Abstract
Background
Currently, the clinico-radiological method was used to analyze the healing progression of fractures globally, but even they are also unable to presume the impaired healing early. Hence till date, no reliable methods are available to predict the impaired healing early, so that it could be interventionally managed as required within the time.
Methods
In this prospective observational study, a total of 121 adults fractured patients and 108 healthy controls were analyzed. Peripheral blood samples were taken from controls (at once) and fractured cases (at different follow-ups) to quantify the Osteocalcin and Osteopontin mRNA and protein expression using qRT-PCR and western blotting assay respectively. In parallel to that the clinico-radiological follow-up examinations also done at various specific follow-up intervals up to 24th post-fracture weeks.
Results
As per the clinico-radiological status at the 24th week, fracture patients were divided into normal healing (n = 102) and impaired healing (n = 19) groups. Mean RUST score between normal healing and the impaired healing group showed a significant statistical difference at each follow-up. In both groups, expressions of Osteocalcin (mRNA & protein) were gradually up-regulated from the baseline to end of follow-ups, whereas Osteopontin mRNA as well as protein gradually up-regulated from the baseline to a peak value at 10th day, then declined. In general, the Osteocalcin and Osteopontin mean fold expressions were higher in normal healing as compared to the impaired healing groups.A significant correlation was found between the mRNA expressions of Osteocalcin and Osteopontin with the RUST score at most of the follow-ups. However, the protein expressions were not shown any significant correlation.
Conclusions
The Osteocalcin and Osteopontin expression will provide an early prediction of the healing outcomes of tibial fractures. This may open a new horizon for innovations to deal with complications associated with impaired fracture healing, especially in tibial bone fractures.
Keywords: Osteocalcin, Osteopontin, Diaphyseal fracture, Biomarkers
1. Introduction
Fractures are a common orthopedic problem, and it occurs mostly in long bones. Amongst all long bones, the shaft of the tibia is one of the commonest bones that are prone to fractures. Such fractures have a relatively higher incidence of impaired healing as the fracture site and have lesser soft tissue coverage, because of subcutaneous bone on anterior aspect.1,2 The mentioned reasons account for a high rate of tibial non-unions amounting to 2–10% of all tibial fractures which leads to significant patient morbidity.3,4 Osteocalcin (OC) has been recognized as a marker of osteoblast activity, and its levels reflect the rate of bone formation.5 Kavukcuoglu et al. (2009) suggested that the OC plays a role in the growth of apatite crystals in bone by increasing the degree of carbonate substitutions.6 Normally uniting fractures had generally higher OC expression as compared with fractures exhibiting delayed union. These results suggest that measurement of OC activity after fracture could provide a useful prognostic indicator.7 Osteopontin (OPN) is a prominent component of the laminae limitantes that line both internal and external bone surfaces8 and thus are strategically positioned to affect cell attachment and signaling.9,10 Duvall et al. (2007)11 in their experiment observed multiple, stage-dependent roles of OPN during fracture healing and concluded that OPN deficiency alters the functionality of multiple cell types, resulting in delayed early vascularization, altered matrix organization and late remodeling, and reduced biomechanical properties (Fig. 1). Chellaiah et al. (2003)12 demonstrate the need for OPN as an osteoclast autocrine factor during bone remodeling and suggested that OPN deficiency produces osteoclast dysfunction because of reduced CD44 surface expression.
Fig. 1.
Involvement of Osteocalcin and Osteopontin during stage of osteoblastic differentiation and maturation.
The Fracture healing is a continuous process to achieve union.13 Therefore, healing should be measured. There are no methods yet to measure the rate of these processes and quantify the healing process. Currently, clinical and radiological methods are most commonly used to assess the healing of fractures. However, several studies suggest that the radiographic assessment is not the most suitable method to assess fracture healing.14,15 The present study indent to pre-identify biomarkers responsible for the healing of fractures at the time of the start of the treatment procedure. With the help of such selected biomarkers, the prognosis of a fracture case could be predicted and a suitable intervention could be planned at the appropriate time. This would minimize the suffering of the patient. In the present study, the researcher selected one bone-formation markers [Osteocalcin (OC)] and one bone-resorption markers [Osteopontin (OPN)] and further planned to quantify the selected biomarkers expression (mRNA and protein) in whole blood at the early phase of healing in within normal and impaired healing groups of patients with the simple diaphyseal tibial fracture. The clinico-radiological progression could be compared with biochemical expression (at different time periods) for differently selected biomarkers; which may give fruitful information regarding their expressions at a different stage of early healing.
Study Objectives:
-
1.
To measure the expression (mRNA & Protein) of selected biomarkers [Osteocalcin (OC) and Osteopontin (OPN)] in blood samples of fracture patients at various follow-ups.
-
2.
To correlate fracture healing progression with the expression of selected biomarkers.
2. Materials and methods
This is a prospective observational study carried out between 2012 and 2017 at our institutional trauma center. All patients included in this study were managed conservatively (reduction -setting and above knee plaster cast under general/regional anesthesia). The biochemical, as well as clinico-radiological follow-ups, were done at various definite intervals. They were admitted for the next 24–48 h and then discharged with standard advice.
2.1. Study subjects
After obtaining ethical clearance (Ref. Code: 55 E C M. IIB/P6) from the institutional ethical review committee and informed consent, demographic data of all enrolled patients were collected. A total of 108 healthy controls (without any injury/fracture) and 145 fractured patients of both sexes of aged between 18 and 40 years with simple, fresh (less than 03 days) traumatic diaphyseal fractures of both bone leg managed conservatively were included in the study. Exclusion criteria included age of less than 18 and more than 45 years; osteoporotic fractures; polytrauma; pathological fractures; compound or infected fractures; alcoholic; smoker; immune-compromised; single tibial fracture with intact fibula; uncontrolled diabetes; bile duct obstruction; chronic inflammatory bowel disease; patients managed surgically; patients coming after 03rd post-fracture days; malnourished; and prolonged use of anabolic steroids, thiazides, diuretics, hormonal therapy, non-steroidal anti-inflammatories, calcium fluorides, and immunosuppressive drugs. To exclude malnourished patients, the nutritional examination like Hemoglobin percentage (manually), Serum albumin (ELITech Clinical System), Serum ferritin (Roche Analyser) and serum calcium were done at the Department of Biochemistry. The radiographic union score for tibial (RUST) fractures was done using plain, examined separately by two orthopedic surgeons and the average findings were noted. In RUST scoring, the bony healing will be evaluated separately for each cortical surface (anterior, posterior, medial and lateral). The absence of callus and a visible fracture line received 1 point; callus with a visible fracture line received 2 points, and callus with no visible fracture line received 3 points. From the sum of these points, a final RUST score was obtained, ranging from 4 for a completely ununited fracture to 12 for a definitively united fracture. A score ≥7 equates to a minimum of three bridge with cortical callus, at which point a fracture is considered to be radiologically united.16,17 The average of the scores was taken for the final decision/analysis. The clinico-radiological evaluation at 24th week was used to label the healing as normal or impaired. Patients with normal bony healing were defined with RUST score ≥7 by the end of the 24th week along with painless (no tenderness), motionless (no abnormal mobility) with the presence of transmitted movements at the fracture site was allocated in the normal healing group. Otherwise, they were allocated in impaired healing group.16,17
2.2. Description of the experiment
In the biochemical examination, the OC and OPN (mRNA & protein) expression in peripheral blood were carried out in enrolled patients at following intervals, i.e. at 04th, 07th, 10th, 15th, 20th and 28th post-fracture days. The total mRNA and serum protein from the whole blood were isolated as per standard protocol using Trizol and the centrifugation method respectively. The OC and OPN mRNA expression were done by qRT-PCR analysis as per standard protocol using primers (IDT, Prime Time Standard qPCR Assay, FAM- TAMRA) (Table 1). Each gene of interest was normalized to the expression of the housekeeping gene, glyceraldehyde-3-phosphate- dehydrogenase (GAPDH). The normalized amount of targets was then compared using the comparative Ct-method. The OC and OPN protein expression were done by western blotting assay using primary antibodies [OC; 1:800, (FL-100; SC-13100] and [OPN; 1:500, (FL-314; SC-20788)] rabbit polyclonal IgG, followed by corresponding horseradish peroxidase-conjugated secondary antibodies (1:5,000, Goat anti-rabbit IgG-HRP, SC-2004) and normalized with GAPDH (FL-335; SC-25778) as per standard protocol. The clinico-radiological examination was done at 06th, 10th, 16th, 20th, 24th post-fracture weeks. The radiological progression of healing was evaluated using RUST Score [1–2] (Fig. 3). The clinical & radiological status (RUST Score) of union based on the 24th week was then analyzed against the expression of OC and OPN (taken at 04th, 07th, 10th, 15th, 20th and 28th post-fracture days under biochemical examination).
Table 1.
Sequence of primers and probes of the selected genes.
| Genes | Sequence |
|---|---|
| Osteocalcin (OC) | |
| OC; F Primer | CGCCTGGGTCTCTTCACT |
| OC; R Primer | CTCACACTCCTCGCCCTAT |
| OC; Probe | AGTCCAGCAAAGGTGCAGCCT |
| Osteopontin (OPN) | |
| OPN; F Primer | TTCAACTCCTCGCTTTCCAT |
| OPN; R Primer | CCCCACAGTAGACACATATGATG |
| OPN; Probe | ACCTGACATCCAGTACCCTGATGCT |
| Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | |
| GAPDH; F Primer | GAAGGTGAAGGTCGGAGTC |
| GAPDH; R Primer | GAAGATGGTGATGGGATTTC |
| GAPDH; Probe | CAAGCTTCCCGTTCTCAGCC |
Fig. 3.
(a) Graph showing mean RUST score (representing the fracture healing progression) between normal (n = 102) and impaired healing (n = 19) groups, showing statistical significant difference at each follow-up intervals. Error bars represent standard deviation. (b) Radiological evaluation of healing progression using RUST scoring during follow-up.
2.3. Accounting for all study subjects
Out of 145 patients who are eligible, 10 patients were excluded as per inclusion-exclusion criteria. Out of these 135 patients who were enrolled in our study, 14 patients were lost to follow-up. So, only 121 patients were analyzed. To compare the baseline expression in the normal healthy population, 108 controls were also enrolled. Mean RUST score at 06th, 10th, 16th, 20th, and 24th weeks of post-fracture follow-up were 6.31 ± 0.49, 7.90 ± 0.45, 8.40 ± 0.60, 10.23 ± 0.90 and 11.08 ± 0.88 respectively in normal healing group and 4.36 ± 0.40, 4.65 ± 0.44, 5.02 ± 0.51, 5.63 ± 0.46, 5.86 ± 0.59 respectively in the impaired healing group. The mean time of healing in normal healing group patients was 17.1 ± 3.6 weeks. The Fig. 2 deals with the overall methodology of the present study.
Fig. 2.
Flowchart of the overall methodology showing the enrollment, examinations and follow-ups of the patients.
2.4. Statistical analysis
Statistical analysis was performed using GraphPad Prism for Windows program (7.0 version). The continuous variables were evaluated by a mean (±standard deviation) or range value when required. For comparison of the means between the two groups, analysis by Student's t-test with a 95% confidence interval, Mann–Whitney U test, and the Pearson correlation coefficient was used. Categorical data were analyzed by Fisher exact and Chi square test accordingly. ANOVA-Dunn's Multiple Comparisons Test and ANOVA- Kruskal- Wallis Test were used for multiple comparisons at different follow-ups for expression analysis. Statistically p < 0.05 or 0.001 was regarded as significant.
3. Results
On the basis of the clinico-radiological status of fracture healing at 24th week, these 121 patients were distributed into two groups: normal healing group (n = 102) showed normal fracture healing progression and Impaired Healing Group (n = 19) showed either slow or no fracture healing progression. The baseline characteristics of the enrolled patients of different groups showed in Table 2. The mean RUST score was significantly higher in each of the radiological follow-ups in the normal healing group as compared to the impaired healing group (p < 0.0001) (Fig. 3). In the present study, we observed relatively lower in baseline expression of OC mRNA and protein in controls when compared with the normal and impaired healing group, however, showing significant difference only at OPN mRNA and protein and to OC mRNA expression only (Fig. 4a, b, c, d). While analyzing the OC in the normal and impaired healing group, expressions of both mRNA as well protein showed a gradual up-regulation of expression throughout the biochemical follow-up. The peak expression of OC (mRNA and protein) was obtained at the 28th day of post-fracture follow-up. In the normal healing group, the OC mRNA, as well as protein, showed higher expressions at all follow-ups than the impaired healing group, however, found statistically significant difference only at 10th, 15th, 20th & 28th days in mRNA and 20th & 28th days in protein expression respectively (Table 3; Fig. 4a,b,c). In both of the fracture groups, the expressions of OC mRNA, as well as protein, showed the statistically significant difference (ANOVA-Dunn's Multiple Comparisons Test) in most of the follow-ups. Similarly, the Kruskal- Wallis Test (ANOVA) also showed a statistically significant difference in both groups among median values of expression (<0.0001) (Table 4). However, while analyzing the OPN in normal and impaired healing group, expressions of both mRNA as well protein showed a gradual up-regulation of expression up to the 10th day, then decline subsequent to the end of biochemical follow-up. The peak expression of OPN (mRNA and protein) was obtained at the 10th day of post-fracture follow-up. The OPN also showed the higher expression both at the mRNA and protein level in the normal healing group as compared to the impaired healing group, but found statistically significant difference only at 07th, & 10th days in mRNA expression (Table 5; Fig. 5 a,b,c). In both of the fracture groups, the expressions of OPN mRNA as well protein showed the statistically significant difference (ANOVA-Dunn's Multiple Comparisons Test) in most of the follow-ups. Similarly, the Kruskal- Wallis Test (ANOVA) also showed a statistically significant difference in both groups among median values of expression (<0.0001) (Table 6).
Table 2.
Demographic characteristics of the patients including controls.
| Characteristics | Controls (n = 108) | Normal Healing (n = 102) | Impaired Healing (n = 19) | P value |
|---|---|---|---|---|
| Mean age ±SD (range) in years | 35.77 ± 9.18 (18–45) | 31.08 ± 7.33 (18–45) | 32.46 ± 9.31 (19–45) | P = 0.2706a |
| Gender | ||||
| Male | 93 (86.1%) | 92 (90.2%) | 14 (73.7%) | χ2 = 3.947 P = 0.1389b |
| Female | 15 (13.9%) | 10 (9.8%) | 5 (26.3%) | |
| Side of fracture | ||||
| Left | – | 50 (49.0%) | 7 (36.8%) | P = 0.4537b |
| Right | – | 52 (51.0%) | 12 (63.2%) | |
| Mode of injury | ||||
| Fall from height | – | 28 (27.4%) | 06 (31.6%) | |
| Road Traffic Accident | – | 49 (48.0%) | 08 (42.1%) | χ2 = 5.665; |
| Simple fall | – | 25 (24.6%) | 4 (21.0%) | P = 0.1291c |
| Slip on ground | – | 0 (0) | 1 (05.3%) | |
| AO type | ||||
| A1 | – | 33 (32.4%) | 5 (26.3%) | |
| A2 | – | 28 (27.4%) | 9 (47.4%) | χ2 = 3.075; |
| A3 | – | 41(40.2%) | 5 (26.3%) | P = 0.2149c |
| Hemoglobin ±SD; g/dl (range) | 10.92 ± 1.35 | 10.58 ± 1.23 | 10.62 ± 0.95 | |
| (8.9–14.2) | (8.4–13.5) | (9.4–12.3) | P = 0.1740a | |
| Albumin level ±SD g/dl (range) | 3.81 ± 0.51 | 3.75 ± 0.22 | 3.66 ± 0.16 | |
| (3.6–4.6) | (3.4–4.5) | (3.4–4.0) | P = 0.1212a | |
| Ferritin level ±SD; ng/ml (range) | 102.67 ± 42.8 | 105.19 ± 36.6 | 91.81 ± 34.2 | |
| (32–197.8) | (28–190.2) | (25–136) | P = 0.4579a | |
| Serum Calcium ±SD; mg/dL | 9.36 ± 0.75 | 9.55 ± 0.56 | 9.43 ± 0.67 | |
| (8.6–9.9) | (8.5–10.1) | (8.5–10) | P = 0.1188 | |
Student t-test (Unpaired).
Fisher exact test.
Chi square test.
Fig. 4.
Figure showing mean fold change (baseline/04th day) (a) Osteocalcin mRNA expression, showing statistical significant difference in expression between normal and control group. (b) Osteocalcin protein expression, showing no statistical significant difference in expression between normal, impaired and control group. (c) Osteopontin mRNA expression, showing statistical significant difference in expression between normal and control group and (d) Osteopontin protein expression, showing statistical significant difference in expression between normal and control group. Error bars represent standard deviation.
Table 3.
Mean fold expression of Osteocalcin (mRNA and protein) between normal and impaired healing groups.
| Follow-ups | Osteocalcin mRNA Expression Mean fold change ± SD (Range) Median |
P-value (two-tailed) | Osteocalcin Protein Expression Mean fold change ± SD (Range) Median |
P-value (two-tailed) | ||
|---|---|---|---|---|---|---|
| Normal Healing |
Impaired Healing |
Normal Healing |
Impaired Healing |
|||
| (N = 102) | (N = 19) | (N = 102) | (N = 19) | |||
| 04th Day | 1.59 ± 0.42 | 1.45 ± 0.37 | U = 778.50 | 0.28 ± 0.11 | 0.24 ± 0.10 | U = 787.00 |
| (1.010–2.760) | (0.970–2.560) | P = 0.1759 | (0.05–0.53) | (0.04–0.42) | P = 0.1960 | |
| 1.550 | 1.430 | 0.30 | 0.25 | |||
| 07th Day | 2.66 ± 0.49 | 2.55 ± 0.45 | U = 842.50 | 0.35 ± 0.16 | 0.31 ± 0.15 | U = 853.00 |
| (2.01–3.98) | (1.98–3.76) | P = 0.3694 | (0.06–0.65) | (0.02–0.55) | P = 0.4106 | |
| 2.65 | 2.54 | 0.33 | 0.32 | |||
| 10th Day | 4.53 ± 0.29 | 4.31 ± 0.40 | U = 614.50 | 0.84 ± 0.21 | 0.75 ± 0.24 | U = 768.00 |
| (3.87–5.22) | (3.76–5.06) | P = 0.0117a | (0.51–1.35) | (0.26–1.12) | P = 0.1532 | |
| 4.59 | 4.31 | 0.77 | 0.85 | |||
| 15th Day | 4.68 ± 0.36 | 4.37 ± 0.52 | U = 663.00 | 1.04 ± 0.33 | 0.93 ± 0.38 | U = 768.00 |
| (3.51–5.66) | (3.21–5.13) | P = 0.0296a | (0.61–1.86) | (0.47–1.76) | P = 0.1532 | |
| 4.66 | 4.35 | 0.96 | 1.01 | |||
| 20th Day | 4.84 ± 0.45 | 4.56 ± 0.55 | U = 606.50 | 1.73 ± 0.28 | 1.57 ± 0.28 | U = 678.00 |
| (4.02–5.99) | (4.01–5.75) | P = 0.0099a | (1.35–2.45) | (1.02–1.99) | P = 0.0389a | |
| 4.79 | 4.33 | 1.63 | 1.65 | |||
| 28th Day | 5.12 ± 0.57 | 4.78 ± 0.61 | U = 657.00 | 2.02 ± 0.36 | 1.81 ± 0.39 | U = 668.00 |
| (4.07–6.35) | (4.03–5.97) | P = 0.0265a | (1.39–2.68) | (0.97–2.37) | P = 0.0326a | |
| 5.09 | 4.59 | 1.96 | 1.87 | |||
Significant; Mann- Whitney U test.
Table 4.
Mean fold expression of Osteocalcin (mRNA and protein) within normal and impaired healing groups (ANOVA).
| ANOVA(Dunn's Multiple Comparisons Test) | Osteocalcin mRNA Expression |
Osteocalcin protein Expression |
||
|---|---|---|---|---|
| Normal Healing |
Impaired Healing |
Normal Healing |
Impaired Healing |
|
| (N = 102) |
(N = 19) |
(N = 102) |
(N = 19) |
|
| P value (two-tailed) | P value (two-tailed) | |||
| 04th day vs. 07th day | <0.01a | >0.05 | >0.05 | >0.05 |
| 04th day vs. 10th day | <0.001a | <0.001a | <0.001a | <0.05a |
| 04th day vs. 15th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 04th day vs. 20th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 04th day vs. 28th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 07th day vs. 10th day | <0.001a | <0.01a | <0.001a | >0.05 |
| 07th day vs. 15th day | <0.001a | <0.001a | <0.001a | <0.01a |
| 07th day vs. 20th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 07th day vs. 28th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 10th day vs. 15th day | >0.05 | >0.05 | >0.05 | >0.05 |
| 10th day vs. 20th day | <0.05a | >0.05 | <0.001a | <0.05a |
| 10th day vs. 28th day | <0.001a | >0.05 | <0.001a | <0.001a |
| 15th day vs. 20th day | >0.05 | >0.05 | <0.001a | >0.05 |
| 15th day vs. 28th day | <0.01a | >0.05 | <0.001a | <0.05a |
| 20th day vs. 28th day | >0.05 | >0.05 | >0.05 | >0.05 |
†In addition, by comparing median value, Kruskal- Wallis Test (ANOVA) also find statistically significant difference (<0.0001).
Significant.
Table 5.
Mean fold expression of Osteopontin (mRNA and protein) between normal and impaired healing groups.
| Follow-ups | Osteopontin mRNA Expression Mean fold change ± SD (Range) Median |
P-value (two-tailed) | Osteopontin Protein Expression Mean fold change ± SD (Range) Median |
P-value (two-tailed) | ||
|---|---|---|---|---|---|---|
| Normal Healing |
Impaired Healing |
Normal Healing |
Impaired Healing |
|||
| (N = 102) | (N = 19) | (N = 102) | (N = 19) | |||
| 04th Day | 1.61 ± 0.41 | 1.48 ± 0.49 | 0.66 ± 0.21 | 0.58 ± 0.22 | ||
| (1.01–2.56) | (0.98–2.33) | U = 748 | (0.31–1.24) | (0.23–0.97) | U = 794.5 | |
| 1.56 | 1.28 | P = 0.1163 | 0.64 | 0.57 | P = 0.2152 | |
| 07th Day | 3.80 ± 0.52 | 3.38 ± 0.65 | 0.83 ± 0.31 | 0.69 ± 0.25 | ||
| (3.04–4.98) | (2.01–4.54) | U = 586.5 | (0.45–1.78) | (0.31–1.23) | U = 715.5 | |
| 3.67 | 3.25 | P = 0.0065a | 0.77 | 0.73 | P = 0.0715 | |
| 10th Day | 4.40 ± 0.71 | 3.97 ± 0.52 | 1.31 ± 0.51 | 1.08 ± 0.53 | ||
| (3.06–5.76) | (2.97–5.13) | U = 627.5 | (0.45–2.43) | (0.43–2.07) | U = 705.5 | |
| 4.25 | 4.05 | P = 0.0152a | 1.25 | 0.84 | P = 0.0610 | |
| 15th Day | 2.57 ± 0.35 | 2.43 ± 0.44 | 0.81 ± 0.34 | 0.68 ± 0.34 | ||
| (2.01–3.69) | (1.98–3.58) | U = 699 | (0.31–1.85) | (0.25–1.72) | U = 738 | |
| 2.60 | 2.27 | P = 0.0549 | 0.85 | 0.64 | P = 0.1006 | |
| 20th Day | 1.63 ± 0.31 | 1.48 ± 0.31 | 0.42 ± 0.17 | 0.36 ± 0.15 | ||
| (1.01–2.63) | (0.98–2.01) | U = 737 | (0.22–0.89) | (0.21–0.78) | U = 757 | |
| 1.65 | 1.45 | P = 0.0991 | 0.37 | 0.35 | P = 0.1319 | |
| 28th Day | 1.41 ± 0.40 | 1.26 ± 0.33 | 0.20 ± 0.08 | 0.17 ± 0.05 | ||
| (0.95–2.59) | (0.75–1.76) | U = 776.5 | (0.11–0.53) | (0.09–0.31) | U = 792 | |
| 1.31 | 1.25 | P = 0.1714 | 0.16 | 0.16 | P = 0.2085 | |
Significant; Mann- Whitney U test.
Fig. 5.
Figure showing mean fold change of (a) Osteocalcin and Osteopontin mRNA expression, showing statistical significant difference in expression between normal and impaired healing at 10th, 15th, 20th and 28th day and at 07th and 10th day of post-fracture respectively. (b) Osteocalcin protein expression, showing statistical significant difference in expression between normal and impaired healing at 20th and 28th day. Osteopontin protein expression showing no statistical significant difference between normal and impaired healing group, and (c) Western blot analysis of Osteocalcin and Osteopontin protein expression between normal and impaired healing groups, normalized with GAPDH. The Error bars in the graphs represent standard deviation.
Table 6.
Mean fold expression of Osteopontin (mRNA and protein) within normal and impaired healing groups.
| ANOVA(Dunn's Multiple Comparisons Test) | Osteopontin mRNA Expression |
Osteopontin protein Expression |
||
|---|---|---|---|---|
| Normal Healing |
Impaired Healing |
Normal Healing |
Impaired Healing |
|
| (N = 102) |
(N = 19) |
(N = 102) |
(N = 19) |
|
| P value (two-tailed) | P value (two-tailed) | |||
| 04th day vs. 07th day | <0.001a | <0.001a | >0.05 | >0.05 |
| 04th day vs. 10th day | <0.001a | <0.001a | <0.001a | >0.05 |
| 04th day vs. 15th day | <0.001a | <0.05a | >0.05 | >0.05 |
| 04th day vs. 20th day | >0.05 | >0.05 | <0.001a | >0.05 |
| 04th day vs. 28th day | >0.05 | >0.05 | <0.001a | <0.001a |
| 07th day vs. 10th day | >0.05 | >0.05 | <0.001a | >0.05 |
| 07th day vs. 15th day | <0.001a | >0.05 | >0.05 | >0.05 |
| 07th day vs. 20th day | <0.001a | <0.001a | <0.001a | <0.05a |
| 07th day vs. 28th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 10th day vs. 15th day | <0.001a | <0.05a | <0.001a | >0.05 |
| 10th day vs. 20th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 10th day vs. 28th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 15th day vs. 20th day | <0.001a | <0.05a | <0.001a | <0.05a |
| 15th day vs. 28th day | <0.001a | <0.001a | <0.001a | <0.001a |
| 20th day vs. 28th day | >0.05 | >0.05 | <0.001a | >0.05 |
† In addition by comparing median value, Kruskal- Wallis Test (ANOVA) also find statistically significant difference (<0.0001).
Significant.
The significant positive correlation was found between the peak mean OPN mRNA expression (at 28th day) with the fracture healing progression at different follow up measured using RUST scoring at 16th, 20th & 24th week of post-fracture follow-ups. However, OPN protein expression was showing an insignificant correlation (Table 7). Also, insignificant correlations were observed in patients divided as per Muller's AO Classification (A1 = 38; A2 = 37 and A3 = 46). Besides our main findings, we have also observed that the mRNA expression of both the biomarkers (OC and OPN) showed most of the significant differences as compared to their protein expressions.
Table 7.
Correlation between the peak mean Osteocalcin (at 28th day) and Osteopontin (at 10th day) expressions with the healing progression at different follow ups (RUST Score).
| Expressions Versus | RUST Score at |
RUST Score at |
RUST Score at |
RUST Score at |
RUST Score at |
||
|---|---|---|---|---|---|---|---|
| 06 Week | 10 Week | 16 Week | 20 Week | 24 Week | |||
| Osteocalcin | mRNA | Spearman r | 0.1155 | 0.2044 | 0.1822 | 0.2317 | 0.2316 |
| P value | 0.2072 | 0.0245a | 0.0454a | 0.0106a | 0.0106a | ||
| Protein | Spearman r | 0.07368 | 0.1218 | 0.05288 | 0.1067 | 0.08337 | |
| P value | 0.4219 | 0.1832 | 0.5646 | 0.2441 | 0.3633 | ||
| Osteopontin | mRNA | Spearman r | 0.1763 | 0.1721 | 0.2326 | 0.2193 | 0.2632 |
| P value | 0.0531 | 0.0592 | 0.0102a | 0.0157a | 0.0035a | ||
| Protein | Spearman r | 0.1731 | 0.1663 | 0.1715 | 0.1518 | 0.1287 | |
| P value | 0.0577 | 0.0684 | 0.0600 | 0.0965 | 0.1594 | ||
Significant.
4. Discussion
An article by Cox et al. (2010)18 observed that the biochemical markers of bone-turnover have long been used to complement the radiological assessment of patients with metabolic bone disease. Due to the rapid accumulation of new knowledge of bone matrix biochemistry, attempts have been made to use these biochemical markers in the interpretation and characterization of various stages of the healing of fractures. The basic aim of this study was to quantify the expression of OC (an osteoblastic marker) and OPN (an osteoclastic marker) in peripheral blood at the initial phase of fracture healing and to correlate their expression levels at selected intervals with the healing outcome of the tibial fracture. Our research hypothesis was that the fracture healing is a complex phenomenon that comprises of different overlapped, but sequential biological events in which processes like osteoclastogenesis or osteoblastogenesis process. Therefore, it might happen that biochemical markers that play an essential role in processes like osteoclastogenesis or osteoblastogenesis may show an optimum differential expression pattern throughout the healing phase of the fracture. Any quantifiable alteration in their expression may predict early impaired fracture healing. In the present study, we observed the differential expression of OC and OPN throughout the initial phase of fracture healing and concluded that the expression may provide an early prediction of the healing outcomes of simple diaphyseal tibial fractures. However, instead of proteomic expression, in the present study transcriptomic expression was more significantly correlated and recommended to be a potential predictive biomarkers. These observations may also indicate that the mRNA and protein expressions of OC and OPN are not similar in proportion, may be due to post-transcriptional and translational modifications, and we are not able to presume the expression of mRNA by analysing their protein expression of OC/OPN or vice versa.
Small sample size, as well as single-centric study, leads to low numbers of impaired healing cases was the limitation of the present study. Beside that on the same study pattern, the author also suggested some other bone biomarkers also for a better outcome. Therefore the author recommends further multicentric study with a large sample size to increase the validity, reliability, and generalizability of our observation and inferences.
Nyman et al. (1991)19 found that mean values of OC were somewhat higher in the group showing faster healing of fracture as compared to slow healing group patients with crural fractures. However, the difference was not significant. In the present study, we also found the same observation, having higher OC mRNA and protein expression level in normal healing as compared to the impaired healing group, which were significant in most of the follow-ups. According to Oni et al. (1989)7 normally uniting fractures had generally shown higher values of OC activity compared with fractures exhibiting delayed union patients. This indicated depressed osteoblastic activity in slowly healing fractures. They observed that patients with tibial or femoral shaft fractures showing normal fracture healing process presented an increase in OC expression level after traumatic fracture from day 01. As per their finding, we also observed the higher OC expression in normal healing as compared to impaired healing patients from 04 to 28 post-fracture days. Herrmann et al. (2002)20 also observed that delayed healing patients’ showed a delay/lag in the rise of OC expression during the first 2 months. In the present study, we too observed higher OC mRNA and protein expression levels in normal healing as compared to the impaired healing group; however, we could not find any significant delay in rising of OC expression in both groups. Unlike the above observations, Marchelli et al. (2009)21 and Emami et al. (1999)22 found no difference in serum OC level between delayed and normal bone union patients. In our study, we found different observation, having higher OC mRNA and protein expression level in normal healing as compared to the impaired healing group showing a statically significant difference at most follow-ups. To the best of our limited knowledge, Herrmann et al. (2002)20; Oni et al. (1989)7; Nyman et al. (1991)19 studied the expression of OC with regard to fracture healing outcome. Our present study observations rely on the aforementioned study and showed a higher OC expression level in normal healing as compared to the impaired healing group. These findings suggest that OC might play a vital role in osteoblastogenesis during the early phase of healing. In a follow-up study on mice, Duvall et al. (2007)11 observed a slight decrease in OPN mRNA expression at 07th day from the baseline (3rd day), followed by an increase at 14th post-fracture day in wild-type but no OPN mRNA expression was found in OPN knockout mice. They also concluded that OPN deficiency significantly alters several stages of the bone healing process, including callus formation, neovascularization, and late-stage remodeling but does not prevent bony union. In the present study, we observed OPN expression (mRNA and protein) gradually elevated from baseline to 10th day only and then gradually decline until the end of the post-fracture follow-up (i.e. 28th day). This variation in observations might be due to the use of different study models as well as the follow-up protocols. However, we also agree with the observations that alter in OPN expressions might be the cause of impaired bone healing. To the best of our limited knowledge, only the Duvall et al. (2007)11, studied the expression of OPN in relation to fracture healing outcome and suggested that deficiency of OPN may lead to delay in fracture healing. In their study, OPN mRNA showed temporal expression with a slight decrease in OPN mRNA expression at 07th day from the baseline, followed by an increase at 14th post-fracture day in the wild-type mouse model. In the present study, our observation was corresponding to the above-mentioned study with slight variation as in our study, we find no decline in OPN expression at 07th post-fracture day, which might be further due to the difference in study models.
The present study is the first study to correlate the OC and OPN expression with RUST scoring that relies on the fracture healing progression. In this study, a positive correlation was observed between peak OC and OPN mRNA expression with a mean RUST score at most of the follow-ups. However, insignificant correlations of OC and OPN protein expression with the RUST score at all follow-ups were observed, suggestive of new bone formation (callus at the fracture site). The insignificant correlation was observed due to the fact that radiological early callus appears late on conventional plain radiographs and may be due to the circadian rhythm of bone remodeling, seasonal effects as well as a high range of variation in expression level.
As our finding showed the significant statistical difference of OC and OPN expression between both groups at most of the follow-ups, mostly in mRNA expressions, it might be considered as a prognostic biomarker to predict impaired healing early by quantifying the OC and OPN expression level in patient peripheral blood. One more interesting thing that we observed in the present study was that the mRNA expression was showing the most significant difference between the normal and impaired healing group as compared to protein expressions of selected genes. Additionally, they were also showing a more significant correlation to healing progression (RUST score) of the fracture when compared with the protein expression of the selected genes. Therefore, the authors recommend mRNA expression of the selected gene had the potential to predict the impaired healing strongly. However, the variability in the observations might be due to different half-lives of mRNA and protein as well as a significant amount of error/noise while conducting the study that may limit our ability to get a clear picture. Besides that, the source of origin of both mRNA and protein expression of selected gene quantified in the peripheral blood samples was still a big question. This may be predicted that most of the detected protein (OC and OPN) was originated from the local site of the fracture, but most of the detected mRNA (OC and OPN) in the peripheral blood might originate from hematopoietic cells. However, we were not able to produce any evidence in this regards in the present study. This might be a dilemma that has to be explored by further studies.
5. Conclusion
Fracture healing is a very complex process which involves the expression of thousands of biomarkers. Since these biomarkers are derived from both cortical and trabecular bone, they may reflect the metabolic activity of the entire skeleton. Therefore, the detail explorations of the role as well as the correlation of the biomarkers with fracture healing or bone remodeling process are in demand. These markers not only may predict the impaired healing of the fractured bone, but may predict the same for various other skeleton disorders. In the present study, we conclude that OC and OPN expression provide an early prediction of the healing outcomes of simple diaphyseal tibial fractures. Also in the present study mRNA expression was more significantly correlated than the protein expression and recommended to be a potential predictive biomarker. However, due to the large intra and inter-individual variability in expressions, we may not able to strongly predict the healing outcome of the fracture by taking these biomarkers (OC and OPN) expression alone. But at the same time the authors realize that instead of selecting single biomarker if we use two or combinations of different biomarkers having a vital role in fracture healing, we may able to strongly predict the healing outcome early. If the role of any of the biochemical marker or combination of markers in relation to the healing of the fracture is further proved, it may open new horizons for innovations in this field with an addition to our armamentarium to deal with complications associated with impaired fracture healing, especially in tibial bone fractures.
6. Limitation of the study
Small sample size, as well as single-centric study, leads to low numbers of impaired healing cases was the limitation of the present study. The biomarkers might be raised due to osteomalacia also be a limitation of the present study. Beside that on the same study pattern, the author also suggested some other bone biomarkers for a better outcome. Therefore the author recommends further multicentric study with a large sample size to increase the validity, reliability, and generalizability of our observation and inferences.
Funding
This study was funded by the Indian Council of Medical Research, New Delhi (No 5/4-5/12/Trauma/2011-NCD-I).
Conflicts of interest
The authors have no conflict of interest in this article.
References
- 1.Patel M., McCarthy J.J., Herzenberg J. 2011. Tibial Nonunion. Medscape Reference.https://emedicine.medscape.com/article/1252306-overview Last assess on. [Google Scholar]
- 2.Reed L.K., Mormino M.A. Distal tibia nonunions. Foot Ankle Clin. 2008;13(4):725–735. doi: 10.1016/j.fcl.2008.09.001. [DOI] [PubMed] [Google Scholar]
- 3.Marsh D. Concepts of fracture union, delayed union, and nonunion. Clin Orthop Relat Res. 1998 Oct 1;355:S22–S30. doi: 10.1097/00003086-199810001-00004. [DOI] [PubMed] [Google Scholar]
- 4.Sarmiento A., Gersten L.M., Sobol P.A., Shankwiler J.A., Vangsness C.T. Tibial shaft fractures treated with functional braces. Experience with 780 fractures. Bone Jt J. 1989;71(4):602–609. doi: 10.1302/0301-620X.71B4.2768307. [DOI] [PubMed] [Google Scholar]
- 5.Wada S., Fukawa T., Kamiya S. Osteocalcin and bone. Clin Calcium. 2007;17(11):1673–1677. 5 (in Japanese) [PubMed] [Google Scholar]
- 6.Kavukcuoglu N.B., Patterson-Buckendahl P., Mann A.B. Effect of osteocalcin deficiency on the nanomechanics and chemistry of mouse bones. J Mech Behav Biomed Mater. 2009;2(4):348–354. doi: 10.1016/j.jmbbm.2008.10.010. [DOI] [PubMed] [Google Scholar]
- 7.Oni O.O., Mahabir J.P., Iqbal S.J., Gregg P.J. Serum osteocalcin and total alkaline phosphatase levels as prognostic indicators in tibial shaft fractures. Injury. 1989;20(1):37–38. doi: 10.1016/0020-1383(89)90042-9. [DOI] [PubMed] [Google Scholar]
- 8.Mckee M.D., Nanci A. Osteopontin: an interfacial extracellular matrix protein in mineralized tissues. Connect Tissue Res. 1996 Jan 1;35(1-4):197–205. doi: 10.3109/03008209609029192. [DOI] [PubMed] [Google Scholar]
- 9.Nakamura H., Ozawa H. Immunolocalization of CD44 and the ERM family in bone cells of mouse tibiae. J Bone Miner Res. 1996;11(11):1715–1722. doi: 10.1002/jbmr.5650111115. [DOI] [PubMed] [Google Scholar]
- 10.Weber G.F., Ashkar S., Glimcher M.J., Cantor H. Receptor-ligand interaction between CD44 and osteopontin (Eta-1) Science. 1996;271(5248):509–512. doi: 10.1126/science.271.5248.509. [DOI] [PubMed] [Google Scholar]
- 11.Duvall C.L., Taylor W.R., Weiss D., Wojtowicz A.M., Guldberg R.E. Impaired angiogenesis, early callus formation, and late stage remodeling in fracture healing of osteopontin-deficient mice. J Bone Miner Res. 2007;22(2):286–297. doi: 10.1359/jbmr.061103. [DOI] [PubMed] [Google Scholar]
- 12.Chellaiah M.A., Kizer N., Biswas R. Osteopontin deficiency produces osteoclast dysfunction due to reduced CD44 surface expression. Mol Biol Cell. 2003;14(1):173–189. doi: 10.1091/mbc.E02-06-0354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Davis B.J., Roberts P.J., Moorcroft C.I., Brown M.F., Thomas P.B., Wade R.H. Reliability of radiographs in defining union of internally fixed fractures. Injury. 2004;35(6):557–561. doi: 10.1016/S0020-1383(03)00262-6. [DOI] [PubMed] [Google Scholar]
- 14.Hammer R., Hammerby S., Lindholm B. Accuracy of radiological assessment of tibial shaft fractures in humans. Clin Orthop Relat Res. 1985;199:233–238. [PubMed] [Google Scholar]
- 15.McCloskey E.V., Spector T.D., Eyres K.S. The assessment of vertebral deformity: a method for use in population studies and clinical trials. Osteoporos Int. 1993;3(3):138–147. doi: 10.1007/BF01623275. [DOI] [PubMed] [Google Scholar]
- 16.Ali S., Singh S., Agarwal A., Parihar A., Mahdi A.A., Srivastava R.N. Reliability of the RUST score for the assessment of union in simple diaphyseal tibial fractures. Int J Biomed Res. 2014;05(05):333–335. [Google Scholar]
- 17.Whelan D.B., Bhandari M., Stephen D. Development of the radiographic union score for tibial fractures for the assessment of tibial fracture healing after intramedullary fixation. J Trauma Acute Care Surg. 2010;68(3):629–632. doi: 10.1097/TA.0b013e3181a7c16d. [DOI] [PubMed] [Google Scholar]
- 18.Cox G., Einhorn T.A., Tzioupis C., Giannoudis P.V. Bone-turnover markers in fracture healing. Bone Jt J. 2010;92(3):329–334. doi: 10.1302/0301-620X.92B3.22787. [DOI] [PubMed] [Google Scholar]
- 19.Nyman M.T., Paavolainen P., Forsius S., Lamberg-Allardt C. Clinical evaluation of fracture healing by serum osteocalcin and alkaline phosphatase. Ann Chir Gynaecol. 1991;80(3):289–293. [PubMed] [Google Scholar]
- 20.Herrmann M., Klitscher D., Georg T., Frank J., Marzi I., Herrmann W. Different kinetics of bone markers in normal and delayed fracture healing of long bones. Clin Chem. 2002;48(12):2263–2266. [PubMed] [Google Scholar]
- 21.Marchelli D., Lp Piodi, Corradini C., Parravicini L., Verdoia C., Ulivieri F.M. Increased serum OPG in atrophic nonunion shaft fractures. J Orthop Traumatol. 2009;10(2):55–58. doi: 10.1007/s10195-009-0047-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Emami A., Larsson A., Petren-Mallmin M., Larsson S. Serum bone markers after intramedullary fixed tibial fractures. Clin Orthop Relat Res. 1999;368:220–229. [PubMed] [Google Scholar]