Abstract
Background
Ofloxacin (OFX) resistant Mycobacterium tuberculosis (MTB) isolates have been increasingly observed and are a major concern in recent years. This study investigated the genetic mutations associated with OFX resistance among clinical OFX mono‐resistant MTB isolates from new and previously treated tuberculosis patients.
Methods
A total of 50 unrelated OFX mono‐resistant MTB isolates were analyzed. For all isolates, the quinolone resistance determining regions of gyrA and gyrB were PCR amplified and sequenced.
Results
Single mutations in the quinolone resistance determining regions of gyrA (positions D94A, G, N, and Y; A90V; and S91P) and gyrB (positions T539A and E540D) were observed in 62% (31/50) and 4% (2/50) of all OFX mono‐resistant isolates, respectively. No differences were detected between the proportions of isolates with mutations in gyrA/gyrB from new and previously treated tuberculosis patients (P=.820).
Conclusions
Although mutations in gyrB were rare, they were as important as mutations in gyrA in predicting OFX resistance in MTB in Tianjin, China.
Keywords: Fluoroquinolone resistance, gyrA, gyrB, mutations, Mycobacterium tuberculosis, ofloxacin resistance, quinolone resistance determining region
1. Introduction
Tuberculosis (TB) caused by Mycobacterium tuberculosis (MTB) remains a threat to public health and was responsible for ~9.6 million infections and an estimated 1.5 million deaths in 2014.1 The emergence and spread of drug resistant MTB isolates has worsened the WHO End TB Strategy, especially multidrug resistant MTB, which is resistant to first‐line drugs such as rifampicin and isoniazid.1, 2, 3 Ofloxacin (OFX) is a member of the fluoroquinolones (FQs), which are some of the most effective second‐line anti‐microbial drugs used to treat patients who are infected with drug resistant TB (including multidrug resistant TB) or who are intolerant of current first‐line therapy.4 However, in recent years, OFX resistant MTB isolates have been increasingly observed and are a major concern, which have exacerbated the process of treating and controlling TB.5
Molecular methods for the rapid detection of mutations in genes associated with drug resistance are faster than automatic liquid culture systems that require 7‐10 days to complete.2, 6, 7 The main cellular target for FQs is DNA gyrase encoded by gyrA and gyrB,5 in which the mutations in quinolone resistance determining regions (QRDRs) have been associated with FQ resistance.8 Efflux pumps also confer FQ resistance, which is able to be induced by anti‐tuberculosis drug such as rifampicin.9 Understanding the mainly genetic background of resistance to FQs in MTB is essential, especially in FQ mono‐resistant MTB.
In this study, we sought to investigate the genetic mutations in the QRDRs of gyrA and gyrB among clinical MTB isolates with OFX mono‐resistance from new and previously treated patients.
2. Materials and Methods
2.1. Strains
A total of 2639 MTB isolates were collected by the Tianjin drug‐resistance tuberculosis surveillance program from Jan 2013 to Dec 2015. Identification of isolates was performed on Lowenstein‐Jensen medium containing p‐Nitrobenzoic‐acid (PNB) and Thiophene‐2‐ carboxylic hydrazide (TCH).
2.2. Drug susceptibility test
According to the proportion method recommended by WHO, drug susceptibility tests (DSTs) were performed on Lowenstein‐Jensen medium containing streptomycin (4 mg/L), rifampicin (40 mg/L), isoniazid (0.2 mg/L), ethambutol (2 mg/L), OFX (2 mg/L), or kanamycin (30 mg/L), at the Tuberculosis Reference Laboratory of Tianjin Center for Tuberculosis Control.10
2.3. Patient information
The demographic and clinical information of enrolled patients, including gender, age, and TB treatment history, was obtained from the patients’ records.
2.4. DNA sequencing of gyrA and gyrB genes
DNA was extracted using the cetyltrimethylammonium bromide method, and samples were stored at −20°C. Primers used to amplify and sequence the QRDR of gyrA and gyrB from MTB isolates were described previously 11 and include GYRA‐F: ATCGACTATGCGATGAGCG, GYRA‐R: GGGCTTCGGTGTACCTCAT, GYRB‐F: AGTCGTTGTGAACAAGGCTGT, and GYRB‐R: CCACTTGAGTTTGTACAGCGG. PCR products were sequenced by Thermo Fisher Scientific Inc. (Beijing, China). Sequence data was analyzed using the MUBII‐TB‐DB database and BLAST on http://blast.ncbi.nlm.nih.gov, using the MTB H37Rv genome as a reference (GenBank accession number: CP003248.2).12
2.5. Statistical analysis
A χ2 test in IBM SPSS Statistics 19.0 (SPSS Inc., Chicago, IL, USA) was used to compare the proportions of drug resistance mutations in gyrA and gyrB between isolates from new and previously treated TB patients. P values of <.05 were considered statistically significant.
3. Results
3.1. Patients’ information
By proportion method, 50 of 2639 isolates were OFX mono‐resistant MTB, excluding six repeated OFX mono‐resistant MTB isolates. Each of the 50 OFX mono‐resistant MTB isolates obtained in this study were collected separately from 50 unrelated pulmonary TB patients (Table 1).
Table 1.
Distribution of mutations in gyrA/gyrB among 50 OFX mono‐resistant MTB isolates from patients
| Patient number | Treatment history | Gender | Age | Mutations in gyrA/gyrB in isolates from patients | |
|---|---|---|---|---|---|
| gyrA | gyrB | ||||
| 13005 | New | Male | 34 | D94N | WT |
| 13137 | New | Female | 50 | D94G | WT |
| 13139 | New | Male | 60 | S91P | WT |
| 13245 | New | Male | 50 | D94N | WT |
| 13497 | New | Female | 78 | S91P | WT |
| 13523 | New | Male | 69 | D94G | WT |
| 13634 | New | Male | 57 | A90V | WT |
| 14015 | New | Male | 44 | D94A | WT |
| 14036 | Previously treated | Male | 28 | D94G | WT |
| 14044 | New | Female | 54 | A90V | WT |
| 14095 | New | Male | 33 | D94N | WT |
| 14179 | Previously treated | Male | 30 | S91P | WT |
| 14374 | New | Female | 38 | D94N | WT |
| 14399 | New | Female | 29 | D94N | WT |
| 14448 | New | Male | 31 | D94A | WT |
| 14466 | New | Male | 51 | D94N | WT |
| 14476 | New | Male | 45 | A90V | WT |
| 14603 | New | Male | 22 | A90V | WT |
| 14823 | New | Female | 57 | D94A | WT |
| 14824 | New | Male | 58 | D94A | WT |
| 14871 | New | Male | 27 | D94A | WT |
| 15043 | New | Female | 38 | D94N | WT |
| 15151 | New | Male | 82 | S91P | WT |
| 15177 | New | Female | 31 | D94G | WT |
| 15182 | New | Male | 74 | A90V | WT |
| 15196 | New | Female | 25 | D94A | WT |
| 15214 | New | Male | 67 | S91P | WT |
| 15219 | New | Male | 44 | D94Y | WT |
| 15426 | Previously treated | Male | 89 | D94G | WT |
| 15457 | New | Male | 56 | D94Y | WT |
| 15786 | Previously treated | Male | 54 | D94G | WT |
| 15369 | New | Male | 55 | WT | T539A |
| 15539 | Previously treated | Female | 81 | WT | E540D |
| 13051 | New | Male | 61 | WT | WT |
| 13356 | New | Male | 83 | WT | WT |
| 13422 | New | Male | 26 | WT | WT |
| 13520 | Previously treated | Male | 45 | WT | WT |
| 13639 | New | Male | 56 | WT | WT |
| 13659 | New | Male | 66 | WT | WT |
| 14096 | New | Female | 60 | WT | WT |
| 14119 | New | Male | 74 | WT | WT |
| 14436 | New | Male | 55 | WT | WT |
| 14739 | New | Female | 28 | WT | WT |
| 14867 | New | Male | 71 | WT | WT |
| 15134 | Previously treated | Male | 41 | WT | WT |
| 15297 | New | Male | 55 | WT | WT |
| 15404 | New | Male | 28 | WT | WT |
| 15470 | Previously treated | Male | 53 | WT | WT |
| 15489 | New | Female | 29 | WT | WT |
| 15670 | New | Male | 62 | WT | WT |
WT, wild type.
3.2. Mutations in gyrA and gyrB genes among MTB strains
As shown in Table 1% (31/50) isolates carried single mutations in the QRDR of gyrA. The most frequent mutations in gyrA were at positions D94N (n=7), A (n=6), G (n=6), and Y (n=2), followed by A90V (n=5) and S91P (n=5). Of all MTB isolates, 4% (2/50) isolates carried single mutations in the QRDR of gyrB, at positions T539A and E540D, based on the findings of Pantel et al.13 All strains carried S95T mutations in gyrA and are not listed in Table 1 because they only showed these specific polymorphisms.6
No differences were detected between the proportions of isolates having mutations in gyrA/gyrB from new (66.7%, 28/42) and previously treated TB patients (62.5%, 5/8), P=.820. No differences were detected between the proportions of isolates with mutations in gyrA/gyrB from male (63.9%, 23/36) and female TB patients (71.4%, 10/14), P=.863.
4. Discussion
In this study, the most common mutations in gyrA were found in the QRDR at positions 94, 90, and 91, carried by 62% OFX mono‐resistant MTB isolates, which was in agreement with the previously findings from literatures.5, 14 To our knowledge, this is the first report to show that the mutations T539A and E540D in the QRDR in gyrB were found from OFX mono‐resistant MTB isolates in China. These mutations in gyrA and gyrB partially accounted for the phenotypic OFX resistance. Other mechanisms of FQ resistance, such as efflux pumps, should be evaluated to improve the prediction of FQ resistance phenotypes.15
All OFX mono‐resistant MTB isolates were obtained from both new (42 cases) and previously treated TB patients (eight cases). Our results implied that the transmission of isolates that were already resistant to FQs causes the prevalence of FQ resistance and that MTB in TB patients acquires FQ resistance correlated with the patient's previous exposure to FQs.16 However, no difference was detected between the proportions of isolates with mutations in gyrA/gyrB from new and previously treated TB patients (P=.820). A limitation was that only a small number of MTB isolates that had mutations in gyrA/gyrB were collected, excluding other OFX resistant MTB isolates.
5. Conclusion
In conclusion, mutations in QRDR in both gyrA and gyrB were important in predicting OFX resistance of MTB isolates in Tianjin, China. Further research using additional OFX resistant MTB isolates to acquire and analyze the prevalence of OFX genotypic resistance of MTB isolates in this region is needed.
Acknowledgments
This work was supported by Tianjin Centers for Disease Control and Prevention (Grant number: CDCKY1503).
Wang Z, Xie T, Mu C, et al. Molecular characteristics of ofloxacin mono‐resistant Mycobacterium tuberculosis isolates from new and previously treated tuberculosis patients. J Clin Lab Anal. 2018;32:e22202 10.1002/jcla.22202
References
- 1. World Health Organization . Global tuberculosis report. 2015.
- 2. Brossier F, Guindo D, Pham A, et al. Performance of the new version (v2.0) of the geno type MTBDRsl test for detection of resistance to second‐line drugs in multidrug‐ resistant Mycobacterium tuberculosis complex strains. J Clin Microbiol. 2016;54:1573‐1580. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Cohen KA, Abeel T, Manson McGuire A, et al. Evolution of extensively drug‐resistant tuberculosis over four decades: whole genome sequencing and dating analysis of Mycobacterium tuberculosis isolates from KwaZulu‐Natal. PLoS Med. 2015;12:e1001880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Blumberg HM, Burman WJ, Chaisson RE, et al. American Thoracic Society/Centers for Disease Control and Prevention/Infectious Diseases Society of America: treatment of tuberculosis. Am J Respir Crit Care Med. 2003;167:603‐662. [DOI] [PubMed] [Google Scholar]
- 5. Bernard C, Veziris N, Brossier F, et al. Molecular diagnosis of fluoroquinolone resistance in Mycobacterium tuberculosis . Antimicrob Agents Chemother. 2015;59:1519‐1524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Avalos E, Catanzaro D, Catanzaro A, et al. Frequency and geographic distribution of gyrA and gyrB mutations associated with fluoroquinolone resistance in clinical Mycobacterium tuberculosis isolates: a systematic review. PLoS ONE. 2015;10:e0120470. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Moure R, Tudó G, Medina R, et al. Detection of streptomycin and quinolone resistance in Mycobacterium tuberculosis by a low‐density DNA array. Tuberculosis. 2013;93:508‐514. [DOI] [PubMed] [Google Scholar]
- 8. Malik S, Willby M, Sikes D, et al. New insights into fluoroquinolone resistance in Mycobacterium tuberculosis: functional genetic analysis of gyrA and gyrB mutations. PLoS ONE. 2012;7:e39754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Louw GE, Warren RM, Gey van Pittius NC, et al. Rifampicin reduces susceptibility to ofloxacin in rifampicin‐resistant Mycobacterium tuberculosis through efflux. Am J Respir Crit Care Med. 2011;184:269‐276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. World Health Organization . Policy guidance on drug‐susceptibility testing (DST) of second‐line anti‐tuberculosis drugs. 2008. [PubMed]
- 11. Kontsevaya I, Mironova S, Nikolayevskyy V, et al. Evaluation of two molecular assays for rapid detection of Mycobacterium tuberculosis resistance to fluoroquinolones in high‐tuberculosis and multidrug resistance settings. J Clin Microbiol. 2011;49:2832‐2837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Flandrois JP, Lina G, Dumitrescu O. MUBII‐TB‐DB: a database of mutations associated with antibiotic resistance in Mycobacterium tuberculosis . BMC Bioinformatics. 2014;15:107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Pantel A, Petrella S, Veziris N, et al. Extending the definition of the GyrB quinolone resistance‐determining region in Mycobacterium tuberculosis DNA gyrase for assessing fluoroquinolone resistance in M. tuberculosis . Antimicrob Agents Chemother. 2012;56:1990‐1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Zhao LL, Sun Q, Zeng CY, et al. Molecular characterisation of extensively drug‐resistant Mycobacterium tuberculosis isolates in China. Int J Antimicrob Agents. 2015;45:137‐143. [DOI] [PubMed] [Google Scholar]
- 15. Singh M, Jadaun GP, Ramdas Srivastava K, et al. Effect of efflux pump inhibitors on drug susceptibility of ofloxacin resistant Mycobacterium tuberculosis isolates. Indian J Med Res. 2011;133:535‐540. [PMC free article] [PubMed] [Google Scholar]
- 16. Wang JY, Lee LN, Lai HC, et al. Fluoroquinolone resistance in Mycobacterium tuberculosis isolates: associated genetic mutations and relationship to antimicrobial exposure. J Antimicrob Chemother. 2007;59:860‐865. [DOI] [PubMed] [Google Scholar]