Abstract
Background
Nephrolithiasis is one of the causes which lead to chronic kidney disease (CKD). Matrix metalloproteinases (MMPs) are endopeptidases degrading extracellular matrix which correlate with the pathogenesis of atherosclerosis. The current study was designed to analyze the association of (R279Q, C1562T) polymorphism of MMP‐9 with nephrolithiasis patients.
Methods
Genotyping of MMP‐9/R279Q and of MMP‐9/C1562T polymorphism were carried out by PCR‐based restriction digestion method. Serum level of MMP‐9, oxidative stress marker, MDA, and uric acid were measured in patients and control.
Results
Allele frequencies of the MMP‐9/C1562T polymorphism for C and T allele were 71.25% and 28.75% in patients, 87.08% and 12.92% in control respectively. The homozygote TT was more frequent in the nephrolithiasis patients group, while T allele frequency was significantly higher in the nephrolithiasis patients group than in the control group. The patients with CT and TT genotype showed a significant increase in serum MMP‐9, Total Oxidant Status (TOS), Oxidative Stress Index (OSI), Malondialdehyde (MDA), and uric acid when compared to CC genotype in patients with nephrolithiasis. The R279Q polymorphism site with regard to the relationship with nephrolithiasis was not significant.
Conclusion
The result indicates that patients with TT genotype had an increased risk of stones. Also, the results demonstrate that TT allele of the C1562T polymorphism in the MMP‐9gene is related with an increase of oxidative stress in nephrolithiasis patients and may possibly impose a risk for cardiovascular diseases in patients with TT genotype of MMP‐9.
Keywords: malondialdehyde, MMP‐9 gene polymorphism, nephrolithiasis, total antioxidant status
1. Introduction
Nephrolithiasis is a common chronic disorder associated with painful stone episodes.1 It can cause post‐renal acute kidney injury via obstruction of urinary outflow, often associated with rapid deterioration in renal function.2 Kidney stone is one of main disorders of the urinary tract.3 Kidney stone may have various compositions which include, in order of decreasing frequency: calcium oxalate, uric acid, calcium phosphate, struvite, and cystine.4 The MMPs are structurally related, zinc dependent.5 The MMP‐9 degrades extracellular matrix proteins, cytokines, and chemokine to regulate physiological and pathophysiological tissue alteration.6, 7 MMPs are provided with descriptive names, depending on substrate specificity.8 MMP‐9 is a gelatinase, in which92‐kDa collagenase (IV) is secreted from various cells including fibroblasts, lymphocytes, endothelial cells, neutrophils, and macrophages.9 Several studies showed that imbalance in the activity of MMP‐9 would lead to vascular disease in patients with kidney failure.10, 11, 12 Furthermore, MMP9 is highly expressed in the weak regions of atherosclerotic plaques and may be causally involved in plaque rupture.13, 14, 15 The increase in plasma concentrations of MMP9 may be a predictor of cardiovascular disease risk and plasma MMP9 concentrations are elevated in patients with acute myocardial infarction.16, 17 Other studies showed that there was an increased risk for coronary heart disease in patients with kidney stones due to increased risk for CKD.18, 19 Thus, the current study proposed that: two functional polymorphisms in the MMP‐9 gene promoter region (C1562T; rs3918242, and Q279R; rs17576) might affect the alterations in MMP‐9 levels linked with nephrolithiasis and the alteration in plasma MMP‐9 concentrations might found in patients with nephrolithiasis. Besides, the relationship between genetic variations of the MMP‐9 gene with oxidative stress in nephrolithiasis patients was examined.
2. Materials and Methods
2.1. Patients collection and samples storage
Patients suffering from major infections like T2DM, diabetic nephropathy, heart disease, history of alcohol intake, taking potent antioxidant, smokers, and pregnant females were excepted in the current study. One hundred twenty patients with nephrolithiasis and one hundred twenty healthy as control were involved in this study. All the patients and controls were subjected to the same clinical examination. Furthermore, all the patients and controls were also subjected to the same biochemical test and urine test and were given the ultrasound and X‐ray test.
Six milliliters of blood samples were collected from patients and control and separated into two parts. The first was stored at −20°C for DNA analysis. The other part was allowed to clot and the serum obtained was used to measure serum MMP‐9 and other biochemical parameters were stored at −20°C. The study was supported by the Institutional Ethics Committee [IIUM/305/14/11/2/IREC 300].
2.2. Genotyping MMP‐9/R279Q and MMP‐9/C1562T polymorphism
2.2.1. DNA extraction
The genomic DNA was extracted by using the standard salting out method.20 Extracted DNA was used as a template, the promoter region of MMP‐9/R279Q and MMP‐9/C1562T were amplified by PCR. Primers sequences are presented in Table 1. Final volume of reaction was 25 μL [12.5 μL 2× Power TaqPCR Master Mix (Pomega Corporation, Madison, WI, USA), 1 μL each primer (10 pmol/μL), and 1 μL genomic DNA]. The restriction enzyme SphI and SmaI (Promega, USA) were used to digest the PCR products of R279Q and C1562T polymorphism sites at 37°C for 16 hours followed by 2% agarose electrophoresis (100 V, 60 minutes). The MMP‐9/R279Q allele produced a 277 base pair (bp), 181 and 96 bp. MMP‐9/C1562T allele was produced a 436 bp fragment, 242 and 194 bp (Figure 1).
Table 1.
The PCR conditions and primers for the MMP‐9/R279Q and MMP‐9/C1562T genes
| Polymorphism Primers | Initial denature | Denature | Annealing | Extension | Cycles | Final extension |
|---|---|---|---|---|---|---|
| MMP‐9/R279Q | ||||||
| F:5′‐ATGGGTCAAAGAACAGGA‐3′ | 5 min, 95°C | 30 s, 94°C | 30 s, 58°C | 30 s, 72°C | 30 cycles | 7 min, 72°C |
| R:5′‐GGTAGACAGGGTGGAGG‐3′ | ||||||
| MMP‐ 9/C1562T | ||||||
| F:5′‐GCCTGGCACATAGTAGGCCC‐3′ | 5 min, 95°C | 30 s, 94°C | 30 s, 64.5°C | 45 s, 72°C | 35 cycles | 10 min, 72°C |
| R:5′‐CTTCCTAGCCAGCCGGCATC‐3′ | ||||||
Figure 1.
Genotyping of the MMP‐9/R279Q and MMP‐9/C1562T. (A) MMP‐9/R279Q:1, AA genotype; 2, 4, AG genotype; 3. GG genotype (B) MMP‐9/C1562T: M, molecular marker; 1, 4, 5 and 7, CC genotype: 2, 3 and 6, CT genotype; 8, CT genotype
2.3. Measurement of oxidative stress index (OSI), total oxidant status (TOS), total antioxidant status (TAS), MMP‐9, malondialdehyde (MDA), and other biochemical parameters
Serum of TAS, TOS, and OSI of were determined by the methods developed by Erel.21, 22, 23 Serum MMP‐9 was measured by ELISA (Cusabio Biotech Com.). The modified method of Satoh was used to measure the MDA concentration.24 Serum urea, creatinine cholesterol, and uric acid were done by commercial kits.
2.4. Statistical analysis
The polymorphisms were tested for confirmation with Hardy‐Weinberg expectations in the nephrolithiasis patient and control groups Differences in demographic characteristics, selected variables and frequencies of the genotypes, alleles of the two MMP‐9 polymorphisms between groups were evaluated using the chi‐square test (for categorical variables) and ANOVA for comparison the biochemical parameters between groups. The association between MMP‐9 variant genotypes and nephrolithiasis risk was estimated by odds ratios (ORs) and their 95% confidence intervals (CIs) using univariate analysis. The factors associated with nephrolithiasis were evaluated using multifactor logistic regression. All data were analyzed using SPSS for Windows 20.0 (SPSS Inc, Chicago, IL, USA).
3. Results
3.1. MMP‐9/R279Q and MMP‐9/C1562T allele frequency and genotype distribution
Table 2 showed the distribution of genotypes and the prevalence of alleles in the nephrolithiasis group and the control group. The frequencies of CC, CT, and TT of MMP‐9/C1562T polymorphism were 58.33%, 25.83%, and 15.84% in the nephrolithiasis group, and 77.50%, 19.17%, and 3.33% in the control group. The homozygote TT was more frequent in the nephrolithiasis group, and allele frequencies of the MMP‐9/C1562T polymorphism for C and T allele were 71.25% and 28.75% in patients group, 87.08% and 12.92% in control, respectively, P<.0001. The MMP‐9 gene R279Q polymorphism showed non‐significant change in allele distribution and genotypes between study groups (P>.05), Table 2.
Table 2.
Genotypes distribution and allele frequencies of the MMP‐9/R279Q and MMP‐9/C1562T polymorphism between patients and control groups
| MMP‐9 polymorphisms | Nephrolithiasis patients [n=120 (%)] | Control group [n=120 (%)] | OR (95% CI) | P value |
|---|---|---|---|---|
| MMP‐9/R279Q | ||||
| AA | 60 (50.00) | 58 (48.33) | 1 | |
| AG | 38 (31.67) | 41 (34.17) | 0.896 (0.507‐1.584) | .705 |
| GG | 22 (18.33) | 21 (17.50) | 1.013 (0.504‐2.036) | .971 |
| AG+GG | 60 (50.00) | 62 (51.67) | 0.935 (0.564‐1.552) | .796 |
| A allele | 158 (65.83) | 157 (65.42) | 1 | |
| Gallele | 82 (34.17) | 83 (34.58) | 0.892 (0.674‐1.431) | .923 |
| MMP‐9/C1562T | ||||
| CC | 70 (58.33) | 93 (77.50) | 1 | |
| CT | 31 (25.83) | 23 (19.17) | 1.791 (0.961‐3.336) | .064 |
| TT | 19 (15.84) | 4 (3.33) | 6.311 (2.055‐19.379) | .0004 |
| CT+TT | 50 (41.67) | 27 (22.50) | 2.460 (1.403‐4.314) | .001 |
| C allele | 171 (71.25) | 209 (87.08) | 1 | |
| T allele | 69 (28.75) | 31 (12.92) | 2.720 (1.701‐4.351) | .00001 |
3.2. Biochemical study in nephrolithiasis patients and control groups
There was not much difference observed between age, urea, creatinine, uric acid, and cholesterol between patients and control groups. MMP‐9 displayed a significant increase in patient groups than in control groups as shown in Table 3. Besides, there was also a significant difference of serum TAS, TOS, OSI, and MDA in patients in comparison to control.
Table 3.
Age and biochemical parameters in serum of nephrolithiasis and control groups
| Characteristics | Patients (n=120) | Control (n=120) | P‐value |
|---|---|---|---|
| Age (y) | 48.42±8.33 | 49.27±7.01 | .393 |
| Urea (mmol/L) | 4.66±0.98 | 4.49±0.86 | .155 |
| Creatinine (μmol/L) | 82.78±11.46 | 82.08±6.34 | .559 |
| Uric acid (μmol/L) | 323.32±65.32 | 310.12±68.23 | .127 |
| Cholesterol (mg/dL) | 194.41±20.23 | 189.31±21.12 | .057 |
| MMP‐9 (ng/mL) | 148.05±74.37 | 113.10±40.71 | .00001 |
| TAS (mmol. Trolox Eq/L) | 1.68±0.42 | 2.03±0.49 | .00001 |
| TOS (μmol. H2O2 Eq/L) | 18.98±3.01 | 13.60±1.71 | .00001 |
| OSI (arbitrary unit) | 10.81±3.90 | 6.18±2.01 | .00001 |
| MDA (nmol/mL) | 3.78±0.53 | 1.23±0.25 | .00001 |
In Table 3, Serum MMP‐9 showed a significant increase in patients than control. The subjects with TT and CT genotype showed higher levels of MMP‐9 than subjects with CC genotypes. Also, a significant difference was found in subjects when divided according genotypes in patients group in Table 4. Besides, the AA, AG, and GG genotypes showed no significant differences in patients group.
Table 4.
Distribution of serum MMP‐9 in patients group according to genotype
| Characteristic | MMP‐9/R279Q genotype | MMP‐9/C1562T genotype | ||||||
|---|---|---|---|---|---|---|---|---|
| AA [n=60] | AG [n=38] | GG [n=22] | P value | CC [n=70] | CT [n=31] | TT [n=19] | P value | |
| MMP‐9 (ng/mL) | 128.33±44.70 | 131.56±78.20 | 135.48±78.25 | .898 | 132.11±49.22 | 167.18±41.13 | 190.35±74.50 | .00001 |
| TAS (mmol Trolox Eq/L) | 1.66±0.33 | 1.70±0.40 | 1.68±0.41 | .871 | 1.57±0.36 | 1.26±0.40 | 1.00±0.33 | .00001 |
| TOS (μmol H2O2 Eq/L) | 18.95±2.30 | 18.52±2.24 | 20.00±2.25 | .054 | 17.80±2.10 | 21.95±2.34 | 28.87±2.23 | .00001 |
| OSI (arbitrary unit) | 8.45±3.33 | 8.75±3.00 | 9.67±3.12 | .312 | 10.05±3.22 | 11.98±3.20 | 17.05±3.89 | .00001 |
| Cholesterol (mg/dL) | 191.12±16.85 | 195.29±16.40 | 198.16±15.80 | .186 | 196.90±18.40 | 208.23±17.65 | 222.93±12.25 | .00001 |
| MDA (nmol/mL) | 3.20±0.43 | 3.30±0.47 | 3.45±0.48 | .084 | 3.20±0.44 | 4.50±0.41 | 5.40±0.49 | .00001 |
| S.Uric acid (μmol/L) | 328.40±55.35 | 331.40±50.65 | 330.68±60.64 | .962 | 324.20±57.55 | 350.25±67.00 | 365.75±65.00 | .015 |
A substantial decrease of serum TAS was shown in patients in comparison to control in Table 3. Serum OSI and TOS were significantly increased in patients than in control as shown in Table 3. The subjects with TT and CT genotype showed lower levels of TAS and higher levels of TOS and OSI than subjects with CC genotypes. On the other hand, a significant difference was found in subjects when divided according genotypes in patients group in Table 4. The AA, AG, and GG genotypes showed no significant differences in patients group.
Serum MDA increased significantly in nephrolithiasis patients compared to control (P<.01; Table 3), while no significant difference was shown in cholesterol level between the groups. From Table 3, there was also anon significant increase in serum uric acid patients group when compared to control. As for Table 4, a significant difference was found in subjects when divided according genotypes in patients group. However, non‐significant differences were shown between AA, AG, and GG in patients group.
A significant correlation was detected between MMP‐9 with oxidative stress markers, and uric acid in patients with nephrolithiasis, while no significant correlation was observed in control, Table 5.
Table 5.
Representation of Pearson's correlation values for patients and control groups
| Correlative variables | Pearson's correlation values patients group | Pearson's correlation values for control group |
|---|---|---|
| r‐value | r‐value | |
| MMP‐9 vs TOS | .73a | .11c |
| MMP‐9 vs TAS | −.65b | −.14c |
| MMP‐9 vs OSI | .69b | .12c |
| MMP‐9 vs MDA | .75a | .12c |
| MMP‐9 vs uric acid | −.62b | .10c |
Significant value at P<.01.
Significant value at P<.05.
Non‐significant value.
4. Discussion
The present results come to an agreement with another study which hypothesized that nephrolithiasis and urinary calculus have been connected with high concentration of uric acid in the blood.25 However, the increase in uric acid in the present study is not significant, while other studies showed that elevated uric acid is an independent risk factor for kidney disease in the general population.26, 27
Individuals may not develop the same type of disease despite being exposed to similar environmental and lifestyle factors. For that reason, inherited factors played a main role in the development of diseases. In contrast, there was no previous study conducted that linked MMP gene polymorphism with nephrolithiasis. The result showed the increase of serum MMP‐9 concentration significantly in patients compared to control group. MMP‐9 activity and concentrations is relied on its expression levels and functional genetic polymorphisms in the MMP‐9 gene.28, 29, 30 Another study exhibited that MMP9 is essential for in vivo nephron mass creation and protection of kidney function.31 The study assumed that two functional polymorphisms of MMP‐9 gene (R279Q; rs17576 and C1562T; rs3918242) may possibly affect the variations in MMP‐9 levels related with nephrolithiasis.
The result of the present study revealed that C1562T alleles of the MMP‐9 gene are associated in patients within nephrolithiasis. On the other hand, no relationship was found between R279Q polymorphism and nephrolithiasis, and these results were not demonstrated in previous studies. As the results indicated, MMP‐9 gene polymorphisms can alter MMP‐9 concentrations and increase cardiovascular complications in nephrolithiasis. Actually, the MMP‐9/C1562T polymorphism results in the damage of a nuclear repressor binding site of protein which lead to higher MMP‐9 mRNA and protein levels once the T allele is extant.32 The MMP‐9/R279Q polymorphism is found in the gelatinase‐specific fibronectin type II domain, which causes the formation of amino acid in the catalytic domain, and the change in MMP‐9 activity.33 The R279Q allele was found to be connected between high level of MMP‐9 and myocardial infarction and cardiovascular disease.30 Moreover, other studies did not found any correlation between R279Q polymorphism with the risk of cardiovascular disease.34, 35
Several studies published indicated the status of oxidative stress in different disorders that escorted with chronic kidney disease.36, 37, 38 On top of that, other studies noted that lipid peroxidation causes tissue damage due to the development of different diseases like atherosclerosis, and is related to the increase of cardiovascular mortality and morbidity in CKD.39, 40
This study demonstrated that the serum concentration of TOS, MDA, OSI TAS and uric acid statistically differed in patients with nephrolithiasis. On the other hand, the research has also shown significant correlation between serum concentration with different oxidative stress and uric acid. Furthermore, the results suggest that MMP‐9 is one of the factors that mediate the relationship between nephrolithiasis and atherosclerosis. On top of that, in CKD arterial stiffening increases cardiac afterload and left ventricular hypertrophy, reduces coronary artery perfusion and myocardial ischemia, but increases pulse pressure that promotes atheroma formation and vascular remodeling.41 MMP‐9 is secreted via inflammatory cells in the adventitia or smooth muscle cells.42 In our study, a significant difference was found in the serum concentration of MMP‐9 between nephrolithiasis patients and control group. Moreover, the significant increase was also found in the value of this biomarker within MMP‐9/C1562T genotype T/T, TG and AG GG types in patients with nephrolithiasis.
The current study conclude that MMP genetic polymorphisms affect MMP variations in nephrolithiasis with the TT genotype for the C1562T polymorphism is showing to high serum MMP‐9 levels. This result may possibly indicate a group of patients that will have worse cardiovascular prognosis. Finally, the study of genetic polymorphisms could help select a specific high‐risk population, who may particularly benefit from targeted antioxidant strategies.
Mehde AA, Mehdi WA, Yusof F, et al. Association of MMP‐9 gene polymorphisms with nephrolithiasis patients. J Clin Lab Anal. 2018;32:e22173 10.1002/jcla.22173
References
- 1. Sigurjonsdottir V, Runolfsdottir H, Indridason O, et al. Impact of nephrolithiasis on kidney function. BMC Nephrol. 2015;16:149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Kusumi K, Smith S, Barr‐Beare E, et al. Pediatric origins of nephrolithiasis‐associated atherosclerosis. J Pediatr. 2015;167:1074–1080.e2 [DOI] [PubMed] [Google Scholar]
- 3. Yusof F, Mehde AA, Mehdi WA, et al. Effects of nephrolithiasis on serum DNase (DeoxyribonucleaseI and II) activity and E3 SUMO‐protein ligase NSE2 (NSMCE2) in Malaysian individuals. Biomed Environ Sci. 2015;28:660–665. [DOI] [PubMed] [Google Scholar]
- 4. Yusof F, Mehde AA, Mehdi WA, et al. Study the effect of kidney stones on serum xanthine oxidase, ecto‐5′‐nucleotidase activity and E3SUMO‐protein ligase NSE2 (NSMCE2) in Malaysian individuals. Asian Pac J Trop Biomed. 2015;5:684–688. [Google Scholar]
- 5. Kalela A. Factors affecting serum matrix metalloproteinase‐9 with special reference to atherosclerosis. Acta Univ Tamperensis. 2002;886:23–30. [Google Scholar]
- 6. Fontana V, Silva P, Gerlach R, Tanus‐Santos J. Circulating matrix metalloproteinases and their inhibitors in hypertension. Clin Chim Acta. 2012;413:656–662. [DOI] [PubMed] [Google Scholar]
- 7. Yabluchanskiy A, Ma Y, Iyer R, et al. Matrix metalloproteinase‐9: many shades of function in cardiovascular disease. Physiology. 2013;28:391–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Ann Rev Cell Dev Biol. 2001;17:463–516. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Erbek S, Yurtcu E, Erbek S, et al. Matrix metalloproteinase‐9 promoter gene polymorphism (1562C>T) in nasal polyposis. Am J Rhinol Allergy. 2009;23:568–570. [DOI] [PubMed] [Google Scholar]
- 10. Pai A, Leaf E, El‐Abbadi M, Giachelli C. Elastin degradation and vascular smooth muscle cell phenotype change precede cell loss and arterial medial calcification in a uremic mouse model of chronic kidney disease. Am J Pathol. 2011;178:764–773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Chung A, Yang H, Sigrist M, et al. Matrix metalloproteinase‐2 and‐9 exacerbate arterial stiffening and angiogenesis in diabetes and chronic kidney disease. Cardiovasc Res. 2009;84:494–504. [DOI] [PubMed] [Google Scholar]
- 12. Chen N, O'Neill K, Chen X, et al. Activation of arterial matrix metalloproteinases leads to vascular calcification in chronic kidney disease. Am J Nephrol. 2011;34:211–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Belo VA, Souza‐Costa DC, Luizon MR, et al. Matrix metalloproteinase‐9 genetic variations affect MMP‐9 levels in obese children. Int J Obes (Lond). 2012;36:69–75. [DOI] [PubMed] [Google Scholar]
- 14. Lijnen HR. Metalloproteinases indevelopment and progression of vascular disease. Pathophysiol Haemost Thromb. 2003;33:275–281. [DOI] [PubMed] [Google Scholar]
- 15. Juan Z, Wei‐Guo Z, Heng‐Liang S, et al. Association of matrix metalloproteinase 9C‐1562T polymorphism with genetic susceptibility to myocardial infarction: a meta‐analysis. Curr Ther Res. 2015;77:40–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Jefferis BJ, Whincup P, Welsh P, et al. Prospective study of matrix metalloproteinase‐9 and risk of myocardial infarction and stroke in older men and women. Atherosclerosis. 2010;208:557–563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Squire IB, Evans J, Ng LL, Loftus IM. Plasma MMP‐9 and MMP‐2 following acute myocardial infarction in man: correlation with echocardiographic and neurohumoral parameters of left ventricular dysfunction. J Card Fail. 2004;10:328–333. [DOI] [PubMed] [Google Scholar]
- 18. Roger VL. Coronary disease surveillance: a public heath imperative. Eur Heart J. 2007;28:2051–2052. [DOI] [PubMed] [Google Scholar]
- 19. Gerber Y, Jacobsen SJ, Frye RL, et al. Secular trends in deaths from cardiovascular diseases: a 25‐year community study. Circulation. 2006;113:2285–2292. [DOI] [PubMed] [Google Scholar]
- 20. Miller S, Dykes D, Polusky H. A salting outprocedure for extracting DNA from nucleic acid cells. Nucleic Acids Res. 1988;160:215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Erel O. A novel automated method to measure total antioxidant response against potent free radical reactions. Clin Biochem. 2004;37:112–119. [DOI] [PubMed] [Google Scholar]
- 22. Erel O. A new automated colorimetric method for measuring total oxidant status. Clin Biochem. 2005;38:1103–1111. [DOI] [PubMed] [Google Scholar]
- 23. Kumari S, Verma A, Rungta S, et al. Serum prolidase activity, oxidant and anti‐oxidant status in non‐ulcer dyspepsia and healthy volunteers. ISRN Biochem. 2013;182601:6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Satoh K. Serum lipid peroxide in cerebrovasculardisorders determined by new colorimetric method. Clin Chim Acta. 1978;90:37–43. [DOI] [PubMed] [Google Scholar]
- 25. Tweeddale MG, Fodor JG. Elevated serum uric acid. A cardiovascular risk factor? Nephron. 1979;23(suppl 1):3–6. [DOI] [PubMed] [Google Scholar]
- 26. Domrongkitchaiporn S, Sritara P, Kitiyakara C, et al. Risk factors for development of decreased kidney function in a southeast Asian population: a 12‐year cohort study. J Am Soc Nephrol. 2005;16:791–799. [DOI] [PubMed] [Google Scholar]
- 27. Iseki K, Ikemiya Y, Inoue T, Iseki C, Kinjo K, Takishita S. Significance of hyperuricemia as a risk factor for developing ESRD in a screened cohort. Am J Kidney Dis. 2004;44:642–650. [PubMed] [Google Scholar]
- 28. Zhang B, Ye S, Herrmann SM, et al. Functional polymorphism in the regulatory region of gelatinase B gene in relation to severity of coronary atherosclerosis. Circulation. 1999;99:1788–1794. [DOI] [PubMed] [Google Scholar]
- 29. Metzger IF, Luizon MR, Lacchini R, Tanus‐Santos JE. Genetic variants in matrix metalloproteinase‐9 gene modify metalloproteinase‐9 levels in black subjects. DNA Cell Biol. 2012;31:504–510. [DOI] [PubMed] [Google Scholar]
- 30. Lacchini R, Jacob‐Ferreira AL, Luizon MR, et al. Matrix metalloproteinase 9 gene haplotypes affect left ventricular hypertrophy in hypertensive patients. Clin Chim Acta. 2010;411:1940–1944. [DOI] [PubMed] [Google Scholar]
- 31. Lelongt B, Ronco P. Role of matrix metalloproteinases in kidney development and glomerulopathy: lessons from transgenic mice. Nephrol Dial Transplant. 2002;17:28–31. [DOI] [PubMed] [Google Scholar]
- 32. Medley TL, Cole TJ, Dart AM, et al. Matrix metalloproteinase‐9 genotype influences large artery stiffness through effects on aortic gene and protein expression. Arterioscler Thromb Vasc Biol. 2004;24:1479–1484. [DOI] [PubMed] [Google Scholar]
- 33. Blankenberg S, Rupprecht HJ, Poirier O, et al. Plasma concentrations and genetic variation of matrix metalloproteinase 9 and prognosis of patients with cardiovascular disease. Circulation. 2003;107:1579–1585. [DOI] [PubMed] [Google Scholar]
- 34. Lamblin N, Bauters C, Hermant X, et al. Polymorphisms in the promoter regions of MMP‐2, MMP‐3, MMP‐9 and MMP‐12 genes as determinants of aneurysmal coronary artery disease. J Am Coll Cardiol. 2002;40:43–48. [DOI] [PubMed] [Google Scholar]
- 35. Kim JS, Park HY, Kwon JH, et al. The roles of stromelysin‐1 and the gelatinase B gene polymorphism in stable angina. Yonsei Med J. 2002;43:473–481. [DOI] [PubMed] [Google Scholar]
- 36. Sundl I, Roob JM, Meinitzer A, et al. Antioxidant status of patients on peritoneal dialysis: associations with inflammation and glycoxidative stress. Perit Dial Int. 2009;9:89–101. [PubMed] [Google Scholar]
- 37. Kocak H, Gumuslu S, Sahin E, et al. Advanced oxidative protein products are independently associated with endothelial function in peritoneal dialysis patients. Nephrology. 2009;14:273–280. [DOI] [PubMed] [Google Scholar]
- 38. Raju D, Lalitha D, Kiranmayi P. A study of lipid profile and lipid peroxidation in chronic kidney disease with special reference to hemodialysis. J Clin Res Bioeth. 2013;4:143. [Google Scholar]
- 39. Yilmaz MI, Saglam M, Caglar K, et al. The determinants of endothelial dysfunction in CKD: oxidative stress and asymmetric dimethylarginine. Am J Kidney Dis. 2006;4:42–50. [DOI] [PubMed] [Google Scholar]
- 40. Annuk M, Soveri I, Zilmer M, et al. Endothelial function, CRP and oxidative stress in chronic kidney disease. J Nephrol. 2005;18:721–726. [PubMed] [Google Scholar]
- 41. Schiffrin E, Lipman ML, Mann JF. Chronic kidney disease: effects on the cardiovascular system. Circulation. 2007;116:85–97. [DOI] [PubMed] [Google Scholar]
- 42. Agharazii M, St‐Louis R, Gautier‐Bastien A, et al. Inflammatory cytokines and reactive oxygen species as mediators of chronic kidney disease‐related vascular calcification. Am J Hypertens. 2015;28:746–755. [DOI] [PubMed] [Google Scholar]