Abstract
Background
The aim of this study was to evaluate the modified Carba NP test to differentiate KPC (Klebsiella pneumoniae carbapenemase)‐ and MBL (metallo‐β‐lactamase)‐producing Klebsiella species.
Methods
A total of 508 non‐duplicate clinical isolates of Klebsiella spp. were processed by modified Carba NP and combined disc tests which were further confirmed by conventional polymerase chain reaction (PCR), a gold standard method for statistical analysis.
Results
Modified Carba NP test demonstrated 91.7% sensitivity, 100% specificity, 100% positive predictive value (PPV) and 99.8% negative predictive value (NPV) for KPC and 96.7%, 100%, 100%, and 99.5% for MBL detection, respectively.
Conclusion
The performance of modified Carba NP test was significantly better than combined disc test, fulfilling the requirement of simple and rapid test for clinical applications.
Keywords: carbapenemase, Klebsiella species, KPC, MBL, modified Carba NP
1. INTRODUCTION
Carbapenemases are β‐lactamase enzymes that render bacteria resistant to nearly all classes of antibiotics including carbapenem, a last‐resort antibiotic, posing an immense threat to public health.1 Carbapenemases have been classified as KPC carbapenemase (Ambler class A), metallo‐β‐lactamase (Ambler class B), and OXA carbapenemase (Ambler class D). Classes A & D enzymes have a serine‐based hydrolytic activity (hence also called serine carbapenemases), while class B enzymes require the presence of metal, i.e, zinc for their activity (thus known as metallo‐β‐lactamases).2, 3
In 2013, the US Center for Disease Control and Prevention (CDC) put three drug‐resistant superbugs in urgent category, namely carbapenem‐resistant Enterobacteriaceae (CRE), drug‐resistant Neisseria gonorrhoeae, and Clostridium difficile.4 In 2014, antimicrobial resistance: global report on surveillance, released by the World Health Organization (WHO) concluded that carbapenemase‐producing Klebsiella pneumoniae has spread to nearly all regions of the globe.5
Conventional methods for carbapenemase detection utilize either enzyme inhibitors (combined disc test, disc synergy test)6, 7 or chromogenic substance (chrome agar culture media), which are time‐consuming and expensive, respectively. Some rapid and cheap methods (Carba NP, Blue Carba, Beta Carba) 8, 9, 10 have been developed. However, they lack the ability to characterize carbapenemases.
MBL producers may pose greater resistance compared with KPC producers because their plasmid may harbor a high number of other resistance genes like plasmid‐mediated cephalosporinase genes, extended spectrum β‐lactamase (ESBL) genes, aminoglycoside resistance genes (16S RNA methylases), macrolide resistance genes (esterase), rifampin genes (rifampin‐modifying enzymes) and sulfamethoxazole resistance genes as a source of multidrug resistance and pandrug resistance.11 Thus, accurate and timely differentiation of KPC and MBL carbapenemases is of the utmost importance for the betterment of treatment modality and reduction in the clinical mortality rate.
2. MATERIALS AND METHODS
2.1. Isolates
From August 2016 to July 2017, a total of 3437 clinical samples (sputum, pus, urine, blood, and fluids) were processed and Klebsiella spp. were identified as per standard operating procedures including microscopy, culture and biochemical tests, which were further subjected for carbapenemase detection.12
2.2. Carbapenemase detection
2.2.1. Screening test
In all, 508 Klebsiella isolates were tested for meropenem susceptibility (10 μg) by Kirby‐Bauer method as per Clinical Laboratory Standard Institute (CLSI) guidelines.8 Strains, showing the zone diameter <22 mm, were considered as suspected carbapenemase producers and further processed for confirmation by combined disc test (CDT), modified Carba NP test, and conventional PCR.
2.2.2. Combined disc test (CDT)
Test strain was inoculated on Mueller‐Hinton agar plate. Then, one disc of temocillin (30 μg) and four discs of meropenem (10 μg): one disc without any inhibitor, second disc with phenylboronic acid (PBA) (400 μg), third disc with EDTA (292 μg), and fourth disc with both PBA and EDTA, were placed. Then, plate was incubated at 37°C for 18‐24 hours.
Test strain, showing more than 5‐mm zone diameter around meropenem with PBA and meropenem with both PBA and EDTA than zone diameter around meropenem disc alone, was considered as serine carbapenemase producer.
Test strain, showing more than 5‐mm zone diameter around meropenem with EDTA and meropenem with both PBA and EDTA than zone diameter around meropenem disc alone, was considered as MBL producer.
However, test strain, showing no increase zone of inhibition around meropenem plus inhibitor and <10‐mm zone diameter around temocillin, was considered as OXA‐48 producer.13
2.2.3. Modified Carba NP test
Modified Carba NP test was performed as described by Dortet et al14 with modification; 4‐5 loops (10 μL) of a pure bacterial culture was taken from blood agar plate, suspended into 400 μL Tris‐HCl bacterial lysis buffer, and then vortexed it for 1 minute. One hundred microliters of this bacterial suspension was added in four microcentrifuge tubes (0.5 mL capacity) each. Tube 1 (control tube) contained 100 μL of diluted phenol red and 0.1 mmol/L ZnSO4; tube 2 contained 100 μL of diluted phenol red, 0.1 mmol/L ZnSO4, and 6 mg/mL imipenem‐cilastatin powder (equivalent to 3 mg/mL of imipenem); tube 3 contained 100 μL of diluted phenol red, 0.1 mmol/L ZnSO4, 6 mg/mL imipenem‐cilastatin, and 4 mg/mL of tazobactam sodium salt; and tube 4 contained 100 μL of diluted phenol red, 0.1 mmol/L ZnSO4, 6 mg/mL imipenem‐cilastatin, and 0.003 mol/L EDTA.
Test strain turning yellow color from original red color in tubes 2 and 4 only was considered as KPC producer, whereas in tubes 2 and 3 it was considered as MBL producer.
2.2.4. Polymerase Chain Reaction
Conventional PCR was performed using different primers to determine the type of carbapenemase genes (KPC, NDM, IMP, VIM, OXA‐48) and used as gold standard method for statistical analysis (Table 1).
Table 1.
Primer sequences for carbapenemase genes
| Sr. No. | Carbapenemase genes | Amplicon size (bp) | Primer sequences |
|---|---|---|---|
| 1. | blaKPC | 201 | F‐5′‐TCGAACAGGACTTTGGCG‐3′ |
| R‐5′‐GGAACCAGCGCATTTTTGC‐3′ | |||
| 2. | blaIMP | 587 | F‐5′‐GAAGGCGTTTATGTTCATAC‐3′ |
| R‐5′‐GTAAGTTTCAAGAGTGATGC‐3′ | |||
| 3. | blaVIM | 382 | F‐5′‐GTTTGGTCGCATATCGCAAC‐3′ |
| R‐5′‐AATGCGCAGCACCAGGATAG‐3′ | |||
| 4. | blaNDM‐1 | 237 | F‐5′‐GCATAAGTCGCAATCCCCG‐3′ |
| R‐5′‐CTTCCTATCTCGACATGCCG‐3′ | |||
| 5. | blaOXA‐48 | 438 | F‐5′‐GCGTGGTTAAGGATGAACAC‐3′ |
| R‐5′‐CATCAAGTTCAACCCAACCG‐3′ |
2.3. Quality Controls
Klebsiella pneumoniae ATCC 1705 and K. pneumoniae ATCC 2146 were used as positive controls for KPC and MBL carbapenemase producers, respectively.
3. RESULTS
Of the 3437 samples processed, 2129 (61.9%) showed positive growth, comprising 1995 (93.7%) samples with single growth and 134 (6.3%) with mixed growth. Thus, a total of 2282 bacterial isolates were obtained, of which 508 (22.3%) were Klebsiella spp. including 73 (14.4%) carbapenemase producers, comprising 12 (16.4%) KPC producers and 61 (83.6%) MBL producers. Klebsiella spp. were predominately isolated from sputum samples (21.5%) followed by pus (15%) and blood samples (12.9%), whereas Escherichia coli (15.6%) was the most common isolate and Enterobacter spp. (0.7%), the least one (Table 2).
Table 2.
Overall distribution of specimen process & isolates obtained
| Isolated organism | Sputum (N = 963) (%) | Pus N = 654 (%) | Urine N = 1342 (%) | Blood N = 280 (%) | High vaginal swab N = 198 (%) | Total n = 3437 (%) |
|---|---|---|---|---|---|---|
| Klebsiella species | 207 (21.5) | 98 (15.0) | 148 (11.0) | 36 (12.9) | 19 (9.6) | 508 (14.8) |
| Escherichia coli | 76 (7.9) | 63 (9.6) | 342 (25.5) | 16 (5.7) | 39 (19.7) | 536 (15.6) |
| Pseudomonas aeruginosa | 89 (9.2) | 46 (7.0) | 98 (7.3) | 23 (8.2) | 7 (3.5) | 263 (7.7) |
| Acinetobacter sp. | 18 (1.9) | 9 (1.4) | 38 (2.8) | 3 (1.1) | 2 (1.0) | 70 (2.0) |
| Proteus sp. | 11 (1.1) | 29 (4.4) | 66 (4.9) | 4 (1.4) | 2 (1.0) | 112 (3.3) |
| Citrobacter sp. | 13 (1.3) | 16 (2.4) | 41 (3.1) | 2 (0.7) | 0 | 72 (2.1) |
| Enterobacter sp. | 4 (0.4) | 9 (1.4) | 11 (0.8) | 0 | 1 (0.5) | 25 (0.7) |
| Staphylococcus aureus | 78 (8.1) | 115 (17.6) | 75 (5.6) | 49 (17.5) | 17 (8.6) | 334 (9.7) |
| CoNS | 0 | 67 (10.2) | 99 (7.4) | 0 | 3 (1.5) | 169 (4.9) |
| Enterococcus sp. | 2 (0.2) | 13 (2.0) | 55 (4.1) | 0 | 3 (1.5) | 73 (2.1) |
| Streptococcus sp. | 81 (8.4) | 7 (1.1) | 16 (1.2) | 14 (5.0) | 2 (1.0) | 120 (3.5) |
CoNS, coagulase negative staphylococcus.
Modified Carba NP test demonstrates very low performance after 30 minutes, which greatly increases up to 2 hours only. Sensitivity, specificity, PPV, and NPV were 91.7%, 100%, 100%, and 99.8% for KPC and 96.7%, 100%, 100%, and 99.5% for MBL detection, respectively (Table 3). Modified Carba NP test detected 91.7% (11/12) KPC‐producing Klebsiella spp. and combined disc test detected 66.7% (9/12), whereas both equally detected MBL producers. However, there was a non‐significant difference (P > .01) by Fisher's exact test (Table 4).
Table 3.
Performance parameters of modified Carba NP test
| Incubation time (min) | Carbapenemase type | TP | FP | TN | FN | Sensitivity (%) | Specificity (%) | PPV (%) | NPV (%) |
|---|---|---|---|---|---|---|---|---|---|
| 30 | KPC | 4 | 0 | 434 | 8 | 33.3 | 100 | 100 | 98.2 |
| MBL | 13 | 0 | 434 | 48 | 21.3 | 100 | 100 | 90.0 | |
| 60 | KPC | 9 | 0 | 434 | 3 | 75.0 | 100 | 100 | 99.3 |
| MBL | 39 | 0 | 434 | 22 | 63.9 | 100 | 100 | 95.2 | |
| 90 | KPC | 11 | 0 | 434 | 1 | 91.7 | 100 | 100 | 99.8 |
| MBL | 57 | 0 | 434 | 4 | 93.4 | 100 | 100 | 99.1 | |
| 120 | KPC | 11 | 0 | 434 | 1 | 91.7 | 100 | 100 | 99.8 |
| MBL | 59 | 0 | 434 | 2 | 96.7 | 100 | 100 | 99.5 | |
| 150 | KPC | 11 | 0 | 434 | 1 | 91.7 | 100 | 100 | 99.8 |
| MBL | 59 | 0 | 434 | 2 | 96.7 | 100 | 100 | 99.5 |
TP, true positive; FP, false positive; TN, true negative; FN, false negative; PPV, positive predictive value; NPV, negative predictive value.
Table 4.
Comparison of modified Carba NP and combined disc test for differentiation of carbapenemase
| Types of carbapenemase | Modified carba NP n (%) | Combined disc test n (%) | P value |
|---|---|---|---|
| KPC carbapenemase (n = 12) | 11 (91.7) | 9 (66.7) | .3168 |
| MBL carbapenemase (n = 61) | 59 (96.7) | 59 (96.7) | 1.0000 |
| Total n = 73 | 70 (95.9) | 68 (93.2) | .7188 |
4. DISCUSSION
This study evaluates the performance of modified Carba NP test for the characterization of carbapenemase‐producing Klebsiella spp. phenotypically.
In this study, 14.4% (73 out of 508) klebsiella isolates were carbapenemase producers. Similarly, Chauhan et al15 and Chakkarapani et al16 reported 12% and 14.4% carbapenemase producing Klebsiella spp. in their studies, respectively.
Carbapenemase‐producing Klebsiella spp. were predominately isolated from sputum samples (Table 2). Similar study by Radhika et al17 revealed that highest 45% carbapenemase‐producing Klebsiella spp. were isolated from sputum sample, whereas in contrast, 54% and 45% carbapenemase producers were isolated from urine and blood samples, respectively, in studies by Mulla et al18 and Shawky et al19. Highest carbapenemase producers, from sputum sample in this study, may be associated with the fact that mostly patients with respiratory tract infection were on assisted (mechanical) ventilation, rendering the patients more prone to get resistant bacterial infection.20
Several studies have been conducted with the modification of Carba NP test using imipenem‐cilastatin for the detection of carbapenemase but with the limitation to differentiate between KPC and MBL producers. A study by Hamid El Abd et al21 concluded the sensitivity and specificity to be 100% for the detection of both KPC and MBL producers. Another study carried out by Campana et al22 reported 73.1% sensitivity and 100% specificity. These studies support the current study, concluding 91.7% sensitivity and 96.7% specificity. Low sensitivity for KPC detection may be due to low hydrolytic activity compared to MBL or due to some interference of KPC with cilastatin (data not available).
In this study, 16.4% Klebsiella strains were KPC and 83.6% were MBL producers (Table 4), which are supported by Kumar et al23 who stated that 19.5% and 60.8% were KPC and MBL producers, respectively. High rate of MBL producers may be because MBLs have been documented throughout the world, while KPC carbapenemases have been reported from New York City area, Atlanta area of USA, and recently in Europe, but seldom reported from India. The reason behind the regional variation is not clear.11
5. CONCLUSION
Antimicrobial resistance among gram‐negative bacteria is rapidly increasing and leaving behind very limited treatment options. Rapid and accurate identification of resistant strains results in better treatment modality and reduction in the mortality rate. Modified Carba NP test is a rapid, cheap, highly sensitive, and specific method for the differentiation of KPC and MBL carbapenemase‐producing Klebsiella spp.
ETHICAL APPROVAL
This study was approved by Institute Ethics Committee (IEC) and Institute Research Committee (IRC), MM Institute of Medical Sciences and Research (MMIMSR), Mullana, Ambala, Haryana, India (Ref no‐IEC/MMIMSR/715).
Kumar N, Singh VA, Beniwal V, Pottathil S. Modified Carba NP Test: Simple and rapid method to differentiate KPC‐ and MBL‐producing Klebsiella species. J Clin Lab Anal. 2018;32:e22448 10.1002/jcla.22448
REFERENCES
- 1. Meletis G. Carbapenem resistance: overview of the problem and future perspectives. Ther Adv Infect Dis. 2016;3:15‐21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Bush K, Jacoby G. Updated functional classification of β lactamase. Antimicrob Agents Chemother. 2010;54:969‐976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Kumar N, Singh V, Pottathil S. Metallo β lactamase and serine carbapenemase producing Klebsiella spp.: a global challenge. J Glob Antimicrob Resist. 2018;12:185‐186. [DOI] [PubMed] [Google Scholar]
- 4. Centers for Disease Control and Prevention . Antibiotic resistance threats in the United States, 2013. http://www.cdc.gov/drugresistance/threat-report-2013/index.html. Accessed September 25, 2017
- 5. World Health Organization . Antimicrobial resistance: global report on surveillance. 2014. http://apps.who.int/medicinedocs/documents/s21405en/s21405en.pdf. Accessed September 25, 2017.
- 6. Pournaras S, Zarkotou O, Poulou A, et al. A combined disc test for direct differentiation of carbapenemase producing Enterobacteriaceae in surveillance rectal swabs. J Clin Microbiol. 2013;51:2986‐2990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Birgy A, Bidet P, Genel N, et al. Phenotypic screening of carbapenemase and associated β lactamases in carbapenem resistant Enterobacteriaceae. J Clin Microbiol. 2012;50:1295‐1302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Clinical and Laboratory standards institute (CLSI) . Performance standards for antimicrobial susceptibility testing, Approved Standard—Eleventh Edition. CLSI document M02‐A12; Wayne, PA: Clinical and Laboratory Standards Institute; 2015. [Google Scholar]
- 9. Bernabeu S, Dortet L, Naas T. Evaluation of the β‐CARBA test, a colorimetric test for the rapid detection of carbapenemase activity in gram negative bacilli. J Antimicrob Chemother. 2017;72:1646‐1658. [DOI] [PubMed] [Google Scholar]
- 10. Pires J, Novais A, Peixe L. Blue Carba, an easy biochemical test for detection of diverse carbapenemase producers directly from bacterial culture. J Clin Microbiol. 2013;51:4281‐4283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Nordmann P, Nass T, Poirel L. Global spread of carbapenemase producing enterobacteriaceae. Emerg Infect Dis. 2011;17:1791‐1796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Koneman WK, Allen SD, Janda WM, et al. Color Atlas and Textbook of Diagnostic Microbiology, 6th ed Philadelphia, PA: Lippincott‐Raven Publisher; 2005:624‐662. [Google Scholar]
- 13. Dijk KV, Voets GM, et al. A disc diffusion assay for detection of class A, B and OXA‐48 carbapenemases in Enterobacteriaceae using phenyl boronic acid, dipicolinic acid and temocillin. Clin Microbiol Infect. 2014;20:345‐349. [DOI] [PubMed] [Google Scholar]
- 14. Dortet L, Poiral L, Nordmann P. Rapid identification of carbapenemase types in enterobacteriaceae and Pseudomonas spp. By using biochemical test. Antimicrob Agents Chemother. 2012;56:6437‐6440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Chauhan K, Pandey A, Asthana AK, Madan M. Evaluation of phenotypic tests for detection of Klebsiella pneumoniae carbapenemase and metallo‐beta‐lactamase in clinical isolates of Escherichia coli and Klebsiella species. Indian J Pathol Microbiol. 2015;58:31‐35. [DOI] [PubMed] [Google Scholar]
- 16. Chakkarapani AA, Amboiram P, Balakrishnan U, Ninan B, Sekar U. Pattern and antimicrobial susceptibility of carbapenem resistant organisms in tertiary care neonatal intensive care unit, India. J Clin Neonatol. 2014;3:200‐204. [Google Scholar]
- 17. Radhika B, Padmaja J. Detection of serine carbapenemase and metallo carbapenemase enzymes in Klebsiella pneumonia in a tertiary care hospital. Am J Sci Med Res. 2015;1:136‐147. [Google Scholar]
- 18. Mulla S, Charan J, Rajdev S. Antibiotic sensitivity pattern in blaNDM‐1‐positive and carbapenemase‐producing Enterobacteriaceae. Int J Appl Basic Med Res. 2016;6:14‐17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Shawkey SM, Abdallah A, Khouly M. Antimicrobial activity of Colistin and Tigecycline against carbapenem‐ resistant Klebsiella pneumoniae clinical isolates in Alexandria, Egypt. Int J Curr Microbiol App Sci. 2015;4:731‐742. [Google Scholar]
- 20. Medell M, Martinez A, et al. Characterization and sensitivity to antibiotics of bacteria isolated from the lower respiratory tract of ventilated patients hospitalized in intensive care unit. Braz J Infect Dis. 2012;16:45‐51. [PubMed] [Google Scholar]
- 21. Hamid El Abd D, Msry S, et al. Carba NP test as a rapid diagnostic tool for carbapenemase producers. JMSCR. 2017;5:19133‐19143. [Google Scholar]
- 22. Campana E, Chuster S, et al. Modified Carba NP test for the detection of carbapenemase production in gram negative rods: optimized handling of multiple samples. Braz J Microbiol. 2017;48:242‐245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Kumar S, Mehra S. Performance of modified hodge test and combined disc test for detection of carbapenemase in clinical isolates of Enterobacteriaceae. Int J Curr Microbiol App Sci. 2015;4:255‐261. [Google Scholar]