed, and overall results showed that the two neonates with chimerism were A102/O01/O02, while the third neonate was O01/O01 and the father A102/O01, the mother O01/O02 (Figure 2).

Figure 1.

Expression of A antigen on red cells by (upper) column agglutination technique and (lower) flow cytometry

Figure 2.

Allele‐specific PCR and direct sequencing results

We have observed an interesting case of chimerism from triplets. The most common way of triplets to be congested is from a polyzygotic pregnancy of three eggs. However, this case presented triplets that include an identical (monozygotic) pair of siblings with a fraternal sibling are the result of a dizygotic pregnancy. The monozygotic twins of the triplets showed mixed‐field agglutination, and interestingly, the presence of all three ABO alleles carried by the parents.

This resulted in a rare case of mixed‐field agglutination, which is an important cause of ABO discrepancy. The causes of mixed‐field agglutination include ABO subgroups, artificially induced chimerism (ie, a blood group A individual who has received a transfusion of group O donor red cells, an ABO mismatched stem cell transplant) and true chimerism. Usually, weak reactivity by manual plate method and mixed‐field agglutination by micro‐column agglutination method are not rarely found in newborn’s sample. This is due to insufficient development of A and B antigens, and therefore the presence of subgroups or blood chimera during neonatal blood grouping is not always suggested.12 In cases of multiple gestations, work up to determine the cause of weak reactivity and mixed‐field agglutination is required. Discrimination of the A3 subgroup, blood chimerism, and healthy babies with weak expression of A antigen on RBCs from down regulation can be performed with flow cytometric methods, and in our case, unlike the adult A/O chimera, flow cytometric pattern of the neonatal A/O chimera mimicked that of the “A3” subgroup. A slightly weak expression of A antigen on RBCs was observed probably due to the fact that the A and B antigens are not fully developed in newborn infants. However, mean fluorescence intensity (MFI) of one population was similar with the MFI for O blood and much lower than MFI of A3 subgroup. Our genotyping results also showed an interesting finding; the presence of multiple O alleles in one neonate.

Twin chimera has been reported multiple times in the literature,13 and we now report the first case of blood chimera from a triplet. As assisted reproductive technology is becoming more popular, blood group chimerism in multiple births is to be dealt with alertness. Revealing chimera can have potential clinical benefits. It has been shown that microchimerism (<1% of donor cells) has beneficial effects on organ transplantation.14 Moreover, there was a case of acute hemolytic reaction after transfusion of a chimeric RBC unit.6 Thus, we emphasize that correct typing of such blood, and full investigation of blood group chimerism is of importance to the hospital blood bank, as it is expected to be more frequently encountered in routine practice.

Chung YN, Chun S, Phan M‐TT, et al. The first case of congenital blood chimerism in two of the triplets in Korea. J Clin Lab Anal. 2018;32:e22580 10.1002/jcla.22580