Abstract
Background
Circular RNAs (circRNAs) play a crucial role in the occurrence of several diseases including cancers. However, little is known about circRNAs’ diagnostic values for gastric cancer, one of the worldwide most common diseases of mortality.
Methods
The hsa_circ_0003159 levels in 108 paired gastric cancer tissues and adjacent non‐tumorous tissues from surgical patients with gastric cancer were first detected by real‐time quantitative reverse transcription‐polymerase chain reaction. Then, the relationships between hsa_circ_0003159 expression levels in gastric cancer tissues and the clinicopathological factors of patients with gastric cancer were analyzed. Finally, its diagnostic value was evaluated through the receiver operating characteristic curve.
Results
Compared with paired adjacent non‐tumorous tissues, hsa_circ_0003159 expression was significantly down‐regulated in gastric cancer tissues. What is more, we found that hsa_circ_0003159 expression levels were significantly negatively associated with gender, distal metastasis, and tumor‐node‐metastasis stage.
Conclusions
All of the results suggest that hsa_circ_0003159 may be a potential cancer marker of patients with gastric cancer.
Keywords: biomarker, circular RNA, gastric cancer, gene diagnosis, hsa_circ_0003159
1. INTRODUCTION
Circular RNAs (circRNAs) are a kind of special non‐coding RNA molecules, which have the form of a closed ring structure.1 Unlike the traditional linear RNA, circRNAs are not digested by traditional RNA exonuclease such as RNase R.2 Besides, circRNAs are more stable than linear RNAs. These mean that circRNAs are not easy to be degraded. About their functions, circRNAs are regarded as microRNA (miRNA) sponges and transcriptional regulators.3 Recently, many researches have proved that circRNAs can be potential novel biomarkers in diagnosing cancers.4 For example, some circRNAs are associated with hepatocellular carcinoma, colorectal cancer, laryngeal cancer and so on.5, 6, 7
Gastric cancer is one of the worldwide most common diseases of mortality.8, 9 Most of them go to deteriorate and miss the best chance to therapy. However, little is known about the relationship between circRNAs and gastric cancer. As a result, exploring new type of ideal cancer markers is benefit to improve the diagnosis of gastric cancer.
On the basis of our previous circRNA microarray screening (GEO No. GSE89143: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE89143), we focused on hsa_circ_0003159, which was aberrantly expressed in gastric cancer tissues comparing with normal gastric tissues. Its gene is located at chr7:81689743‐81746489. Its length is 483nt.
By expanding sample size, we found that hsa_circ_0003159 expression levels were associated with major clinicopathological factors of patients with gastric cancer. As a result, hsa_circ_0003159 might become a new marker of diagnosis of gastric cancer.
2. MATERIALS AND METHODS
2.1. Patients and sample collection
We have collected 108 paired fresh gastric cancer tissues and adjacent non‐tumorous tissues between June 2012 and December 2015 at The Affiliated Hospital of Ningbo University School of Medicine and Yinzhou People's Hospital, China. We obtained informed consent from all subjects. The Human Research Ethics Committee from Ningbo University approved all aspects of this study.
The adjacent tissues were obtained 5 cm away from the cancer edge. There were no obvious tumor cells evaluated by two experienced pathologists. No radiotherapy or chemotherapy was carried out prior to the operation.
Histological grade was assessed following the National Comprehensive Cancer Network Clinical Practice Guideline of Oncology (V.1.2011). Tumors were staged according to the tumor‐node‐metastasis (TNM) staging system of the International Union Against Cancer (5th ed).
After being removed from the bodies, tissues were immediately soaked in RNA‐fixer Reagent (Bioteke, Beijing, China), and then stored at −80°C until use.
2.2. Total RNA extraction
Extracting total RNA from tissues was carried out by TRIzol reagent (Invitrogen, Karlsruhe, Germany) following the manufacturer's instructions. Then chloroform was added to separate organic phase from inorganic phase. The isopropanol was used for the precipitation of total RNA. And the extracted RNA was preserved at −80°C until use. RNA concentration was measured using NanoDrop ND‐2000 (Thermo Fisher Scientific, Wilmington, DE, USA).
2.3. Reverse transcription
Reverse transcription (RT) reaction was performed in the GoScript RT System (Promega, Madison, WI, USA) using random primers. At the same time, no template reaction was used as a control.
2.4. Polymerase chain reaction
The real‐time quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) was performed using GoTaq qPCR master mix (Promega) on the Mx3005P QPCR System (Stratagene, La Jolla, CA, USA) following the manufacturer's instructions. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) mRNA was used to normalize the levels of the circRNA. Primers for hsa_circ_0003159 and GAPDH were synthesized by Sangon Biotech (Shanghai, China). Their sequences were as follows: 5′‐ACTGGGAATGGAGGAAGA‐3′ and 5′‐TGAGAAAGGATTGAGGGAAAAG‐3′ for hsa_circ_0003159; 5′‐AAGCCACCCCACTTCTCTCTAA‐3′ and 5′‐AATGCTATCACCTCCCCTGTGT‐3′ for GAPDH. The ΔC t method was used to analyze the data.4 Through three independent experiments, all results were expressed as the mean±SD.
2.5. Statistical analysis
We used spss 18.0 software (SPSS Inc., Chicago, IL, USA) for data analysis. The t test was used to analyze the differences in hsa_circ_0003159 levels between gastric cancer tissues and paired adjacent non‐tumorous tissues. The relationships between hsa_circ_0003159 levels and clinicopathological factors of patients with gastric cancer were further analyzed by one‐way analysis of variance (ANOVA). We established a receiver operating characteristic curve (ROC) to evaluate the diagnostic value.
3. RESULTS
3.1. Amplification of circRNA—hsa_circ_0003159
We first analyzed the specificity of the amplified hsa_circ_0003159 product. Our melting curve analysis indicated that the amplified product showed only a single peak. This means that there was neither non‐specific amplification no primer dimers. After sequencing the hsa_circ_0003159 amplified product (Figure 1), we can make the conclusion that the sequence was completely consistent with that from CircBase (http://circbase.org/cgi-bin/simplesearch.cgi). All of these prove that hsa_circ_003159 exists in gastric cancer tissues and could be efficiently amplified by qRT‐PCR.
Figure 1.
The sequencing result of the products of qRT‐PCR for hsa_circ_0003159
3.2. Expression of hsa_circ_0003159 is down‐regulated in gastric carcinoma tissues
Then, we detected the expression of hsa_circ_0003159 in 108 paired gastric cancer tissues and non‐tumorous tissues. As shown in Figure 2, its expression levels in cancer tissues from patients with gastric cancer were lower than those in corresponding non‐tumorous tissues.
Figure 2.
The expression levels of hsa_circ_0003159 in gastric cancer samples. Hsa_circ_0003159 and GAPDH expression levels were detected by qRT‐PCR. The ΔC t method was used to analyze the relative expression of hsa_circ_0003159. n=108, P˂.001
3.3. Potential diagnostic values of hsa_circ_0003159 in gastric cancer
Next, we performed an analysis to evaluate the potential diagnostic value of hsa_circ_0003159. The results showed that hsa_circ_0003159 expression was associated with some clinicopathological factors of patients with gastric cancer (Table 1). The result indicated that the expression of hsa_circ_0003159 was associated with gender (P=.003), distal metastasis (P=.020) and TNM stage (P=.018). These clearly indicated that advanced and distal metastasis cancer patients were related with lower expression levels of hsa_circ_0003159. The majority of these gastric cancer patients are male (67.6%). We did not further find the relationship between hsa_circ_0003159 levels and other clinicopathologic factors such as differentiation, lymphatic metastasis, and age (Table 1).
Table 1.
Relationship of hsa_circ_0003159 expression levels (ΔC t) in cancer tissues with clinicopathological factors of patients with gastric cancer
| Characteristics | No. of patients (%) | Mean±SD | P value |
|---|---|---|---|
| Age (y) | |||
| <60 | 35 (32.4) | 12.82±1.19 | .657 |
| ≥60 | 73 (67.6) | 12.94±1.38 | |
| Gender | |||
| Female | 35 (32.4) | 12.37±0.84 | .003 |
| Male | 73 (67.6) | 13.16±1.43 | |
| Diameter (cm) | |||
| <5 | 55 (51.9) | 12.69±1.39 | .095 |
| ≥5 | 52 (48.1) | 13.12±1.22 | |
| Differentiation | |||
| Well | 9 (8.3) | 12.82±0.48 | .915 |
| Moderate | 58 (53.7) | 12.95±1.53 | |
| Poor | 41 (38.0) | 12.85±1.10 | |
| Lymphatic metastasis | |||
| N0 | 44 (40.7) | 12.79±1.11 | .325 |
| N1 | 22 (20.4) | 13.35±1.96 | |
| N2 | 8 (7.4) | 12.58±1.00 | |
| N3 | 34 (31.5) | 12.85±1.07 | |
| Distal metastasis | |||
| M0 | 100 (92.6) | 12.99±1.32 | .020 |
| M1 | 8 (7.4) | 11.87±0.68 | |
| Invasion | |||
| Tis & T1 | 21 (19.4) | 12.58±0.82 | .116 |
| T2 & T3 | 19 (17.6) | 12.55±0.95 | |
| T4 | 68 (63.0) | 13.11±1.49 | |
| TNM stage | |||
| 0 & I | 30 (27.8) | 12.56±0.99 | .018 |
| II & III | 71 (65.7) | 13.14±1.41 | |
| IV | 7 (6.5) | 11.97±0.82 | |
Bold numbers indicate significance at P < .05.
We speculated that this circRNA might be used as a biomarker of gastric cancer. So we established a ROC curve. The area under ROC curve (AUC) was up to 0.75 (P<.001, Figure 3). The sensitivity and specificity were 0.852 and 0.565, respectively. The cutoff value (ΔC t) was 12.31.
Figure 3.
The ROC curve of hsa_circ_0003159
4. DISCUSSION
As early as the 1970s, circRNAs were found in the RNA viruses.10 Hsu and Coca‐Prados first reported that RNAs were existed in the eukaryotic cytoplasm in the shape of circularity.11 Recently, with the rapid developments and widely applications of RNA sequencing, many researchers have found that circRNAs can be formed by gene rearrangement using exonic transcripts or non‐linear reverse splicing.12 What is more, they take a great proportion of all spliced transcripts. Exons or introns may be the source of circRNAs.13 Both exonic and intronic circRNAs have possibility to regulate gene expression.
CircRNAs have a wide expression in human cells. Comparing with their linear isomers, their expression levels might be 10‐fold or higher.12 Highly conserved sequences and stability are two essential properties of circRNAs.14 These properties make circRNAs possible to become new type of biomarkers in the diagnosis of cancers. Compared with other non‐coding RNAs, like miRNAs and long non‐coding RNAs (lncRNAs), circRNAs have their own advantages.
A representative circRNA named cerebellar degeneration‐related protein 1 transcript (CDR1as) has been found about 70 binding sites with miR‐7.15 It makes circRNA difficult to be degraded by the RNA induced silencing complexes (RISC).1 Thus it plays an important role as a miRNA sponge. Previously, a research showed that miR‐7 played a key role in Parkinson's disease.16 As a sponge for miR‐7, CDR1as is potentially valuable in monitoring the progression of these diseases.
Another circRNA, circular anti‐sense non‐coding RNA in the INK4 locus (cANRIL), is linked with a single nucleotide polymorphism.17 It may influence cANRIL splicing.17 In addition, cANRIL influences polycomb group (PcG) to mediate INK4/ARF gene inhibitory effect, and affects the risk of atherosclerosis.17 At the same time, other researchers have found that circRNAs had abundant roles with the classification, storage or position of RNA binding protein.17
Although more and more researchers have begun to study circRNAs and their potential functions, there still exist gaps in their clinical diagnostic values in cancers. In this study, we found that hsa_circ_0003159 was down‐regulated in gastric cancer (Figure 2) and is potentially valuable in the diagnosis of gastric cancer (Table 1 and Figure 3).
The distal metastasis and TNM stages are important factors in the evaluation of the prognosis of patients with gastric cancer.18, 19 In this study, we found that there was a significantly relationship between low expression levels of hsa_circ_0003159 in gastric cancer and distal metastasis or TNM stages (Table 1).
However, due to the samples in this study were from tissues, the practical significance of the findings needs to be confirmed. The findings would be more interest if it was established that hsa_circ_0003159 can be detected in the circulation.
In conclusion, our data show that hsa_circ_0003159 may become a possible biomarker for the diagnosis of gastric cancer.
ACKNOWLEDGMENTS
This work was supported by the Applied Research Project on Nonprofit Technology of Zhejiang Province (2016C33177), Zhejiang Provincial High‐Education Teaching Reform Project (No. jg2015047), the Scientific Innovation Team Project of Ningbo (No. 2017B00001), and the K. C. Wong Magna Fund in Ningbo University.
Tian M, Chen R, Li T, Xiao B. Reduced expression of circRNA hsa_circ_0003159 in gastric cancer and its clinical significance. J Clin Lab Anal. 2018;32:e22281 10.1002/jcla.22281
REFERENCES
- 1. Yao T, Chen Q, Fu L, Guo J. Circular RNAs: biogenesis, properties, roles, and their relationships with liver diseases. Hepatol Res. 2017;47:497‐504. [DOI] [PubMed] [Google Scholar]
- 2. Chen S, Li T, Zhao Q, Xiao B, Guo J. Using circular RNA hsa_circ_0000190 as a new biomarker in the diagnosis of gastric cancer. Clin Chim Acta. 2017;466:167‐171. [DOI] [PubMed] [Google Scholar]
- 3. Li P, Chen H, Chen S, et al. Circular RNA 0000096 affects cell growth and migration in gastric cancer. Br J Cancer. 2017;116:626‐633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Li P, Chen S, Chen H, et al. Using circular RNA as a novel type of biomarker in the screening of gastric cancer. Clin Chim Acta. 2015;444:132‐136. [DOI] [PubMed] [Google Scholar]
- 5. Fu L, Yao T, Chen Q, Mo X, Hu Y, Guo J. Screening differential circular RNA expression profiles reveals hsa_circ_0004018 is associated with hepatocellular carcinoma. Oncotarget. 2017. 10.18632/oncotarget.16881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Xie H, Ren X, Xin S, et al. Emerging roles of circRNA_001569 targeting miR‐145 in the proliferation and invasion of colorectal cancer. Oncotarget. 2016;7:26680‐26691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Xuan L, Qu L, Zhou H, et al. Circular RNA: a novel biomarker for progressive laryngeal cancer. Am J Transl Res. 2016;8:932‐939. [PMC free article] [PubMed] [Google Scholar]
- 8. Wang J, Qu J, Li Z, et al. Pretreatment platelet‐to‐lymphocyte ratio is associated with the response to first‐line chemotherapy and survival in patients with metastatic gastric cancer. J Clin Lab Anal. 2017. 10.1002/jcla.22185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Xiang F, Ni Z, Zhan Y, Xu J, Wu R, Kang X. Association of 758 G/A polymorphism of 3'untranslated region of prohibitin with risk of gastric cancer. J Clin Lab Anal. 2017. 10.1002/jcla.22182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Wu Q, Wang Y, Cao M, et al. Homology‐independent discovery of replicating pathogenic circular RNAs by deep sequencing and a new computational algorithm. Proc Natl Acad Sci U S A. 2012;109:3938‐3943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Hsu MT, Coca‐Prados M. Electron microscopic evidence for the circular form of RNA in the cytoplasm of eukaryotic cells. Nature. 1979;280:339‐340. [DOI] [PubMed] [Google Scholar]
- 12. Li J, Yang J, Zhou P, et al. Circular RNAs in cancer: novel insights into origins, properties, functions and implications. Am J Cancer Res. 2015;5:472‐480. [PMC free article] [PubMed] [Google Scholar]
- 13. Zhang Y, Zhang XO, Chen T, et al. Circular intronic long noncoding RNAs. Mol Cell. 2013;51:792‐806. [DOI] [PubMed] [Google Scholar]
- 14. Hansen TB, Jensen TI, Clausen BH, et al. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384‐388. [DOI] [PubMed] [Google Scholar]
- 15. Xu H, Guo S, Li W, Yu P. The circular RNA Cdr1as, via miR‐7 and its targets, regulates insulin transcription and secretion in islet cells. Sci Rep. 2015;5:12453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Junn E, Lee KW, Jeong BS, Chan TW, Im JY, Mouradian MM. Repression of alpha‐synuclein expression and toxicity by microRNA‐7. Proc Natl Acad Sci U S A. 2009;106:13052‐13057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Burd CE, Jeck WR, Liu Y, Sanoff HK, Wang Z, Sharpless NE. Expression of linear and novel circular forms of an INK4/ARF‐associated non‐coding RNA correlates with atherosclerosis risk. PLoS Genet. 2010;6:e1001233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Shao Y, Ye M, Li Q, et al. LncRNA‐RMRP promotes carcinogenesis by acting as a miR‐206 sponge and is used as a novel biomarker for gastric cancer. Oncotarget. 2016;7:37812‐37824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Yang Y, Shao Y, Zhu M, et al. Using gastric juice lncRNA‐ABHD11‐AS1 as a novel type of biomarker in the screening of gastric cancer. Tumour Biol. 2016;37:1183‐1188. [DOI] [PubMed] [Google Scholar]