Skip to main content
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2018 May 4;32(7):e22562. doi: 10.1002/jcla.22562

Association of VDR gene polymorphisms and 22 bp deletions in the promoter region of TLR2Δ22 (‐196‐174) with increased risk of pulmonary tuberculosis: A case‐control study in tea garden communities of Assam

Kangjam Rekha Devi 1,✉, Kaustab Mukherjee 1, Pradipta Kumar Chelleng 1, Simanta Kalita 1, Upasana Das 1, Kanwar Narain 1
PMCID: PMC6817153  PMID: 29727015

Abstract

Background

A high number of pulmonary tuberculosis (PTB) cases have been reported from tea garden communities of Assam. Till date, no molecular epidemiological study was performed to investigate the association of candidate gene(s) with the risk PTB in this region. The present case‐control study was aimed to investigate the association of vitamin D receptor (VDR) gene polymorphisms and 22 bp deletion in the promoter region of toll‐like receptor 2 (TLR2) gene with the risk of PTB in tea garden communities of Assam.

Methods

Genotyping of VDR polymorphisms and TLR2Δ22 (‐196‐174) gene was carried out for 169 PTB cases and 227 apparently healthy community controls using blood samples by PCR‐RFLP followed by DNA sequencing. For association study, both univariate and multivariate logistic regression analyses were performed.

Results

This study has shown that BsmI and FokI polymorphisms of VDR gene significantly associated with an increased risk of PTB (AOR = 3.58, 95% CI = 1.64‐7.80, P < .01 for B/b genotype of BsmI and AOR = 2.44, 95% CI = 1.40‐4.24, P < .01 for F/f genotype of FokI polymorphism). No significant association of TaqI and ApaI polymorphism of VDR gene was found with the risk of PTB. Moreover, this study has revealed that person carrying deletion allele in their TLR2Δ22 (‐196‐174) gene is significantly associated with an increased risk of PTB having b/b or F/f genotypes in BsmI or FokI polymorphisms of VDR gene.

Conclusion

This study has revealed that BsmI and FokI polymorphisms of VDR gene significantly associated with an increased risk of PTB.

Keywords: gene‐gene interaction, infection, innate immunity, molecular epidemiology

1. INTRODUCTION

Tuberculosis (TB) is a global health problem affecting 32% of the total world's population.1 Revised National TB Control Program (RNTCP) has reported pulmonary TB (PTB) as one of the major public health concerns in India.2 Moreover, epidemiological studies have shown that in northeastern (NE) region of India, PTB is one of the important infectious diseases caused by different strains of Mycobacterium tuberculosis complex.3 RNTCP report has revealed high number of PTB cases in tea garden communities of Assam (RNTCP report, 2015). Molecular epidemiological studies have shown that host genetic factors significantly influence the individual susceptibility to PTB.4 Moreover, in recent years, clinical studies have hypothesized that genotyping of immune genes in host genome may be beneficial to understand the host genetic susceptibility to PTB.5 Thus, it is an utmost need to identify genetic factors significantly associated with the increased risk of PTB in endemic regions.6 Earlier our epidemiological surveys revealed that low BMI (<18.5), family history of TB, and alcohol consumption significantly increased the risk of PTB in tea garden communities of Assam.7 In this study, we examined the association of VDR and TLR2 gene polymorphisms with the risk of PTB.

Immunological studies have shown that in the host immune system, antigen presentation of M. tuberculosis is mediated through the mannose receptors (MRs) and complement receptors (CRs) present on the surface of the antigen presenting cells (APCs) followed by the activation of toll‐like receptors (TLRs).8 Molecular epidemiological studies have revealed that single nucleotide polymorphisms (SNPs) or mutations in immune genes in host genome significantly increased the susceptibility to PTB infection.9 Studies have shown that defective immune response in M. tuberculosis infection due to altered genetic makeup in the host immune system is significantly associated with an increased risk of PTB in different ethnic groups globally.10 Thus, genotyping studies of candidate immune genes to find out their association with the risk of PTB have gained much attention globally.11

Vitamin D receptor (VDR) is a nuclear receptor family transcription factor12 present in lungs, thymus and T‐lymphocytes, neutrophils and antigen presenting cells (APCs).13 In human, VDR gene is located on chromosome number 12 (12q12‐14) and contain 16 exons.12 Genetic studies have shown more than 25 known polymorphisms in VDR gene14 in which most commonly studied polymorphisms are ApaI variant at intron VIII, TaqI variant at exon IX, FokI variant at exon II, and BsmI variants at intron VIII.12 Studies have revealed significant association of VDR gene polymorphism with the risk of PTB in different ethnic population globally although the results are inconsistent and variations persist between different ethnic groups.13, 15, 16, 17, 18

Toll‐like receptors are trans‐membrane receptors present on the surface of immune cell types, mostly APCs.19 Molecular studies have shown that TLRs play a crucial role in innate immune system as pathogen‐associated molecular patterns recognition receptors.8 Activation of TLRs on APCs by the receptor‐ligand interaction between M. tuberculosis antigen and TLRs initiates signaling cascade by the release of cytokines and chemokines from the immune cells to maintain the milieu of inflammatory responses.19 A 22 base pair (bp) nucleotide deletion in the promoter region of TLR2 gene has been found to alter the promoter activity.20 Epidemiological studies have shown that TLR2Δ22 (‐196‐174) significantly associated with an increased risk of PTB in Taiwanese21 and Pakistani populations22 although results are inconsistent.23

Earlier no molecular epidemiological study was performed to investigate the association of VDR polymorphisms and 22 bp deletion in the promoter region of TLR2Δ22 (‐196‐174) gene with the risk of PTB in tea garden communities of Assam. Thus, the present case‐control study was carried out to explore the association of 4 common polymorphisms of VDR gene, namely BsmI, FokI, TaqI, and ApaI and 22 bp deletion in the promoter region of TLR2Δ22 (‐196‐174) gene with the risk of PTB in this endemic region.

2. MATERIAL AND METHODS

2.1. Study subjects and specimen collection

This study was conducted from 2010 to 2012 in 30 tea gardens of Assam. Among the total 379 tea gardens of the 4 districts in Assam viz, Dibrugarh, Jorhat, Sivasagar, and Tinsukia, a sample of 30 tea gardens was selected using PPS systematic cluster sampling technique. PTB patients were identified through the community screening program. Door to door mass surveys were carried out in selected tea gardens. Sputum samples were collected from each clinically suspected patient following RNTCP guidelines. All sputum samples were examined for AFB staining. Apparently healthy controls were also recruited from the community from where PTB cases were found. Controls had no sign of PTB as well as their sputum smear was found to be AFB negative. The study design was unmatched case‐control study. For the present case‐control study, we recruited sputum and culture positive 169 incident pulmonary TB (PTB) cases and 227 apparently healthy community controls from neighborhood of the cases.

Information on socio‐demographic factors, anthropogenic measures, and dietary habits was collected from each study participant by conducting face‐to‐face interviews, and information gathered was recorded in a predesigned questionnaire. About 3 mL of peripheral blood was collected from each study participant in EDTA‐containing vial after getting written informed consent from them and stored at −80°C ultra‐freezer until analyzed.

2.2. DNA isolation and genotyping

Isolation of DNA for genotyping was carried out using Qiagen DNeasy(R) Blood kit (Qiagen, Germany). Genotyping of 4 polymorphisms of VDR gene viz. BsmI, FokI, TaqI, and ApaI was carried out by polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP), whereas allele‐specific primers were used for genotyping study of TLR2Δ22 (‐196‐174). The primer sequences, amplification temperature, restriction enzymes, and fragment sizes have shown in Table 1. Briefly, the PCR was performed for VDR genotyping study in a 25 μL reaction mixture containing 0.5 μL 10 pmol of each primer (IDT), 12.5 μL 2X GoTaq Hot start DNA polymerase master mix (Promega, Madison, WI, USA), 8.5 μL nuclease free water (Promega), 0.5 μL 25 mmol MgCl2 (Promega), 0.5 μL 3% trehalose (Sigma, USA), and 0.3 μg genomic DNA. Amplified products were checked in 1.5% agarose gel electrophoresis. PCR products were then digested overnight with BsmI, FokI, TaqI, and ApaI restriction endonucleases (New England Biolabs, Beverly, MA, USA) and visualized in 2.5% agarose gel electrophoresis. Conditions for restriction enzyme digestion and data interpretation have been presented in Table 2. Genotyping of TLR2Δ22(‐196‐174) was performed using allele‐specific primer pairs as described earlier.24, 25 The amplified PCR products of TLR2Δ22 (‐196‐174) were run on 10% polyacrylamide gel electrophoresis (PAGE), and gel images was captured in a gel documentation system.

Table 1.

Primer sequences, PCR conditions, and PCR product sizes of VDR polymorphisms and TLR2∆22 (‐196‐174)

SNP (rs no) Location Allele name Common name Primers (5′‐3′) PCR condition PCR product size (bp)
VDR polymorphisms
BsmI (rs1544410) Intron VIII A B Forward‐CAACCAAGACTACAAGTACCGCGTCAGTGA Denaturation‐96°C (4 min) 825
G b Reverse‐AACCAGCGGGAAGAGGTCAAGGG 35 cycles:
94°C (30 s)
63°C (30 s)
72°C (60 s)
Extension‐72°C (2 min)
FokI (rs228570) Exon II C F Forward‐AGCTGGCCCTGGCACTGACTCTGGCT Denaturation‐96°C (4 min) 267
T f Reverse‐ATGGAAACACCTTGCTTCTTCTCCCTC 30 cycles:
94°C (45 s)
57°C (30 s)
72°C (45 s)
Extension‐72°C (5 min)
TaqI (rs731236) Exon IX T T Forward‐CAGAGCATGGACAGGGAGCAAG Denaturation‐96°C (5 min) 720
C t Reverse‐GCAACTCCTCATGGCTGAGGTCTCA 28 cycles:
93°C (45 s)
66°C (30 s)
72°C (45 s)
Extension‐72°C (5 min)
ApaI (rs7975232) Intron VIII C A Forward‐CAGAGCATGGACAGGGAGCAAG Denaturation‐96°C (5 min) 720
A a Reverse‐GCAACTCCTCATGGCTGAGGTCTCA 28 cycles:
93°C (45 s)
66°C (30 s)
72°C (45 s)
Extension‐72°C (5 min)
22 bp deletion in the promoter region of TLR2∆22 (‐196‐174)
TLR2∆22 (‐196‐174) Promoter region Forward‐CACGGAGGCAGCGAGAAA Denaturation‐95°C (5 min) I/I = 286
Reverse‐CTGGGCCGTGCAAAGAAG 35 cycles: I/D = 286 264
D/D = 264
95°C (30 s)
60°C (40 s)
72°C (40 s)
Extension‐72°C (7 min)

I, insertion; D, deletion; bp, base pairs.

Table 2.

Conditions for restriction enzymes digestion and size (bp) of digested products for VDR gene polymorphism and product size of allele‐specific PCR of TLR2∆22 (‐196‐174)

SNP Restriction enzyme Incubation time Temperature Product size (bp)
BsmI (rs2228570) BsmI Overnight 37°C BB = 825
Bb = 825 650 175
Bb = 650 175
FokI (rs2228570) FokI Overnight 37°C FF = 305
Ff = 305 190 115
ff = 190 115
TaqI (rs731236) TaqI Overnight 37°C TT = 494 251
Tt = 494 251 293 201
Tt = 293 251 201
ApaI (rs7975232) ApaI Overnight 37°C AA = 745
Aa = 745 528 217
Aa = 217 518
TLR2∆22 (‐196‐174) Allele‐specific PCR — — I/I = 286
I/D = 286 264
D/D = 264

2.3. Statistical analysis

To determine the association of VDR gene polymorphisms and 22 bp deletion in the promoter region of TLR2Δ22 (‐196‐174) gene with risk of PTB, both univariate and multivariate logistic regression analyses were performed using SPSS ver17.0 (SPSS Inc., Chicago, IL, USA). Initially, we carried out univariate logistic regression analysis for both VDR and TLR2Δ22 (‐196‐174) genes to determine the crude odds ratio (OR) and 95% confidence interval (CI). Multivariate logistic regression analysis was performed for adjustment of confounding variables such as age, sex, alcohol consumption and tobacco smoking and/or chewing habit. For multiple logistic regression analysis, we did not use backward or forward elimination for variable selection (value for entry 0.05 and removal 0.01), instead we entered all the confounding variables in the multiple regression equation for adjustment (in addition to the study variables). A P‐value <.05 (CI) was taken as statistically significant. Moreover, gender‐specific univariate and multivariate logistic regression analysis was also performed. The study population was stratified into two strata based on their TLR2Δ22(‐196‐174) genotypes viz. group I having I/I genotype and group II having I/D‐D/D genotype. Both univariate and multivariate logistic regression analyses were carried out of stratified data. Before performing the association study, Hardy‐Weinberg equilibrium (HWE) for allele frequencies was tested by using chi‐squared test.

2.4. Ethics statement

The study was approved by Institutional Human Ethics Committee of ICMR‐Regional Medical Research Centre, N.E. Region, Dibrugarh. All study participants, both cases and controls, provided their written consent to be included in this study.

3. RESULTS

3.1. Demographic features of study participants

The present case‐control study comprised of 169 newly diagnosed pulmonary tuberculosis (PTB) cases. Among 169 PTB cases, 106 cases were male and 63 were female. A total of 227 apparently healthy control study participants (134 males and 93 females) were also included in this study by organizing community surveys from neighborhood of the cases. The demographic features of both cases and controls have been tabulated in Table 3.

Table 3.

Demographic features of study population

Demographic features Total study population PTB cases Apparently healthy controls
Age groups in years (n = 396) (n = 169) (n = 227)
<30 y 161 68 93
30‐45 y 189 84 105
>45 y 46 17 29
Mean age ± SD in years (n = 396) (n = 169) (n = 227)
33.07 ± 10.56 32.63 ± 10.36 33.40 ± 10.73
Gender of the study participants (n = 396) (n = 169) (n = 227)
Male 240 106 134
Female 156 63 93
Smoking and/or alcohol consumption (n = 323) (n = 123) (n = 200)
Never 161 64 97
Only alcohol 111 39 72
Only smoking 4 2 2
Both 47 18 29

PTB, pulmonary tuberculosis; SD, standard deviation.

3.2. Test for Hardy‐Weinberg equilibrium

Before carrying out the association study, genotypic data of 4 polymorphisms of VDR gene (BsmI, FokI, TaqI, and ApaI) and TLR2Δ22 (‐196‐174) for control samples were tested for Hardy‐Weinberg equilibrium (HWE). The genotypes of BsmI (P = .948 for control), FokI (P = .864 for control), TaqI (P = .143 for control) and ApaI (P = .225 for control) and TLR2Δ22 (‐196‐174) (P = .936 for control) did not deviate from HWE.

3.3. Association of BsmI, FokI, TaqI, and ApaI polymorphisms of VDR gene and TLR2Δ22 (‐196‐174) with the risk of PTB in tea garden communities of Assam, NE region of India

To investigate the association of BsmI, FokI, TaqI, and ApaI polymorphisms of VDR gene and 22 bp deletion at promoter region of TLR2Δ22 (‐196‐174) gene with the risk of PTB, both univariate and multivariate logistic regression analyses were performed. Univariate logistic regression analysis found that BsmI and FokI polymorphisms of VDR gene significantly associated with an increased risk of PTB (AOR = 3.58, 95% CI = 1.64‐7.80, P < .01 for B/b genotype of BsmI polymorphism and AOR = 2.44, 95% CI = 1.40‐4.24, P < .01 for F/f genotype of FokI polymorphism; Table 4). This study did not reveal any significant association of TaqI and ApaI polymorphisms of VDR gene and TLR2Δ22 (‐196‐174) with the risk of PTB (Table 4).

Table 4.

Association of VDR gene polymorphisms and 22 bp deletion at promoter region of TLR2 gene (TLR2∆22) with risk of PTB in tea garden communities of Assam, NE region of India

Genotypes Cases (n = 169) Controls (n = 227) Crude OR (95% CI) P‐value AOR (95% CI) P‐value
BsmI polymorphism
Codominant model
B/B 24 56 Ref Ref
B/b 100 113 2.06 (1.19‐3.57) .01 3.58 (1.64‐7.80) .00a
b/b 45 58 1.81 (0.97‐3.35) .05 2.56 (1.11‐5.93) .02a
Dominant model
B/B 24 56 Ref Ref
B/b‐b/b 145 171 1.97 (1.16‐3.35) .01 3.16 (1.50‐6.66) .00a
Recessive model
B/b‐b/b 124 169 Ref Ref
b/b 45 58 1.05 (0.67‐1.66) .80 0.99 (0.56‐1.76) .98
FokI polymorphism
Codominant model
F/F 59 119 Ref Ref
F/f 106 90 2.37 (1.56‐3.61) .00 2.44 (1.40‐4.24) .00a
f/f 4 18 0.44 (0.14‐1.38) .16 0.26 (0.05‐1.40) .12
Dominant model
F/F 59 119 Ref Ref
F/f‐f/f 110 108 2.05 (1.36‐3.09) .00 1.98 (1.16‐3.36) .01a
Recessive model
F/f‐f/f 165 209 Ref Ref
f/f 4 18 0.28 (0.09‐0.84) .02 0.18 (0.03‐0.94) .04a
TaqI polymorphism
Codominant model
T/T 86 116 Ref Ref
T/t 73 86 1.14 (0.75‐1.74) .52 1.08 (0.61‐1.90) .77
t/t 10 25 0.54 (0.24‐1.18) .12 0.47 (0.17‐1.31) .15
Dominant model
T/T 86 116 Ref Ref
T/t‐t/t 83 111 1.00 (0.67‐1.50) .96 0.93 (0.54‐1.57) .78
Recessive model
T/t‐t/t 159 202 Ref Ref
t/t 10 25 0.50 (0.23‐1.08) .08 0.45 (0.17‐1.23) .45
ApaI polymorphism
Codominant model
A/A 36 49 Ref Ref
A/a 83 103 1.09 (0.65‐1.84) .72 1.10 (0.57‐2.12) .76
a/a 50 75 0.90 (0.51‐1.58) .73 0.83 (0.40‐1.70) .61
Dominant model
A/A 36 49 Ref Ref
A/a‐a/a 133 178 1.01 (0.62‐1.65) .94 0.98 (0.53‐1.81) .97
Recessive model
A/a‐a/a 119 152 Ref Ref
a/a 50 75 0.85 (0.55‐1.31) .46 0.77 (0.44‐1.37) .38
TLR2∆22 (‐196‐174)
Codominant model
I/I 110 139 Ref Ref
I/D 55 77 0.90 (0.58‐1.38) .63 0.80 (0.46‐1.39) .43
D/D 4 11 0.46 (0.14‐1.48) .19 0.26 (0.05‐1.30) .10
Dominant model
I/I 110 139 Ref Ref
I/D‐D/D 59 88 0.84 (0.56‐1.28) .43 0.72 (0.42‐1.24) .24
Recessive model
I/I‐I/D 165 216 Ref Ref
D/D 4 11 0.47 (0.14‐1.52) .21 0.28 (0.05‐1.40) .12

OR, odds ratio; AOR, adjusted odds ratio, adjusted for age, sex and tobacco and/or alcohol consumption habit; CI, confidence interval.

a

Statistically significant (P < .05).

Gender‐specific analysis of VDR gene and TLR2Δ22 (‐196‐174) polymorphisms by both univariate and multivariate logistic regression analyses has shown that BsmI and FokI polymorphisms of VDR gene associated with an increased risk of PTB in both male (AOR = 3.81, 95% CI = 1.32‐10.98, P < .05 for B/b genotype of BsmI polymorphism and AOR = 3.42, 95% CI = 1.57‐7.47, P < .01 for F/f genotype of FokI polymorphism) and female study participants (AOR = 2.40, 95% CI = 1.23‐4.69, P < .05 for F/f genotype of FokI polymorphism; Table 5).

Table 5.

Gender‐specific association of VDR gene polymorphism and 22 bp deletion at TLR2∆22 (‐196‐174) gene with risk of PTB in tea garden communities of Assam, NE region of India

Genotypes Male study participants Female study participants
Cases (n = 106) Controls (n = 134) Crude OR (95% CI) P‐values AOR (95% CI) P‐values Cases (n = 63) Controls (n = 93) Crude OR (95% CI) P‐values AOR (95% CI) P‐values
BsmI Polymorphism
Codominant
B/B 14 32 Ref Ref 10 24 Ref Ref
B/b 64 68 2.15 (1.05‐4.39) .03 3.81 (1.32‐10.98) .01 36 45 1.92 (0.81‐4.52) .13 3.60 (0.89‐14.46) .07
b/b 28 34 1.88 (0.84‐4.20) .12 2.50 (0.7‐8.12) .12 17 24 1.70 (0.64‐4.46) .28 3.99 (0.94‐16.91) .06
Dominant
B/B 14 32 Ref Ref 10 24 Ref Ref
B/b‐b/b 92 102 2.06 (1.03‐4.10) .03 3.33 (1.19‐9.28) .02 53 69 1.84 (0.81‐4.18) .14 3.76 (1.01‐13.96) .04a
Recessive
B/b‐b/b 78 100 Ref Ref 46 69 Ref Ref
b/b 28 34 1.05 (0.59‐1.88) .85 0.91 (0.40‐2.05) .82 17 24 1.06 (0.51‐2.19) .87 1.59 (0.58‐4.33) .36
FokI Polymorphism
Codominant
F/F 37 70 Ref Ref 22 49 Ref Ref
F/f 65 52 2.36 (1.37‐4.05) .00 3.42 (1.57‐7.47) .00 41 38 2.40 (1.23‐4.69) .01 2.03 (0.81‐5.09) .128
f/f 4 12 0.63 (0.19‐2.09) .45 0.37 (0.05‐2.56) .31 0 6 — — — —
Dominant
F/F 37 70 Ref Ref 22 49 Ref Ref
F/f‐f/f 69 64 2.04 (1.20‐3.44) .00 2.66 (1.26‐5.60) .01 41 44 2.07 (1.07‐4.01) .03 2.02 (0.80‐5.06) .13
Recessive
F/f‐f/f 102 122 Ref Ref 63 87 Ref Ref
f/f 4 12 0.39 (0.12‐1.27) .12 0.21 (0.03‐1.41) .10 0 6 — — — —
TaqI Polymorphism
Codominant
T/T 66 50 Ref Ref 36 50 Ref Ref
T/t 49 49 1.32 (0.76‐2.26) .31 1.59 (0.73‐3.46) .23 24 37 0.90 (0.46‐1.75) .76 0.76 (0.28‐2.06) .60
t/t 19 7 0.48 (0.19‐1.24) .13 0.34 (0.08‐1.37) .13 3 6 0.69 (0.16‐2.96) .62 1.20 (0.18‐7.82) .84
Dominant
T/T 50 66 Ref Ref 36 50 Ref Ref
T/t‐t/t 56 68 1.08 (0.65‐1.81) .74 1.17 (0.56‐2.42) .67 27 43 0.87 (0.45‐1.66) .67 0.82 (0.32‐2.10) .69
Recessive
T/t‐t/t 99 115 Ref Ref 60 87 Ref Ref
t/t 7 19 0.42 (0.17‐1.06) .67 0.27 (0.07‐1.04) .05 3 6 0.72 (0.17‐3.01) .65 1.32 (0.21‐8.30) .76
ApaI Polymorphism
Codominant
A/A 21 29 Ref Ref 15 20 Ref Ref
A/a 51 63 1.11 (0.57‐2.18) .74 1.17 (0.48‐2.87) .72 32 40 1.06 (0.47‐2.41) .87 1.01 (0.31‐3.28) .97
a/a 34 42 1.11 (0.54‐2.29) .76 1.18 (0.44‐3.13) .73 16 33 0.64 (0.26‐1.58) .34 0.54 (0.15‐1.95) .35
Dominant
A/A 21 29 Ref Ref 15 20 Ref Ref
A/a‐a/a 85 105 1.11 (0.59‐2.09) .72 1.17 (0.51‐2.71) .70 48 73 0.87 (0.40‐1.87) .73 0.79 (0.27‐2.33) .67
Recessive
A/a‐a/a 72 92 Ref Ref 47 60 Ref Ref
a/a 34 42 1.03 (0.59‐1.78) .90 1.06 (0.49‐2.28) .87 16 33 0.61 (0.30‐1.25) .18 0.54 (0.19‐1.51) .24
TLR2∆22 (‐196‐174)
Codominant
I/I 71 83 Ref Ref 39 56 Ref Ref
I/D 32 47 0.79 (0.45‐1.37) .41 0.88 (0.41‐1.89) .75 23 30 1.10 (0.55‐2.13) .78 1.48 (0.53‐4.12) .45
D/D 3 4 0.87 (0.19‐4.04) .86 0.30 (0.02‐3.34) .32 1 7 0.20 (0.02‐1.73) .14 0.15 (0.01‐1.60) .11
Dominant
I/I 71 83 Ref Ref 39 56 Ref Ref
I/D‐D/D 35 51 0.80 (0.47‐1.36) .41 0.81 (0.38‐1.70) .58 24 37 0.93 (0.48‐1.79) .83 0.99 (0.38‐2.52) .98
Recessive
I/I‐I/D 103 130 Ref Ref 62 86 Ref Ref
D/D 3 4 0.94 (0.20‐4.32) .94 0.31 (0.02‐3.44) .34 1 7 0.19 (0.02‐1.65) .13 0.13 (0.01‐1.42) .09

OR, odds ratio; AOR, adjusted odds ratio, adjusted for age, sex and tobacco smoking and/or chewing and alcohol consumption habit; CI, confidence interval.

a

Statistically significant (P < .05).

Moreover, to identify relation between TLR2∆22 and VDR gene with the risk of PTB, the study population was stratified into two strata based on their TLR2∆22 (‐196‐174) genotypes. Group 1 comprised of study participants with I/I genotype, whereas group 2 study participants having I/D‐D/D genotype in their TLR2∆22 (‐196‐174) gene. For association study, both univariate and multivariate logistic regression analyses were performed. Stratified logistic regression analysis has shown that BsmI polymorphism significantly associated with an increased risk of PTB (AOR = 30.43, 95% CI = 2.42‐382.72, P < .01 for B/b genotype and AOR = 42.11, 95% CI = 3.05‐581.34, P < .01 for b/b genotype) in those people who were carrying 22 bp deletion (I/D‐D/D genotype) in the promoter region of their TLR2 gene in comparison with those having I/I genotype (Table 6). Multivariate logistic regression analysis of stratified data has also revealed that FokI polymorphism is significantly associated with an increased risk of PTB in persons carrying 22 bp deletion in the promoter region of their TLR2∆22 gene (AOR = 4.96, 95% CI = 1.48‐16.63, P < .01 for F/f genotype; Table 6). This study has also explored that t/t genotype of TaqI polymorphism of VDR gene is significantly associated with an increased risk of PTB in persons carrying I/I genotype in their TLR2 gene (AOR = 2.38, 95% CI = 1.08‐5.23, P < .05), whereas T allele of TaqI polymorphism of VDR gene is significantly protective with the risk of PTB in persons carrying 22 bp deletion in the promoter region of their TLR2 gene (AOR = 0.05, 95% CI = 0.004‐0.828, P < .05) (Table 6).

Table 6.

Association of VDR gene polymorphism with risk of PTB in tea garden communities of Assam, NE region of India, stratified on the basis of their TLR2∆22 (‐196‐174) genotype status

Genotypes Study participants having I/I genotype in TLR2 gene Study participants having I/D‐D/D genotype in TLR2 gene
Cases (n = 110) Controls (n = 139) Crude OR (95% CI) P‐values AOR (95% CI) P‐values Cases (n = 59) Controls (n = 88) Crude OR (95% CI) P‐values AOR (95% CI) P‐values
BsmI Polymorphism
Codominant
B/B 18 34 Ref Ref 6 22 Ref Ref
B/b 63 68 1.75 (0.89‐3.40) .10 2.82 (1.06‐7.53) .03a 37 45 3.01 (1.10‐8.21) .03 30.43 (2.42‐382.72) .00a
b/b 29 37 1.48 (0.69‐3.13) .30 1.60 (0.54‐4.72) .39 16 21 2.79 (0.91‐8.49) .07 42.11 (3.05‐581.34) .00a
Dominant
B/B 18 34 Ref Ref 6 22 Ref Ref
B/b‐B/b 92 105 1.65 (0.87‐3.12) .12 2.32 (0.91‐5.91) .07 53 66 2.94 (1.11‐7.78) .03 34.10 (2.78‐417.59) .00a
Recessive
B/B‐B/b 81 102 Ref Ref 43 67 Ref Ref
b/b 29 37 0.98 (0.56‐1.74) .96 0.74 (0.33‐1.63) .46 16 21 1.18 (0.55‐2.52) .65 2.48 (0.79‐7.81) .11
FokI Polymorphism
Codominant
F/F 40 72 Ref Ref 19 47 Ref Ref
F/f 66 60 1.98 (1.17‐3.33) .01 2.28 (1.11‐4.67) .02a 40 30 3.29 (1.61‐6.72) .00 4.96 (1.48‐16.63) .00a
f/f 4 7 1.02 (0.28‐3.72) .96 1.22 (0.17‐8.39) .83 0 11 — — — —
Dominant
F/F 40 72 Ref Ref 19 47 Ref Ref
F/f‐F/f 70 67 1.88 (1.12‐3.13) .01 2.18 (1.07‐4.42) .03a 40 41 2.41 (1.21‐4.80) .01 2.56 (0.87‐7.49) .08
Recessive
F/F‐F/f 106 132 Ref Ref 59 77 Ref Ref
f/f 4 7 0.71 (0.20‐2.49) .59 0.80 (0.12‐5.20) .81 0 11 — — — —
TaqI Polymorphism
Codominant
T/T 55 81 Ref Ref 31 35 Ref Ref
T/t 48 44 1.60 (0.94‐2.73) .08 2.38 (1.08‐5.23) .03 25 42 0.67 (0.33‐1.34) .26 0.46 (0.14‐1.47) .19
t/t 7 14 0.73 (0.27‐1.94) .53 1.03 (0.29‐3.67) .95 3 11 0.30 (0.07‐1.20) .09 0.05 (0.00‐0.82) .03a
Dominant
T/T 55 81 Ref Ref 31 35 Ref Ref
T/t‐t/t 55 58 1.39 (0.84‐2.31) .19 1.97 (0.95‐4.09) .06 28 53 0.59 (0.30‐1.16) .12 0.36 (0.11‐1.11) .07
Recessive
T/T‐ T/t 103 125 Ref Ref 56 77 Ref Ref
t/t 7 14 0.60 (0.23‐1.56) .30 0.74 (0.22‐2.51) .63 3 11 0.37 (0.10‐1.40) .14 0.09 (0.00‐1.20) .00a
ApaI Polymorphism
Codominant
A/A 27 30 Ref Ref 9 19 Ref Ref
A/a 49 64 0.85 (0.44‐1.61) .62 0.79 (0.34‐1.84) .58 34 39 1.84 (0.73‐4.00) .19 3.27 (0.70‐15.24) .13
a/a 34 45 0.84 (0.42‐1.66) .61 0.67 (0.26‐1.69) .40 16 30 1.12 (0.41‐3.05) .81 1.68 (0.29‐9.50) .55
Dominant
A/A 27 30 Ref Ref 9 19 Ref Ref
A/a‐A/a 83 109 0.84 (0.46‐1.53) .58 0.74 (0.34‐1.61) .45 50 69 1.53 (0.63‐3.66) .34 2.72 (0.61‐12.11) .18
Recessive
A/A‐A/a 76 94 Ref Ref 47 60 Ref Ref
a/a 34 45 0.93 (0.54‐1.60) .80 0.78 (0.36‐1.66) .52 16 33 0.71 (0.34‐1.48) .37 0.63 (0.20‐2.03) .44

OR, odds ratio; AOR, adjusted odds ratio, adjusted for age, sex and tobacco smoking and/or chewing and alcohol consumption habit; CI, confidence interval.

a

Statistically significant (P < .05).

4. DISCUSSION

Epidemiological surveys have revealed that susceptibility to M. tuberculosis infection significantly varies in different ethnic groups globally.26 Molecular epidemiological studies in last decade hypothesized that susceptibility to M. tuberculosis infection in different ethnic populations may be due to deficiency of circulatory vitamin D,27 a potent stimulator for macrophages to phagocytose invading bacilli of M. tb.26, 28 However, twin studies have revealed that individual host genetic factors are major determinant in M. tuberculosis infection in different ethnic populations.4, 29 In recent years, case‐control studies in different ethnic groups have explored the association of candidate genes in susceptibility to PTB, however, some studies in this context have also been found to be statistically under powered.29 Keeping these in view, several case‐control studies have been carried out by different group of researchers on different ethnic populations to explore the association of VDR and TLR gene polymorphisms with an increased risk of PTB but results are inconsistent and inconclusive (Figures S1 and S2).

Vitamin D inhibits B‐cell proliferation and differentiation to inhibit immunoglobulin secretion.30 In vitro studies have shown that Epstein bar virus (EBV) downregulate the expression of VDR gene on B cells.11 Vitamin D suppresses T‐cell proliferation and stimulates the conversion from Th1 phenotype to Th2 phenotype.11 Molecular studies have shown that vitamin D acts as one of the important immune modulators and exerts its action through VDR‐TLR‐CD14 crosstalk at the time of infection.31 Moreover, studies have also shown that TLR activation on human macrophage and monocytes significantly associated with the upregulation of VDR gene expression against microbial pathogens.32 Genetic studies have found significant correlation between VDR gene expression and alternation in circulatory cytokine milieu in inflammatory response during M. tuberculosis infection.33 Moreover, studies have shown that M. tuberculosis infection downregulates the VDR gene expression on macrophages.34

Epidemiological studies have revealed that VDR gene polymorphism is significantly associated with an increased risk of PTB in Venezuela,35 Iran,36 Turkey,37 and Han Taiwanese populations.38 Molecular epidemiological studies have also revealed that VDR polymorphism is significantly associated with an increased risk of PTB in tribal population of Chhattisgarh and southeastern region of India.39 One meta‐analysis study, comprised of 32 studies with 4894 cases and 5319 controls, has shown that FokI polymorphism of VDR gene significantly associated with an increased risk of HIV negative PTB in Asian population,40 whereas another meta‐analysis study, comprising 15 studies with 2309 cases and 3568 controls, has explored that BsmI polymorphism of VDR gene is significantly protective of PTB in Asian population.41 However, one hospital‐based case‐control study on Gujarati population lived in UK has revealed no association of VDR gene polymorphism with the risk of PTB although they have shown significant association of 25‐hydroxycholecalciferol deficiency with increased risk of PTB.13 Similarly, one case‐control study from Africa has shown no significant association of VDR gene polymorphism with the risk of PTB, whereas they have shown that BsmI, ApaI, and TaqI variants of VDR gene have strong linkage disequilibrium and significantly associated with the anti‐TB treatment outcome.42 Moreover, another study from Peru has reported that polymorphism of VDR gene is significantly associated with PTB treatment regime.43 This study has also shown that vitamin D metabolites interact with macrophages to counter M. tuberculosis antigen through VDR in PTB patients during anti‐TB treatment regime.43 Recently, one group from South India has carried out an extensive study to measure 25‐hydroxycholecalciferol level and genotyping of VDR gene in both PTB patients and their household contacts and have found that BsmI and FokI polymorphisms of VDR gene are significantly associated with an increased risk of PTB.44

The present case‐control study has revealed that both BsmI and FokI polymorphisms of VDR gene are significantly associated with an increased risk of PTB in tea garden communities of Assam (Table 4). Moreover, gender‐specific analysis in the present study has also shown that BsmI and FokI polymorphisms of VDR gene are significantly associated with an increased risk of PTB in both male and female study participants in this endemic region (Table 5). However, we did not find any significant association of TaqI and ApaI polymorphisms of VDR gene with the risk of PTB (Tables 4 and 5).

Till date several polymorphisms and/or mutations in TLR2 gene have been studied extensively in different ethno‐cultural populations throughout the globe.45 Epidemiological studies have revealed that T597C (rs3804099), R677W (no rs number), and R753Q (rs5743708) polymorphisms of TLR2 gene significantly associated with an increased risk of PTB in Chinese population,46 whereas G2258A (rs5743708) and R753Q (rs5743708) polymorphisms significantly associated with an increased risk of PTB in Korean,23 Turkish,47 and Tunisian populations.48 Moreover, molecular epidemiological study has shown that GT repeat variation at the microsatellite region of exon 2 of the TLR2 gene is significantly associated with an increased risk of PTB.49 However, molecular epidemiological study did not find any significant association of R753Q (rs5743708) and R677W (no rs number) polymorphisms of TLR2 gene with the risk of PTB in Indian50 and Iranian populations.51 Molecular studies have shown that 22 bp deletion at the promoter region of TLR2 gene is capable to alter the promoter activity.20 Studies have shown that 22 bp deletion at the promoter region of TLR2Δ22 gene is significantly associated with an increased risk of prostate cancer,52 gastric cancer,53 bladder cancer,54 cervical cancer,55 and chronic hepatitis C.56 We have also found that 22 bp deletion at the promoter region of TLR2Δ22 (‐196‐174) gene is significantly associated with an increased risk of stomach cancer25 and breast cancer in NE region of India.24 Moreover, molecular epidemiological studies have also shown that TLR2Δ22 (‐196‐174) significantly associated with an increased the risk of PTB.22 However, the present case‐control study did not reveal any significant association of 22 bp deletion in the promoter region of TLR2Δ22 (‐196‐174) gene with the risk of PTB in tea garden communities of Assam (Tables 4 and 5). Although this study has shown that people carrying deletion allele in their TLR2Δ22 (‐196‐174del) gene are significantly more susceptible to PTB infection having B/b genotype in their BsmI polymorphism and F/f genotype in FokI polymorphism of VDR gene in comparison with those study participants carrying insertion allele of TLR2Δ22 (‐196‐174) gene (Table 6). Moreover, this study has also revealed that T/T genotype in TaqI polymorphism of VDR gene is significantly associated with the protection from PTB infection in those persons carrying deletion allele in their TLR2Δ22 (‐196‐174) gene (Table 6).

As per current knowledge, the present case‐control study is the first to elucidate the association of genetic factors with the risk of PTB in tea garden communities of Assam. In the present study, we did not get any opportunity to measure the circulatory vitamin D levels in study participants and correlation between VDR genotype with anti‐TB treatment outcome in a longitudinal mood due to logistic issues. In future, therefore, longitudinal studies with larger sample size and with more SNPs of VDR and TLR genes to identify gene‐gene interactions and gene‐environmental interactions with the risk of PTB will be performed in this region to identify host genetic heterogeneity associated with an increased risk of PTB in NE region of India.

In conclusion, the present case‐control study has revealed that BsmI (“b” allele) and FokI (“f” allele) polymorphisms of VDR gene are significantly associated with an increased risk of PTB in tea garden communities of Assam.

Supporting information

 

ACKNOWLEDGMENTS

This work was supported by the Indian Council of Medical Research (ICMR), India. We would like to thank all study participants for their cooperation.

Devi KR, Mukherjee K, Chelleng PK, Kalita S, Das U, Narain K. Association of VDR gene polymorphisms and 22 bp deletions in the promoter region of TLR2Δ22 (‐196‐174) with increased risk of pulmonary tuberculosis: A case‐control study in tea garden communities of Assam. J Clin Lab Anal. 2018;32:e22562 10.1002/jcla.22562

REFERENCES

  • 1. Zumla A, George A, Sharma V, et al. The WHO 2014 global tuberculosis report–further to go. Lancet Glob Health. 2015;3:e10‐e12. [DOI] [PubMed] [Google Scholar]
  • 2. Ram U, Jha P, Gerland P, et al. Age‐specific and sex‐specific adult mortality risk in India in 2014: analysis of 0.27 million nationally surveyed deaths and demographic estimates from 597 districts. Lancet Glob Health. 2015;312:e767‐e775. [DOI] [PubMed] [Google Scholar]
  • 3. Singhal R, Myneedu VP, Arora J, Singh N, Sah GC, Sarin R. Detection of multi‐drug resistance & characterization of mutations in Mycobacterium tuberculosis isolates from North‐ Eastern States of India using GenoType MTBDRplus assay. Indian J Med Res. 2014;1404:501‐506. [PMC free article] [PubMed] [Google Scholar]
  • 4. Bellamy RJ, Hill AV. Host genetic susceptibility to human tuberculosis. Novartis Found Symp. 1998;217:3‐13; discussion 13‐23. [DOI] [PubMed] [Google Scholar]
  • 5. Di Pietrantonio T, Schurr E. Host‐pathogen specificity in tuberculosis. Adv Exp Med Biol. 2013;783:33‐44. [DOI] [PubMed] [Google Scholar]
  • 6. Gupte A, Padmapriyadarsini C, Mave V, et al. Cohort for Tuberculosis Research by the Indo‐US Medical Partnership (CTRIUMPH): protocol for a multicentric prospective observational study. BMJ Open. 2016;62:e010542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Chelleng PK, Devi KR, Borbora D, et al. Risk factors of pulmonary tuberculosis in tea garden communities of Assam, India. Indian J Med Res. 2014;1401:138‐141. [PMC free article] [PubMed] [Google Scholar]
  • 8. Yu X, Zeng J, Xie J. Navigating through the maze of TLR2 mediated signaling network for better mycobacterium infection control. Biochimie. 2014;102:1‐8. [DOI] [PubMed] [Google Scholar]
  • 9. Thuong NT, Hawn TR, Thwaites GE, et al. A polymorphism in human TLR2 is associated with increased susceptibility to tuberculous meningitis. Genes Immun. 2007;85:422‐428. [DOI] [PubMed] [Google Scholar]
  • 10. Kleinnijenhuis J, Oosting M, Joosten LA, Netea MG, Van Crevel R. Innate immune recognition of Mycobacterium tuberculosis . Clin Dev Immunol. 2011;2011:405310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kongsbak M, Levring TB, Geisler C, von Essen MR. The vitamin d receptor and T cell function. Front Immunol. 2013;4:148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Whitfield GK, Remus LS, Jurutka PW, et al. Functionally relevant polymorphisms in the human nuclear vitamin D receptor gene. Mol Cell Endocrinol. 2001;177:145‐159. [DOI] [PubMed] [Google Scholar]
  • 13. Wilkinson RJ, Llewelyn M, Toossi Z, et al. Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case‐control study. Lancet. 2000;355:618‐621. [DOI] [PubMed] [Google Scholar]
  • 14. Jurutka PW, Whitfield GK, Hsieh JC, Thompson PD, Haussler CA, Haussler MR. Molecular nature of the vitamin D receptor and its role in regulation of gene expression. Rev Endocr Metab Disord. 2001;22:203‐216. [DOI] [PubMed] [Google Scholar]
  • 15. Sinaga BY, Amin M, Siregar Y, Sarumpaet SM. Correlation between Vitamin D receptor gene FOKI and BSMI polymorphisms and the susceptibility to pulmonary tuberculosis in an Indonesian Batak‐ethnic population. Acta Med Indones. 2014;464:275‐282. [PubMed] [Google Scholar]
  • 16. Lee YH, Song GG. Vitamin D receptor gene FokI, TaqI, BsmI, and ApaI polymorphisms and susceptibility to pulmonary tuberculosis: a meta‐analysis. Genet Mol Res. 2015;143:9118‐9129. [DOI] [PubMed] [Google Scholar]
  • 17. Bid HK, Mishra DK, Mittal RD. Vitamin‐D receptor (VDR) gene (Fok‐I, Taq‐I and Apa‐I) polymorphisms in healthy individuals from north Indian population. Asian Pac J Cancer Prev. 2005;62:147‐152. [PubMed] [Google Scholar]
  • 18. Acen EL, Worodria W, Mulamba P, Kambugu A, Erume J. The frequency distribution of vitamin D Receptor fok I gene polymorphism among Ugandan pulmonary TB patients. F1000Res. 2016;5:1890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Drennan MB, Nicolle D, Quesniaux VJ, et al. Toll‐like receptor 2‐deficient mice succumb to Mycobacterium tuberculosis infection. Am J Pathol. 2004;1641:49‐57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Misch EA, Hawn TR. Toll‐like receptor polymorphisms and susceptibility to human disease. Clin Sci (Lond). 2008;1145:347‐360. [DOI] [PubMed] [Google Scholar]
  • 21. Chen YC, Hsiao CC, Chen CJ, et al. Toll‐like receptor 2 gene polymorphisms, pulmonary tuberculosis, and natural killer cell counts. BMC Med Genet. 2010;11:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Khan AU, Aslam MA, Hussain I, et al. Role of Toll‐like receptor 2 (‐196 to ‐174) polymorphism in susceptibility to pulmonary tuberculosis in Pakistani population. Int J Immunogenet. 2014;412:105‐111. [DOI] [PubMed] [Google Scholar]
  • 23. Zhang Y, Jiang T, Yang X, et al. Toll‐like receptor ‐1, ‐2, and ‐6 polymorphisms and pulmonary tuberculosis susceptibility: a systematic review and meta‐analysis. PLoS One. 2013;85:e63357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Devi KR, Chenkual S, Majumdar G, et al. TLR222 (‐196‐174) significantly increases the risk of breast cancer in females carrying proline allele at codon 72 of TP53 gene: a case‐control study from four ethnic groups of North Eastern region of India. Tumour Biol. 2015;3612:9995‐10002. [DOI] [PubMed] [Google Scholar]
  • 25. Mukherjee D, Devi KR, Deka M, et al. Association of toll‐like receptor 2 22 and risk for gastric cancer considering main effects and interactions with smoking: a matched case‐control study from Mizoram, India. Tumour Biol. 2016;37:10821‐10826. [DOI] [PubMed] [Google Scholar]
  • 26. Stead WW, Senner JW, Reddick WT, Lofgren JP. Racial differences in susceptibility to infection by Mycobacterium tuberculosis . N Engl J Med. 1990;3227:422‐427. [DOI] [PubMed] [Google Scholar]
  • 27. Davies PD. A possible link between vitamin D deficiency and impaired host defence to Mycobacterium tuberculosis . Tubercle. 1985;664:301‐306. [DOI] [PubMed] [Google Scholar]
  • 28. Crowle AJ, Ross EJ, May MH. Inhibition by 1,25(OH)2‐vitamin D3 of the multiplication of virulent tubercle bacilli in cultured human macrophages. Infect Immun. 1987;5512:2945‐2950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Bellamy R. Genetics and pulmonary medicine. 3. Genetic susceptibility to tuberculosis in human populations. Thorax. 1998;537:588‐593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Chen S, Sims GP, Chen XX, Gu YY, Chen S, Lipsky PE. Modulatory effects of 1,25‐dihydroxyvitamin D3 on human B cell differentiation. J Immunol. 2007;1793:1634‐1647. [DOI] [PubMed] [Google Scholar]
  • 31. Wu S, Sun J. Vitamin D, vitamin D receptor, and macroautophagy in inflammation and infection. Discov Med. 2011;1159:325‐335. [PMC free article] [PubMed] [Google Scholar]
  • 32. Liu PT, Stenger S, Li H, et al. Toll‐like receptor triggering of a vitamin D‐mediated human antimicrobial response. Science. 2006;3115768:1770‐1773. [DOI] [PubMed] [Google Scholar]
  • 33. Edfeldt K, Liu PT, Chun R, et al. T‐cell cytokines differentially control human monocyte antimicrobial responses by regulating vitamin D metabolism. Proc Natl Acad Sci USA. 2010;10752:22593‐22598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Hakim I, Bar‐Shavit Z. Modulation of TNF‐alpha expression in bone marrow macrophages: involvement of vitamin D response element. J Cell Biochem. 2003;885:986‐998. [DOI] [PubMed] [Google Scholar]
  • 35. Fernandez‐Mestre M, Villasmil A, Takiff H, Alcala ZF. NRAMP1 and VDR gene polymorphisms in susceptibility to tuberculosis in Venezuelan population. Dis Markers. 2015;2015:860628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Salimi S, Farajian‐Mashhadi F, Alavi‐Naini R, Talebian G, Narooie‐Nejad M. Association between vitamin D receptor polymorphisms and haplotypes with pulmonary tuberculosis. Biomed Rep. 2015;32:189‐194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ates O, Dolek B, Dalyan L, Musellim B, Ongen G, Topal‐Sarikaya A. The association between BsmI variant of vitamin D receptor gene and susceptibility to tuberculosis. Mol Biol Rep. 2011;384:2633‐2636. [DOI] [PubMed] [Google Scholar]
  • 38. Lee SW, Chuang TY, Huang HH, Liu CW, Kao YH, Wu LS. VDR and VDBP genes polymorphisms associated with susceptibility to tuberculosis in a Han Taiwanese population. J Microbiol Immunol Infect. 2016;495:783‐787. [DOI] [PubMed] [Google Scholar]
  • 39. Sharma PR, Singh S, Jena M, et al. Coding and non‐coding polymorphisms in VDR gene and susceptibility to pulmonary tuberculosis in tribes, castes and Muslims of Central India. Infect Genet Evol. 2011;116:1456‐1461. [DOI] [PubMed] [Google Scholar]
  • 40. Huang L, Liu C, Liao G, Yang X, Tang X, Chen J. Vitamin D receptor gene foki polymorphism contributes to increasing the risk of tuberculosis: an update meta‐analysis. Medicine (Baltimore). 2015;9451:e2256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Wu YJ, Yang X, Wang XX, et al. Association of vitamin D receptor BsmI gene polymorphism with risk of tuberculosis: a meta‐analysis of 15 studies. PLoS One. 2013;86:e66944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Bornman L, Campbell SJ, Fielding K, et al. Vitamin D receptor polymorphisms and susceptibility to tuberculosis in West Africa: a case‐control and family study. J Infect Dis. 2004;1909:1631‐1641. [DOI] [PubMed] [Google Scholar]
  • 43. Roth DE, Soto G, Arenas F, et al. Association between vitamin D receptor gene polymorphisms and response to treatment of pulmonary tuberculosis. J Infect Dis. 2004;1905:920‐927. [DOI] [PubMed] [Google Scholar]
  • 44. Joshi L, Ponnana M, Penmetsa SR, Nallari P, Valluri V, Gaddam S. Serum vitamin D levels and VDR polymorphisms (BsmI and FokI) in patients and their household contacts susceptible to tuberculosis. Scand J Immunol. 2014;792:113‐119. [DOI] [PubMed] [Google Scholar]
  • 45. Velez DR, Wejse C, Stryjewski ME, et al. Variants in toll‐like receptors 2 and 9 influence susceptibility to pulmonary tuberculosis in Caucasians, African‐Americans, and West Africans. Hum Genet. 2010;1271:65‐73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Zhao Y, Bu H, Hong K, et al. Genetic polymorphisms of CCL1 rs2072069 G/A and TLR2 rs3804099 T/C in pulmonary or meningeal tuberculosis patients. Int J Clin Exp Pathol. 2015;810:12608‐12620. [PMC free article] [PubMed] [Google Scholar]
  • 47. Dalgic N, Tekin D, Kayaalti Z, et al. Arg753Gln polymorphism of the human Toll‐like receptor 2 gene from infection to disease in pediatric tuberculosis. Hum Immunol. 2011;725:440‐445. [DOI] [PubMed] [Google Scholar]
  • 48. Ben‐Ali M, Barbouche MR, Bousnina S, Chabbou A, Dellagi K. Toll‐like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients. Clin Diagn Lab Immunol. 2004;113:625‐626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Yim JJ, Lee HW, Lee HS, et al. The association between microsatellite polymorphisms in intron II of the human Toll‐like receptor 2 gene and tuberculosis among Koreans. Genes Immun. 2006;72:150‐155. [DOI] [PubMed] [Google Scholar]
  • 50. Biswas D, Gupta SK, Sindhwani G, Patras A. TLR2 polymorphisms, Arg753Gln and Arg677Trp, are not associated with increased burden of tuberculosis in Indian patients. BMC Res Notes. 2009;2:162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Naderi M, Hashemi M, Hazire‐Yazdi L, et al. Association between toll‐like receptor2 Arg677Trp and 597T/C gene polymorphisms and pulmonary tuberculosis in Zahedan, Southeast Iran. Braz J Infect Dis. 2013;175:516‐520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Mandal RK, George GP, Mittal RD. Association of Toll‐like receptor (TLR) 2, 3 and 9 genes polymorphism with prostate cancer risk in North Indian population. Mol Biol Rep. 2012;397:7263‐7269. [DOI] [PubMed] [Google Scholar]
  • 53. de Oliveira JG, Silva AE. Polymorphisms of the TLR2 and TLR4 genes are associated with risk of gastric cancer in a Brazilian population. World J Gastroenterol. 2012;1811:1235‐1242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Singh V, Srivastava N, Kapoor R, Mittal RD. Single‐nucleotide polymorphisms in genes encoding toll‐like receptor ‐2, ‐3, ‐4, and ‐9 in a case‐control study with bladder cancer susceptibility in a North Indian population. Arch Med Res. 2013;441:54‐61. [DOI] [PubMed] [Google Scholar]
  • 55. Pandey S, Mittal RD, Srivastava M, et al. Impact of Toll‐like receptors [TLR] 2 (‐196 to ‐174 del) and TLR 4 (Asp299Gly, Thr399Ile) in cervical cancer susceptibility in North Indian women. Gynecol Oncol. 2009;1143:501‐505. [DOI] [PubMed] [Google Scholar]
  • 56. Nischalke HD, Coenen M, Berger C, et al. The toll‐like receptor 2 (TLR2) ‐196 to ‐174 del/ins polymorphism affects viral loads and susceptibility to hepatocellular carcinoma in chronic hepatitis C. Int J Cancer. 2012;1306:1470‐1475. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 


Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES