Abstract
Simple Summary
Alpha-ketoglutarate (AKG) is a critical intermediate in the tricarboxylic acid cycle. AKG has been reported to participate in energy production, promote protein synthesis, and improve amino acid metabolism. However, whether AKG functionally participates in the regulation of fat metabolism remains unknown. The objective of this experiment was to evaluate the impact of dietary supplementation with AKG on lipid metabolism in a pig model. The present results suggest that AKG supplementation in a reduced-protein diet could increase the intramuscular fat (IMF) and monounsaturated fatty acid (MUFA) contents in the biceps femoris muscles of pigs. These effects could be linked to the altered lipid metabolism related gene mRNA expression, which promotes the absorption and deposition of fatty acids in the muscle tissues. The results of this study can provide better understanding of the mechanisms by which dietary AKG modulates muscle lipid metabolism in pigs, and this could help to improve pig feeding strategies and supply high-quality pork for humans.
Abstract
The aim of the current study was to investigate whether dietary supplementation with alpha-ketoglutarate (AKG) in a reduced crude protein (CP) diet would affect fatty acid composition and lipid metabolism related gene expression in the muscles of growing pigs. A total of 27 Large White × Landrace growing pigs at 44 ± 1 d of age (11.96 ± 0.18 kg) were randomly allocated to three treatments (n = 9). Dietary treatments included: (1) normal protein diet with 20% crude protein (CP) (NP); (2) a low crude protein diet formulated to contain approximately 17% CP (LP); and (3) a low crude protein diet with 17% CP supplemented with 1% AKG at the expense of regular corn components (ALP). The experimental trial lasted 35 d. The results showed that compared with the NP and LP diets, supplementation with AKG in a low-protein diet increased the intramuscular fat (IMF), oleic acid (C18:1n-9), and monounsaturated fatty acid (MUFA) contents (p < 0.05), and tended to increase the percentage of palmitoleic acid (C16:1) and stearic acid (C18:0) (p < 0.10) in the biceps femoris and longissimus dorsi muscles of growing pigs. These effects may be associated with increased relative mRNA expression levels of fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), adipocyte determination and differentiation factor 1 (ADD1), fatty acid binding protein 4 (FABP4), and stearoyl-CoA desaturase (SCD) in skeletal muscle, indicating that AKG might be involved in the differential regulation of some key lipogenic genes in skeletal muscles of pigs.
Keywords: alpha-ketoglutarate, growing pigs, fatty acid composition, intramuscular fat, lipid metabolism
1. Introduction
With the increasing focus on the quality of pork for human consumption, fatty acid composition has been investigated as a desirable attribute in muscle and adipose tissues of farm animals [1]. The quality of a pig carcass and cuts is mostly dependent on the muscle and fat contents [2]. Increasing skeletal muscle growth and reducing excess fat accretion are major goals for pig production [3]. Intramuscular fat (IMF), also termed marbling fat, which is the total lipid within the skeletal muscles, plays a prominent role in meat quality, and the content of IMF is directly correlated with the quality of flesh including the nutritional value, flavor, and texture [4]. Nutritional modulation is an efficient way to change meat quality by affecting the muscle/fat ratio and composition [5,6,7]; however, the underlying mechanisms are still largely unknown.
Alpha-ketoglutarate (AKG) is a molecule that has a central role in the Krebs cycle, determining the overall rate of the citric acid cycle of the organism, and is also a nitrogen scavenger in the body. AKG can be rapidly converted into glutamate through the transamination by glutamate dehydrogenase, and further into glutamine through the amination by glutamine synthase [8]. AKG has a great effect on suppressing the production of oxygen free radicals and preventing peroxidative damage of lipids by participating in nonenzymatic oxidative decarboxylation during the decomposition of hydrogen peroxide [9]. Infusion of AKG may contribute to improved nutrient utilization and energy expenditure in growing pigs [10]. Furthermore, dietary supplementation with AKG improves energy status by modulating the AMP-activated protein kinase (AMPK) signaling pathway in the small intestine of piglets [11]. The addition of AKG can also enhance energy status by activating mechanistic target of rapamycin (mTOR) signaling, which inhibits acetyl-coenzyme A carboxylase (ACC) β in skeletal muscles of piglets [12]. Similarly, dietary AKG supplementation could increase muscle mass of weanling piglets [13]. Yao et al. (2013) reported that mTOR pathway was induced by AKG supplementation, which increased skeletal muscle mass in rats [14]. Our previous study demonstrated that the addition of AKG to a low-protein diet improved growth performance [15] and promoted the cells in skeletal muscles to synthesize amino acids in growing pigs [16]. Additionally, the muscular fiber and fatty acid composition in pig skeletal muscles were modulated by the dietary supplementation of monosodium l-glutamate [3]. These studies revealed that AKG might also affect muscle flesh quality and lipid metabolism in pigs, which is valuable to investigate. Several studies have reported that synthetic amino acid plays a critical role in lipid metabolism of pigs [6,17]. However, to the best of our knowledge, there are no studies on the effects of dietary AKG supplementation on lipid metabolism in pigs. Therefore, this study was conducted to investigate whether dietary supplementation with AKG in a reduced protein diet would affect fatty acid composition and lipid metabolism related gene expression in the muscles of growing pigs.
2. Materials and Methods
All experimental procedures used throughout this study were approved by the Committee of Animal Ethics at Hunan Agricultural University (permit number: CACAHU 2018-0069). The AKG (purity ≥98%) was obtained from Hubei Yuancheng Saichuang Technology Co., Ltd. (Wuhan, China).
2.1. Animals, Experimental Design, and Diets
A total of 27 Large White × Landrace growing pigs at 44 ± 1 d of age (11.96 ± 0.18 kg) were randomly allocated to the 3 following treatment groups: (1) normal protein diet with 20% crude protein (CP) (NP); (2) a low crude protein diet formulated to contain approximately 17% CP (LP); and (3) a low crude protein with 17% CP supplemented with 1% AKG at the expense of regular corn components (ALP). There were 9 replicates in each treatment, with 1 pig per replicate. The 3 diets were formulated based on corn–soybean meal to be isocaloric and meet the nutritional needs of these animals following National Research Council (NRC, 2012) guidelines (Table 1) [18]. Pigs were housed individually in cages equipped with a feeder and a nipple drinker, and all pigs had ad libitum access to clean drinking water and their assigned diets. The experiment lasted 35 d.
Table 1.
Ingredient composition and nutrient levels in experimental diets (as-fed basis, %).
| Items | Dietary Treatment a | ||
|---|---|---|---|
| NP | LP | ALP | |
| Ingredient (%) | |||
| Corn | 63.64 | 66.50 | 65.50 |
| Soybean meal | 19.80 | 18.80 | 18.80 |
| Dried whey | 4.30 | 4.30 | 4.30 |
| Fish meal | 9.00 | 4.00 | 4.00 |
| Soybean oil | 0.80 | 2.60 | 2.60 |
| AKG b | 0.00 | 0.00 | 1.00 |
| Limestone | 0.50 | 0.60 | 0.60 |
| Monocalcium phosphate | 0.00 | 0.74 | 0.74 |
| L-lysine-HCl | 0.41 | 0.65 | 0.65 |
| L-threonine | 0.11 | 0.25 | 0.25 |
| DL-methionine | 0.13 | 0.20 | 0.20 |
| L-tryptophan | 0.01 | 0.06 | 0.06 |
| Sodium chloride | 0.30 | 0.30 | 0.30 |
| Premix c | 1.00 | 1.00 | 1.00 |
| Total | 100.00 | 100.00 | 100.00 |
| Nutrient level (%) | |||
| Digestible energy (MJ/kg) d | 14.60 | 14.60 | 14.60 |
| Crude protein | 20.19 | 17.21 | 17.20 |
| Lysine | 1.25 | 1.24 | 1.23 |
| Methionine | 0.38 | 0.37 | 0.37 |
| Methionine + cysteine | 0.62 | 0.65 | 0.63 |
| Threonine | 0.76 | 0.73 | 0.74 |
| Tryptophan | 0.22 | 0.22 | 0.21 |
| Total calcium | 0.72 | 0.72 | 0.71 |
| Total phosphorus | 0.65 | 0.64 | 0.63 |
a NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein. b AKG, alpha-ketoglutarate. c Supplied per kg of diet: CuSO4·5H2O, 19.8 mg; KI, 0.20 mg; FeSO4·7H2O, 400 mg; NaSeO3, 0.56 mg; ZnSO4·7H2O, 359 mg; MnSO4 H2O, 10.2 mg; Vitamin K (menadione), 5 mg; Vitamin B1, 2 mg; Vitamin B2, 15 mg; Vitamin B12, 30 g; Vitamin A, 5400 IU; Vitamin D3, 110 IU; Vitamin E, 18 IU; Choline chloride, 80 mg; Antioxidants, 20 mg; Fungicide, 100 mg. d Calculated values, other values were measured directly.
2.2. Sample Collection and Preparation
All pigs were weighed individually at the beginning and the end of the experiment. The feed consumption was recorded at the end of the experiment to calculate average daily gain, average daily feed intake, and feed-to-gain ratio, as previously described [15]. When the feeding experiment ended, 8 mL blood samples were collected via jugular vein puncture into 10 mL tubes. The samples were centrifuged at 3000× g and 4 °C for 10 min to separate out the serum and were stored at −20 °C until analysis. Subsequently, the pigs were euthanized after being anesthetized by intraperitoneal injection of sodium pentobarbital. Samples of the longissimus dorsi and biceps femoris muscles were collected immediately, followed by sharp freezing in liquid nitrogen and −80 °C storage.
2.3. Measurement of Serum Lipid Related Substances
Serum nonesterified fatty acids (NEFAs), triglyceride, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and total cholesterol (TC) concentrations in serum were assayed using a biochemical analytical instrument (Cobas® c311, Basel, Switzerland).
2.4. Muscle Fatty Acid Composition
Total lipid and fatty acid composition in the muscle was measured according to the procedure of Chen et al. [19]. The detailed gas chromatography (GC) parameters were as described previously [20]. The concentration of individual fatty acids was quantified according peak area and expressed as a percentage of total fatty acids.
2.5. RNA Extraction, Complementary DNA Synthesis, and Quantitative RT-PCR
Total RNA isolation from longissimus dorsi and biceps femoris muscle tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA) was performed according to the manufacturer’s instructions. Purified and quality extracted RNA was carried out, as previously described [16].
Quantitative real-time PCR (qRT-PCR) was performed in triplicate for each complementary DNA (cDNA) sample, using an SYBR® Premix Ex Taq™ II qPCR kit (Takara Biotechnology Co. Ltd., Dalian, China) according to the manufacturer’s guidelines on an ABI7900HT real-time PCR system (Applied Biosystems, Forest City, CA, USA). Amplification was performed with the following conditions: denaturation for 10 min at 95 °C, followed by 40 PCR cycles of denaturation for 15 s at 95 °C, and annealing and extension for 60 s at 56–64 °C. Gene expression was normalized to GAPDH (internal reference) and presented as relative fold change compared with control (NP). All samples were measured in triplicate. The mRNA expression levels of target genes were calculated using the 2−ΔΔCt method [21]. All PCR primers used in this study are listed in Table 2 [22,23].
Table 2.
Primers used for real-time quantitative PCR in this study.
| Gene | Primer Sequence (5′-3′) | Size (bp) | Accession No. |
|---|---|---|---|
| ACC | F: GGCCATCAAGGACTTCAACC | 120 | NM_001114269 |
| R: ACGATGTAAGCGCCGAACTT | |||
| ADD1 | F: GCGACGGTGCCTCTGGTAGT | 218 | XM_021066226.1 |
| R: CGCAAGACGGCGGATTTA | |||
| FAS | F: GCCTAACTCCTCGCTGCAAT | 195 | NM_001099930.1 |
| R: TCCTTGGAACCGTCTGTGTTC | |||
| LPL | F: CTCGTGCTCAGATGCCCTAC | 148 | NM_214286.1 |
| R: GGCAGGGTGAAAGGGATGTT | |||
| SCD | F: GCCTACTATCTGCTGAGTGC | 152 | XM_021072070.1 |
| R: TCTCGGGCCCATTCATAAAC | |||
| FABP4 | F: TGGAAACTTGTCTCCAGTG | 147 | NM_001002817.1 |
| R: GGTACTTTCTGATCTAATGGTG | |||
| HSL | F: TCGGAGTGAACGGATTTG | 195 | - |
| R: TCCTCCTTGGTGCTAATCTCGT | |||
| GAPDH | F: TCGGAGTGAACGGATTTG | 219 | NM_001206359.1 |
| R: CCTGGAAGATGGTGATGG |
2.6. Statistical Analysis
Data collected in the present study were analyzed by analysis of variance, using the general linear model (GLM) procedures of SPSS v. 20.0 (IBM, Armonk, NY, USA). Differences between treatment means were classified using Tukey’s multiple comparison test. Results are presented as mean ± standard error. For all statistical analyses, significance level was set at p < 0.05, and tendency was declared at 0.05 < p < 0.10.
3. Results
3.1. Serum Biochemical Parameters
Pigs fed the ALP diet had lower (p < 0.05) circulating concentrations of TC and triglyceride compared with those fed NP and LP diets (p < 0.05) (Table 3). The serum concentrations of LDL cholesterol in the ALP group tended to be lower (p < 0.10). However, pigs fed the ALP diet had higher concentrations of HDL cholesterol than those fed the NP diet (p < 0.05). No differences (p > 0.10) in serum concentrations of nonesterified fatty acids were observed among the NP, LP, and ALP treatments.
Table 3.
Serum lipid-related substances of growing pigs fed normal protein or low-protein diets without or supplemented with AKG.
| Items | Dietary Treatment 1 | SEM | p-Value | ||
|---|---|---|---|---|---|
| NP | LP | ALP | |||
| Non-esterified fatty acid, μmol/L | 610.43 | 578.68 | 605.74 | 11.81 | 0.261 |
| HDL-cholesterol, mmol/L | 0.78 b | 0.84 a,b | 0.96 a | 0.12 | 0.032 |
| LDL-cholesterol, mmol/L | 1.47 | 1.36 | 1.32 | 0.03 | 0.074 |
| Triglyceride, mmol/L | 0.46 a | 0.38 a | 0.24 b | 0.04 | 0.028 |
| TC, mmol/L | 2.96 a | 2.88 a | 2.73 b | 0.05 | 0.039 |
1 NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein. a,b Means within a row with different superscripts differ (p < 0.05).
3.2. Intramuscular Fat and Fatty Acid Profile of Muscle
The IMF content of biceps femoris muscle with the LP and ALP diets was higher than that with the NP diet (p < 0.05) (Figure 1). No differences (p > 0.10) in the IMF content of longissimus dorsi muscle were found among the NP, LP, and ALP treatments.
Figure 1.
Effects of dietary AKG supplementation of a low crude protein diet on intramuscular fat (IMF) in the longissimus dorsi (a) and biceps femoris (b) muscles of growing pigs. Results are means ± SEM, representing nine animals per treatment. Bars without a common letter differ significantly (p < 0.05). NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein.
In comparison to the NP and LP diets, pigs fed low-protein diets supplemented with AKG tended to have an increased percentage of palmitoleic acid (C16:1) of the longissimus dorsi muscle, but decreased percentage of C17:0 (p < 0.10) (Table 4). Compared with the NP diet, the ALP diet significantly increased the percentage of monounsaturated fatty acid (MUFA) of the longissimus dorsi muscle in growing pigs (p < 0.05).
Table 4.
Fatty acid composition (% of total fatty acids) of longsissimus dorsi muscle from growing pigs fed normal protein or low-protein diets without or supplemented with AKG.
| Items | Dietary Treatment 1 | SEM | p-Value | ||
|---|---|---|---|---|---|
| NP | LP | ALP | |||
| C12:0 | 0.06 | 0.07 | 0.06 | 0.02 | 0.265 |
| C13:0 | 0.19 | 0.17 | 0.16 | 0.06 | 0.704 |
| C14:0 | 0.93 | 0.90 | 0.84 | 0.11 | 0.586 |
| C15:0 | 0.22 | 0.19 | 0.17 | 0.02 | 0.779 |
| C15:1 | 0.16 | 0.16 | 0.15 | 0.03 | 0.925 |
| C16:0 | 22.14 | 21.97 | 21.13 | 1.71 | 0.553 |
| C16:1 | 1.89 | 1.84 | 2.29 | 0.20 | 0.095 |
| C17:0 | 1.15 | 1.05 | 0.86 | 0.11 | 0.086 |
| C18:0 | 12.44 | 11.61 | 11.34 | 0.26 | 0.812 |
| C18:1n-9 | 30.13 | 30.99 | 31.77 | 2.21 | 0.115 |
| C18:2n-6 | 16.33 | 16.04 | 15.59 | 1.13 | 0.269 |
| C20:0 | 0.19 | 0.18 | 0.20 | 0.03 | 0.662 |
| C18:3n-3 | 0.51 | 0.50 | 0.48 | 0.07 | 0.238 |
| C20:2n-6 | 0.59 | 0.61 | 0.59 | 0.14 | 0.146 |
| C20:3n-6 | 0.33 | 0.30 | 0.28 | 0.06 | 0.804 |
| C20:3n-3 | 0.15 | 0.14 | 0.12 | 0.05 | 0.173 |
| C20:4n-6 | 1.72 | 1.66 | 1.60 | 0.19 | 0.147 |
| C20:5n-3 | 0.16 | 0.15 | 0.14 | 0.10 | 0.216 |
| C22:6n-3 | 0.13 | 0.13 | 0.12 | 0.29 | 0.418 |
| SFA 2 | 37.30 | 36.15 | 34.76 | 2.75 | 0.352 |
| MUFA 3 | 32.17 b | 32.99 a,b | 34.21 a | 2.34 | 0.049 |
| PUFA 4 | 19.91 | 19.54 | 18.91 | 1.07 | 0.526 |
| ΣPUFA:SFA | 0.53 | 0.54 | 0.54 | 0.09 | 0.599 |
| Σn-3 PUFA 5 | 0.94 | 0.93 | 0.86 | 0.30 | 0.198 |
| Σn-6 PUFA 6 | 18.97 | 18.61 | 18.05 | 1.17 | 0.371 |
| Σn-6:n-3 PUFA | 20.19 | 20.05 | 21.00 | 0.84 | 0.642 |
1 NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein. 2 SFA = C12:0 + C13:0 + C14:0 + C15:0 + C16:0 + C17:0 + C18:0 + C20:0. 3 MUFA = C15:1 + C16:1 + C18:1n-9. 4 PUFA = C18:2n-6 + C18:3n-6 + C18:3n-3 + C20:3n-6 + C20:3n-3+ C20:4n-6 + C20:5n-3 + C22:6n-3. 5 n-3 PUFA = C18:3n-3 + C20:3n-3 + C20:5n-3+ C22:6n-3. 6 n-6 PUFA = C18:2n-6 + C18:3n-6 + C20:3n-6 + C20:4n-6. a,b Means within a row with different superscripts differ (p < 0.05).
Compared with the NP and LP diets, the ALP diet showed significantly greater oleic acid (C18:1n-9) and MUFA (p < 0.05) content and an increased n-6:n-3 PUFA ratio (p < 0.05), and tended to increase the percentage of C16:1and stearic acid (C18:0) (p < 0.10) (Table 5). In addition, compared with the NP diet, pigs fed the ALP diet had a decreased percentage of eicosatrienoic acid (C20:3n-6) (p < 0.05).
Table 5.
Fatty acid composition (% of total fatty acids) of biceps femoris muscle of growing pigs fed normal protein or low-protein diets without or supplemented with AKG.
| Items | Dietary Treatment 1 | SEM | p-Value | ||
|---|---|---|---|---|---|
| NP | LP | ALP | |||
| C12:0 | 0.06 | 0.06 | 0.07 | 0.02 | 0.667 |
| C13:0 | 0.26 | 0.29 | 0.22 | 0.09 | 0.460 |
| C14:0 | 0.82 | 0.80 | 0.78 | 0.08 | 0.851 |
| C15:0 | 0.22 | 0.23 | 0.30 | 0.08 | 0.636 |
| C15:1 | 0.16 | 0.18 | 0.13 | 0.06 | 0.502 |
| C16:0 | 21.36 | 20.75 | 20.52 | 0.60 | 0.563 |
| C16:1 | 1.91 | 1.66 | 2.00 | 0.21 | 0.097 |
| C17:0 | 1.01 | 1.08 | 0.98 | 0.36 | 0.495 |
| C18:0 | 10.65 | 11.37 | 11.84 | 0.99 | 0.077 |
| C18:1n-9 | 27.67 b | 28.54 b | 31.94 a | 0.65 | 0.046 |
| C18:2n-6 | 19.62 | 19.61 | 18.38 | 0.39 | 0.119 |
| C20:0 | 0.15 | 0.15 | 0.17 | 0.03 | 0.286 |
| C18:3n-3 | 1.02 | 0.94 | 0.83 | 0.11 | 0.256 |
| C20:2n-6 | 0.75 | 0.71 | 0.67 | 0.09 | 0.243 |
| C20:3n-6 | 0.38 a | 0.35 a,b | 0.24 b | 0.13 | 0.041 |
| C20:3n-3 | 0.15 | 0.14 | 0.13 | 0.05 | 0.203 |
| C20:4n-6 | 2.40 | 2.27 | 2.11 | 0.13 | 0.477 |
| C20:5n-3 | 0.24 | 0.23 | 0.20 | 0.05 | 0.219 |
| C22:6n-3 | 0.18 | 0.17 | 0.17 | 0.02 | 0.312 |
| SFA 2 | 34.54 | 34.74 | 34.89 | 2.30 | 0.165 |
| MUFA 3 | 29.73 b | 30.38 b | 34.07 a | 1.26 | 0.038 |
| PUFA 4 | 24.74 | 24.42 | 22.73 | 1.39 | 0.219 |
| ΣPUFA:SFA | 0.72 | 0.70 | 0.65 | 0.07 | 0.104 |
| Σn-3 PUFA 5 | 1.58 | 1.48 | 1.33 | 0.03 | 0.135 |
| Σn-6 PUFA 6 | 23.15 | 22.94 | 21.40 | 2.44 | 0.132 |
| Σn-6:n-3 PUFA | 14.61 b | 15.49 a,b | 16.08 a | 1.51 | 0.026 |
1 NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein. 2 SFA = C12:0 + C13:0 + C14:0 + C15:0 + C16:0 + C17:0 + C18:0 + C20:0. 3 MUFA = C15:1 + C16:1 + C18:1n-9. 4 PUFA = C18:2n-6 + C18:3n-6 + C18:3n-3 + C20:3n-6 + C20:3n-3+ C20:4n-6 + C20:5n-3 + C22:6n-3. 5 n-3 PUFA = C18:3n-3 + C20:3n-3 + C20:5n-3+ C22:6n-3. 6 n-6 PUFA = C18:2n-6 + C18:3n-6 + C20:3n-6 + C20:4n-6. a,b Means within a row with different superscripts differ (p < 0.05).
3.3. Gene mRNA Expression Levels in Muscle
The mRNA expression levels of key genes involved in lipid metabolism were quantified to determine whether the genes are regulated by supplementation of low-protein diets with AKG. Figure 2 shows the mRNA expression levels of genes related to lipogenesis (acetyl-CoA carboxylase, ACC; stearoyl-CoA desaturase, SCD; adipocyte determination and differentiation factor 1, ADD1; fatty acid synthase, FAS); lipolysis (hormone-sensitive lipase, HSL; lipoprotein lipase, LPL); and lipid transport (fatty acid binding protein 4, FABP4) in the longissimus dorsi muscle (Figure 2a) and biceps femoris muscle (Figure 2b).
Figure 2.
Effects of dietary AKG supplementation of a low-protein diet on the relative mRNA expression levels of genes in the longissimus dorsi muscle (a) and biceps femoris muscle (b) of the growing pigs. Results are means ± SEM, representing nine animals per treatment. Bars without a common letter differ significantly (p < 0.05). NP, normal protein; LP, low crude protein; ALP, AKG + low crude protein.
In the longissimus dorsi muscle, there was no difference in mRNA levels of ACC, FAS, LPL, SCD, FABP4, and HSL among the groups (P > 0.05). The ALP group showed a higher level of mRNA for ADD1 than the other two groups (P < 0.05).
In the biceps femoris muscle, there was no difference in mRNA levels of LPL among the groups (P > 0.05). The ALP diet increased the mRNA levels of FAS, ACC, ADD1, FABP4, and SCD (P < 0.05), but decreased the mRNA level of HSL when compared with the NP and LP diets (P < 0.05). However, no significant difference was found between the NP and LP diets (P > 0.05).
4. Discussion
In this study, the primary aim was to investigate the IMF content and fatty acid profile in muscle tissues of growing pigs that were fed with a reduced protein diet supplemented with AKG. The secondary aim was to investigate the effects of supplementation with AKG on the mRNA expression levels of genes that are involved in lipid metabolism.
Over the last decades, commercial pig lines have benefited from intensive artificial selection to reduce the subcutaneous fat content, but this brought a concomitant decrease in marbling or IMF [23]. The IMF content is one of the most important traits that determines the characteristics of meat quality, such as tenderness, juiciness, and flavor [24]. It has been found that a higher IMF percentage in pork, including more monounsaturated and less polyunsaturated fatty acid, could be achieved by reducing the protein content of the pig diet [25,26]. Ranges of dietary protein concentrations (e.g., 21% vs. 18% and 20% vs. 17%) have been demonstrated to increase the IMF content in crossbred pigs [27,28]. In this study, the IMF content in muscle was also confirmed to be increased by feeding with a low-protein diet. To our knowledge, this is the first time an in vivo approach was used to investigate increased IMF in pigs fed low-protein diets supplemented with AKG, and our results on the effects of AKG supplementation are consistent with those of Tan et al. [29] and Madeira et al. [23], who demonstrated that dietary supplementation with 1% arginine increased IMF content in pig muscle. Therefore, a reduced-protein diet supplemented with AKG changed muscle composition, which might be related to alteration of lipid metabolism in muscle. Additionally, it has been reported that energy-related phosphorylation of AMPK and energy oxidation were stimulated by AKG in the intestinal mucosa [11]. The subsequent inactivation of the downstream target enzyme ACC, which is responsible for converting acetyl-CoA into malonyl-CoA, an inhibitor of fatty acid synthesis, and enhancing ATP supply to promote fat storage, improved the energy status in the skeletal muscles of pigs [12].
In recent years, the fatty acid composition of meat has been reported to be altered due to changes in target diets during the animal production cycle [7,25,26]. Therefore, the balance between fatty acid deposition and absorption could be indicated by the variations of fatty acid profile that is detected in skeletal muscle [22]. Fatty acid composition is also an important factor that determines the nutritional value and oxidative stability of muscle [27]. Since saturated fatty acid (SFA) and monounsaturated fatty acid (MUFA) are positively correlated with meat flavor [30], they are considered as essential indices of meat quality. Nutritional recommendations for a healthy swine diet suggest that the ratio of PUFA to SFA (PUFA/SFA) should be at least 0.40 [31]. A higher ratio of PUFA to SFA was found to be associated with a lower risk of coronary heart disease (CHD) in humans [32]. In this study, low crude protein diets supplemented with AKG increased the contents of palmitoleic acid (C16:1), oleic acid (C18:1n-9), and MUFA in skeletal muscles of pigs. Furthermore, the ratio of each kind of PUFA to SFA was over 0.40. These results might suggest that the improved capacity of PUFA synthesis in pigs and the change of the fatty acid profile in pig muscle might result from the AKG supplementation, which could be involved in MUFA synthesis in muscle, in a protein-reduced diet.
On the other hand, it has been reported that AKG can be converted into leucine, arginine, proline, and other amino acids in enterocytes [33]. Amino acids (e.g., leucine, isoleucine, arginine) play important roles in energy homeostasis and adipogenesis [17,22,34]. Thus, the alteration of IMF and MUFA content in muscle caused by dietary supplementation of AKG could be associated with the ectopic expression of genes involved in lipid metabolism that modulates muscle lipogenesis. SCD, the rate-limiting enzyme in the biosynthesis of MUFA from SFA, could catalyze the conversion of palmitate and stearate to the corresponding unsaturated fatty acids (C16:1, C18:1), which are important substrates for the synthesis of cholesterol and phospholipids [35,36]. In our results, pigs in the ALP group showed upregulation of SCD mRNA expression in biceps femoris muscle, which corresponded to the increased MUFA content in skeletal muscle and might indicate the induction of lipogenesis in IMF in pigs that were fed with an AKG-supplemented low-protein diet.
The indispensable rate-limiting enzymes in de novo lipogenesis (DNL) are fatty acid synthase and DNL commitment enzyme ACC [37]. ADD1 has been regarded as a principal regulatory transcription factor that controls the expression of PPARγ gene to promote DNL in animals [38,39]. FAS was found to be a key regulatory enzyme in fatty acid synthesis, which is involved in the final step of fatty acid biosynthesis in tissues [40], while HSL, as the most important lipase for intracellular triglyceride and diglyceride hydrolysis, catalyzed the first two degradation procedures of triglycerides and diglycerides [41]. Additionally, HSL can also facilitate the absorption and deposition of lipids [42]. FABP4, as a member of the fatty acid binding protein family, is responsible for the transport of fatty acids in adipocytes [43]. In this study, we did not identify any significant effect of a low-protein diet on the mRNA expression levels of key genes such as ACC, FAS, FABP4, and LPL controlling fatty acid deposition in both muscle tissues compared with control diet. Such findings are consistent with the results published by Madeira et al. [44]. Notably, our results reveal that feeding with a low-protein diet supplemented with AKG boosted the transcriptional expression of ACC, ADD1, FAS, and FABP4, but reduced the expression level of HSL in biceps femoris muscle. This might indicate that superior fatty acid transport and synthesis occurred, leading to the higher IMF content and fatty acid availability in biceps femoris muscle of pigs in the ALP group. Thus, it can be speculated that AKG supplementation in a low-protein diet may elevate the influx of fatty acids in different locations of the skeletal muscle, particularly in the biceps femoris muscle in pigs, but the underlying mechanism is still unknown. In order to further improve meat quality as well as nutritional value, it is still necessary to explore its underlying mechanism in detail.
5. Conclusions
In conclusion, the results obtained under the conditions of this experiment suggest that supplementation with AKG in a low-protein diet could increase the IMF and MUFA content in biceps femoris muscle of pigs. This might be a result of the alteration of mRNA expression level of important genes involved in lipid metabolism, further causing a change of absorption and utilization of fatty acids in muscle tissue. These changes could also provide a better understanding of how dietary AKG regulates muscle lipogenesis in pigs, and could potentially help to improve pig feeding strategies and supply high-quality pork for humans.
Author Contributions
Conceptualization, J.C. and K.Y.; methodology, J.C., F.C., and B.K.; software, Y.L. and J.C.; validation, J.C. and K.Y.; formal analysis, C.F. and H.G.; data curation, B.K.; writing-original draft preparation, J.C. and K.Y.; writing-review & editing, J.C., K.Y., and H.Z.
Funding
This work was supported by the National Natural Science Foundation of China (31472107); the Chinese Academy of Sciences ‘Hundred Talent’ award; and the Hunan Agricultural University provincial outstanding doctoral dissertation cultivating fund (YB2017002).
Conflicts of Interest
Authors declare that they have no conflicts of interest.
References
- 1.Dannenberger D., Nuernberg K., Nuernberg G., Priepke A. Impact of dietary protein level and source of polyunsaturated fatty acids on lipid metabolism-related protein expression and fatty acid concentrations in porcine tissues. J. Agric. Food Chem. 2014;62:12453–12461. doi: 10.1021/jf504699a. [DOI] [PubMed] [Google Scholar]
- 2.Kouba M., Bonneau M. Compared development of intermuscular and subcutaneous fat in carcass and primal cuts of growing pigs from 30 to 140 kg body weight. Meat Sci. 2009;81:270–274. doi: 10.1016/j.meatsci.2008.08.001. [DOI] [PubMed] [Google Scholar]
- 3.Wood J.D., Nute G.R., Richardson R.I., Whittington F.M., Southwood O., Plastow G., Mansbridge R., da Costa N., Chang K.C. Effects of breed, diet and muscle on fat deposition and eating quality in pigs. Meat Sci. 2004;67:651–667. doi: 10.1016/j.meatsci.2004.01.007. [DOI] [PubMed] [Google Scholar]
- 4.Fernandez X., Monin G., Talmant A., Mourot J., Lebret B. Influence of intramuscular fat content on the quality of pig meat-1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Sci. 1999;53:59–65. doi: 10.1016/S0309-1740(99)00037-6. [DOI] [PubMed] [Google Scholar]
- 5.Ye C., Zeng X., Zhu J., Liu Y., Ye Q., Qiao S., Zeng X. Dietary N-Carbamylglutamate Supplementation in a Reduced Protein Diet Affects Carcass Traits and the Profile of Muscle Amino Acids and Fatty Acids in Finishing Pigs. J. Agric. Food Chem. 2017;65:5751–5758. doi: 10.1021/acs.jafc.7b02301. [DOI] [PubMed] [Google Scholar]
- 6.Duan Y., Li F., Guo Q., Wang W., Zhang L., Wen C., Yin Y. Branched-chain amino acid ratios modulate lipid metabolism in adipose tissues of growing pigs. J. Funct. Foods. 2018;40:614–624. doi: 10.1016/j.jff.2017.12.004. [DOI] [Google Scholar]
- 7.Apple J.K., Maxwell C.V., Bass B.E., Yancey J.W.S., Payne R.L., Thomson J. Effects of reducing dietary crude protein levels and replacement with crystalline amino acids on growth performance, carcass composition, and fresh pork quality of finishing pigs fed ractopamine hydrochloride. J. Anim. Sci. 2017;95:4971–4985. doi: 10.2527/jas2017.1818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Radzki R.P., Bienko M., Pierzynowski S.G. Effect of dietary alpha-ketoglutarate on blood lipid profile during hypercholesterolaemia in rats. Scand. J. Clin. Lab. Investig. 2009;69:175–180. doi: 10.1080/00365510802464633. [DOI] [PubMed] [Google Scholar]
- 9.Selvaraj V., Dakshayani K.B., Perumal S. Effects of alpha-ketoglutarate on antioxidants and lipid peroxidation products in rats treated with ammonium acetate. Nutrition. 2002;18:747–750. doi: 10.1016/s0899-9007(02)00825-0. [DOI] [PubMed] [Google Scholar]
- 10.Junghans P., Derno M., Pierzynowski S., Hennig U., Eberhard Rudolph P., Souffrant W.B. Intraduodenal infusion of alpha-ketoglutarate decreases whole body energy expenditure in growing pigs. Clin. Nutr. 2006;25:489–496. doi: 10.1016/j.clnu.2005.11.003. [DOI] [PubMed] [Google Scholar]
- 11.Hou Y., Yao K., Wang L., Ding B., Fu D., Liu Y., Zhu H., Liu J., Li Y., Kang P., et al. Effects of α-ketoglutarate on energy status in the intestinal mucosa of weaned piglets chronically challenged with lipopolysaccharide. Br. J. Nutr. 2011;106:357–363. doi: 10.1017/S0007114511000249. [DOI] [PubMed] [Google Scholar]
- 12.Wang L., Yi D., Hou Y., Ding B., Li K., Li B., Zhu H., Liu Y., Wu G. Dietary Supplementation with alpha-Ketoglutarate Activates mTOR Signaling and Enhances Energy Status in Skeletal Muscle of Lipopolysaccharide-Challenged Piglets. J. Nutr. 2016;146:1514–1520. doi: 10.3945/jn.116.236000. [DOI] [PubMed] [Google Scholar]
- 13.Wang L., Hou Y., Yi D., Li Y., Ding B., Zhu H., Liu J., Xiao H., Wu G. Dietary supplementation with glutamate precursor α-ketoglutarate attenuates lipopolysaccharide-induced liver injury in young pigs. Amino Acids. 2015;47:1309–1318. doi: 10.1007/s00726-015-1966-5. [DOI] [PubMed] [Google Scholar]
- 14.Yao K., Xiong X., Fu C., Dahanayaka S., Lei J., Lu W., Wu G., Liao P., Yin Y. Dietary alpha-ketoglutarate supplementation may increase muscle gain through mTOR signaling pathway in diet-induced obese rat. J. Food Agric. Environ. 2013;11:151–154. [Google Scholar]
- 15.Chen J., Kang B., Jiang Q., Han M., Zhao Y., Long L., Fu C., Yao K. Alpha-ketoglutarate in low-Protein diets for growing pigs: Effects on cecal microbial communities and parameters of microbial metabolism. Front. Microbiol. 2018;9:1057. doi: 10.3389/fmicb.2018.01057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chen J., Su W., Kang B., Jiang Q., Zhao Y., Fu C., Yao K. Supplementation with alpha-ketoglutarate to a low-protein diet enhances amino acid synthesis in tissues and improves protein metabolism in the skeletal muscle of growing pigs. Amino Acids. 2018;50:1525–1537. doi: 10.1007/s00726-018-2618-3. [DOI] [PubMed] [Google Scholar]
- 17.Tan B., Yin Y., Liu Z., Tang W., Xu H., Kong X., Li X., Yao K., Gu W., Smith S.B., et al. Dietary L-arginine supplementation differentially regulates expression of lipid-metabolic genes in porcine adipose tissue and skeletal muscle. J. Nutr. Biochem. 2011;22:441–445. doi: 10.1016/j.jnutbio.2010.03.012. [DOI] [PubMed] [Google Scholar]
- 18.National Research Council . Nutrient Requirements of Swine. 11th ed. National Academic Press; Washington, DC, USA: 2012. [Google Scholar]
- 19.Chen C., Chen J., Wang S., You C., Li Y. Effects of different dietary ratios of linolenic to linoleic acids or docosahexaenoic to eicosapentaenoic acids on the growth and immune indices in grouper, Epinephelus coioides. Aquaculture. 2017;473:153–160. doi: 10.1016/j.aquaculture.2017.02.010. [DOI] [Google Scholar]
- 20.Li Y.Y., Hu C.B., Zheng Y.J., Xia X.A., Xu W.J., Wang S.Q., Chen W.Z., Sun Z.W., Huang J.H. The effects of dietary fatty acids on liver fatty acid composition and Δ 6 -desaturase expression differ with ambient salinities in Siganus canaliculatus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2008;151:183–190. doi: 10.1016/j.cbpb.2008.06.013. [DOI] [PubMed] [Google Scholar]
- 21.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 22.Luo Y., Zhang X., Zhu Z., Jiao N., Qiu K., Yin J. Surplus dietary isoleucine intake enhanced monounsaturated fatty acid synthesis and fat accumulation in skeletal muscle of finishing pigs. J. Anim. Sci. Biotechnol. 2018;9:88. doi: 10.1186/s40104-018-0306-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Franco D., Vazquez J.A., Lorenzo J.M. Growth performance, carcass and meat quality of the Celta pig crossbred with Duroc and Landrance genotypes. Meat Sci. 2014;96:195–202. doi: 10.1016/j.meatsci.2013.06.024. [DOI] [PubMed] [Google Scholar]
- 24.Wood J., Enser M., Fisher A., Nute G., Sheard P., Richardson R.I., Hughes S., Whittington F. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci. 2008;78:343–358. doi: 10.1016/j.meatsci.2007.07.019. [DOI] [PubMed] [Google Scholar]
- 25.Cheng C., Liu Z., Zhou Y., Wei H., Zhang X., Xia M., Deng Z., Zou Y., Jiang S., Peng J. Effect of oregano essential oil supplementation to a reduced-protein, amino acid-supplemented diet on meat quality, fatty acid composition, and oxidative stability of Longissimus thoracis muscle in growing-finishing pigs. Meat Sci. 2017;133:103–109. doi: 10.1016/j.meatsci.2017.06.011. [DOI] [PubMed] [Google Scholar]
- 26.Wood J.D., Lambe N.R., Walling G.A., Whitney H., Jagger S., Fullarton P.J., Bayntun J., Hallett K., Bünger L. Effects of low protein diets on pigs with a lean genotype. 1. Carcass composition measured by dissection and muscle fatty acid composition. Meat Sci. 2013;95:123–128. doi: 10.1016/j.meatsci.2013.03.001. [DOI] [PubMed] [Google Scholar]
- 27.Duan Y., Duan Y., Li F., Li Y., Guo Q., Ji Y., Tan B., Li T., Yin Y. Effects of supplementation with branched-chain amino acids to low-protein diets on expression of genes related to lipid metabolism in skeletal muscle of growing pigs. Amino Acids. 2016;48:2131–2144. doi: 10.1007/s00726-016-2223-2. [DOI] [PubMed] [Google Scholar]
- 28.Doran O., Moule S.K., Teye G.A., Whittington F.M., Hallett K.G., Wood J.D. A reduced protein diet induces stearoyl-CoA desaturase protein expression in pig muscle but not in subcutaneous adipose tissue: Relationship with intramuscular lipid formation. Br. J. Nutr. 2006;95:609–617. doi: 10.1079/BJN20051526. [DOI] [PubMed] [Google Scholar]
- 29.Bie T., Yin Y., Liu Z., Li X., Xu H., Kong X., Huang R., Tang W., Shinzato I., Smith S.B. Dietaryl-arginine supplementation increases muscle gain and reduces body fat mass in growing-finishing pigs. Amino Acids. 2009;37:169–175. doi: 10.1007/s00726-008-0148-0. [DOI] [PubMed] [Google Scholar]
- 30.Cameron N.D., Enser M., Nute G.R., Whittington F.M., Penman J.C., Fisken A.C., Perry A.M., Wood J.D. Genotype with nutrition interaction on fatty acid composition of intramuscular fat and the relationship with flavour of pig meat. Meat Sci. 2000;55:187–195. doi: 10.1016/S0309-1740(99)00142-4. [DOI] [PubMed] [Google Scholar]
- 31.Realini C.E., Duran-Montge P., Lizardo R., Gispert M., Oliver M.A., Esteve-Garcia E. Effect of source of dietary fat on pig performance, carcass characteristics and carcass fat content, distribution and fatty acid composition. Meat Sci. 2010;85:606–612. doi: 10.1016/j.meatsci.2010.03.011. [DOI] [PubMed] [Google Scholar]
- 32.Hu F.B., Stampfer M.J., Manson J.E., Ascherio A., Colditz G.A., Speizer F.E., Hennekens C.H., Willett W.C. Dietary saturated fats and their food sources in relation to the risk of coronary heart disease in women. Am. J. Clin. Nutr. 1999;70:1001–1008. doi: 10.1093/ajcn/70.6.1001. [DOI] [PubMed] [Google Scholar]
- 33.Kristensen N.B., Jungvid H., Fernandez J.A., Pierzynowski S.G., Kristensen N.B., Jungvid H., Fernandez J.A., Pierzynowski S.G. Absorption and metabolism of α-etoglutarate in growing pigs. J. Anim. Physiol. Anim. Nutr. 2002;86:239–245. doi: 10.1046/j.1439-0396.2002.00380.x. [DOI] [PubMed] [Google Scholar]
- 34.Kimball S.R., Jefferson L.S. Signaling pathways and molecular mechanisms through which branched-chain amino acids mediate translational control of protein synthesis. J. Nutr. 2006;136:227–231. doi: 10.1093/jn/136.1.227S. [DOI] [PubMed] [Google Scholar]
- 35.Estany J., Ros-Freixedes R., Tor M., Pena R.N. A functional variant in the stearoyl-CoA desaturase gene promoter enhances fatty acid desaturation in pork. PLoS ONE. 2014;9:e86177. doi: 10.1371/journal.pone.0086177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ntambia J.M., Miyazakib M. Regulation of stearoyl-CoA desaturases and role in metabolism. Prog. Lipid. Res. 2004;43:91–104. doi: 10.1016/S0163-7827(03)00039-0. [DOI] [PubMed] [Google Scholar]
- 37.Sul H.S., Wang D. Nutritional and hormonal regulation of enzymes in fat synthesis: Studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu. Rev. Nutr. 1998;18:331–351. doi: 10.1146/annurev.nutr.18.1.331. [DOI] [PubMed] [Google Scholar]
- 38.Moldes M., Boizard M., Liepvre X.L., Fève B., Dugail I., Pairault J. Functional antagonism between inhibitor of DNA binding (Id) and adipocyte determination and differentiation factor 1/sterol regulatory element-binding protein-1c (ADD1/SREBP-1c) trans-factors for the regulation of fatty acid synthase promoter in adipocytes. Biochem. J. 1999;344:873–880. doi: 10.1042/bj3440873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Horton J.D., Goldstein J.L., Brown M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Investig. 2002;109:1125–1131. doi: 10.1172/JCI0215593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Munday M.R. Regulation of mammalian acetyl-CoA carboxylase. Biochem. Soc. Trans. 2002;30:1059–1064. doi: 10.1042/bst0301059. [DOI] [PubMed] [Google Scholar]
- 41.Holm C. Molecular mechanisms regulating hormone-sensitive lipase and lipolysis. Biochem. Soc. Trans. 2003;31:1120–1124. doi: 10.1042/bst0311120. [DOI] [PubMed] [Google Scholar]
- 42.Berraondo B., Martínez J.A. Free fatty acids are involved in the inverse relationship between hormone-sensitive lipase (HSL) activity and expression in adipose tissue after high-fat feeding or β 3-adrenergic stimulation. Obes. Res. 2012;8:255–261. doi: 10.1038/oby.2000.30. [DOI] [PubMed] [Google Scholar]
- 43.Hocquette J.F., Gondret F., Baéza E., Médale F., Jurie C., Pethick D.W. Intramuscular fat content in meat-producing animals: Development, genetic and nutritional control, and identification of putative markers. Animal. 2010;4:303–319. doi: 10.1017/S1751731109991091. [DOI] [PubMed] [Google Scholar]
- 44.Madeira M.S., Pires V.M.R., Alfaia C.M., Costa A.S.H., Luxton R., Doran O., Bessa R.J.B., Prates J.A.M. Differential effects of reduced protein diets on fatty acid composition and gene expression in muscle and subcutaneous adipose tissue of Alentejana purebred and Large White×Landrace×Pietrain crossbred pigs. Br. J. Nutr. 2013;110:216–229. doi: 10.1017/S0007114512004916. [DOI] [PubMed] [Google Scholar]


