Abstract
The objectives of the current study were to explore the effects of mannan oligosaccharide (MOS) supplementation in the diets of sow and (or) their offspring on intestinal bacteria, intestinal and systemic inflammation in the piglet. A total of 60 multiparous sows (4 ± 1 parity; Landrace × Yorkshire) were fed either control diet (sCON, n = 30) or a diet containing 400 mg kg−1 MOS (sMOS, n = 30) from day 86 of gestation until weaning (day 20 of postpartum). On day 7 of age, offspring (Duroc × Landrace Yorkshire) were assigned within sow treatments and fed control diet (pCON) or diet containing 800 mg kg−1 MOS (pMOS) for 28 d (end at 35 d of age), resulting in four piglet diet groups (n = 15 litters per diet group): sCON-pCON, sCON-pMOS, sMOS-pCON, and sMOS-pMOS. Results found that piglet diet MOS increased or tend to increase Lactobacillus amount in the ileum digesta (P < 0.01) and jejunum digesta (P = 0.07), respectively; while tend to decrease Escherichia coli amount in jejunum digesta (P =0.06) and cecum digesta (P = 0.08). Both sow and piglet diets add MOS (sMOS-pMOS) increased Lactobacillus amount but decreased E. coli amount in jejunum digesta (P < 0.05) compared with the sCON-pCON diet group. In addition, sow diet MOS (rather than piglet diet MOS) increased sIgA content in piglet jejunum mucosa compared with control (P = 0.04). Sow diet MOS decreased toll-like receptor 2 (TLR2), toll-like receptor 4 (TLR4), and interleukin 8 (IL-8) mRNA levels (P < 0.05) and tended to decrease nuclear factor-κB p65 (NF-κB p65) mRNA level (P = 0.07) in piglet intestinal lymphatic. The interaction effects between sow and piglet diets were found on the mRNA levels of NF- κB p65 (P = 0.03) and IL-8 (P = 0.02) in piglet jejunum. Finally, the sow diet MOS decreased proinflammatory cytokines IL-2 (P < 0.01) and IL-4 (P < 0.01) concentrations in piglet serum. Piglets diet MOS decreased the contents of IL-2 (P = 0.03), IL-4 (P = 0.01) and interferon (IFN)-γ (P < 0.01) while increased anti-inflammatory cytokine IL-10 (P < 0.01) content in serum. The interaction effects between sows and piglet diets on IL-4 (P = 0.02), IL-10 (P < 0.01), and IFN-γ (P = 0.08) were observed. In conclusion, sow and/or piglet diet MOS could improve intestinal microbiota, enhance intestinal mucosal immune competence, and suppress intestinal and systemic inflammation in the piglet.
Keywords: intestinal bacteria, immune, mannan oligosaccharide, piglet, sow
Introduction
Sow health is critical for the growth and health of their offspring piglets (Lu et al., 2019). Our previous study found that sow diet mannan oligosaccharide (MOS) supplementation was beneficial for colostrum quality, and promoted piglet growth performance and the systemic innate immunity in lactation and nursery piglets (Duan et al., 2016). It was well studied that MOS directly added in piglet diet could improve its’ growth and health by improving intestinal microbe and immunity (Castillo et al., 2008; Che et al., 2011; Che et al., 2012a). However, little is known about the effects of MOS supplementation in sow and their offspring diets on intestinal microbe and the intestinal local immunity in the piglets.
The microflora composition is complex in the animal intestine and mainly divided into pathogenic microorganisms (such as Escherichia coli [E. coli]) and beneficial microorganisms (such as Lactobacillus) by function (Halas and Nochta, 2012; Patil, et al., 2015). Most pathogenic microorganisms are type 1 fimbriae (mannose-specific lectin) bacteria, which can bind to the mannose-rich intestine epithelial surface, and thus play a harmful role for intestinal health (Baumler et al., 1997; Finuance et al., 1999). MOS, derived from Saccharomyces cerevisiae cell wall, can serve as a decoy to bind with type 1 fimbriae bacteria and thus prevent their adherence, colonization, and infection in the animal intestine (Halas and Nochta, 2012; Spring et al., 2015). Furthermore, intestinal microbe also influenced intestinal immunity. For example, Gram-positive or -negative bacteria cell walls peptidoglycan or lipopolysaccharide can be recognized by pattern recognition receptors, toll-like receptors (TLRs), which can initiate the inflammation mediated by nuclear factor-κB p65 (NF-κB p65) pathway (Takeda and Akira, 2004). Che et al. (2012a) found that piglet diet MOS could alleviate inflammation and speculated that the possible mechanism might be associated with TLRs-mediated inflammation pathway. Moreover, the local intestinal immune could further trigger the systemic immune response in animals (Halas and Nochta, 2012). Thus, there may be a tight relationship among MOS, intestinal microbe and intestinal inflammation, which needs a further systematic study.
Therefore, the objectives of the present study were to explore the effects of MOS supplementation in sows and (or) their offspring diets on intestinal bacteria, intestinal and systemic inflammation in piglet by detecting the amount of pathogenic microorganism (E. coli) and beneficial microorganism (Lactobacillus) in different intestinal segments, TLRs/NF-κB p65-mediated inflammation pathway in intestinal lymphatic and jejunum, and inflammation cytokine contents in piglet serum. The current study results would further support our previous study that sow and/or their offspring diets MOS supplementation could improve piglet growth and immunity.
Materials and Methods
Animals and Experimental Diets
All animal experimental procedures in the present study were approved by the Animal Care and Use Committee of Sichuan Agricultural University.
The experimental design, diets ingredients, and animal management were all identical to our previous study (Duan et al., 2016). Sixty sows (4 ± 1 parity, Large White × Yorkshire) were randomly assigned to two diet groups (n = 30 sows per treatment) and fed with control diet (sCON) or supplementation with 400 mg kg−1 mannan oligosaccharide diet (sMOS) from the 86th day of gestation until the ending of lactation (day 20 post-farrowing). The control diet (Table 1) was formulated according to the nutrient requirements of lactating sows (NRC, 1998), and MOS was incorporated in the sMOS diet by corn substitution. From day 86 to day 107 of gestation, the sows were housed individually in pregnancy crates (2.0 × 0.6 m), and 3.0 kg of feed was provided daily. From day 108 of gestation until to day 20 post-farrowing, sows were transferred to farrowing crates (2.13 × 0.66 m). From day 108 to day 111 of gestation, the diet was provided for ad libitum consumption. Around farrowing, all sows received 2.0 kg of feed daily, which was followed by 2.0–3.0 kg of feed on days 2–3 post-farrowing. Thereafter, this amount was increased daily by 1.0 kg until ad libitum feeding. Sows had ad libitum access to water during the whole experimental period.
Table 1.
Composition and nutrients levels of sow basal diet (as-fed basis)
| Ingredient | Amount, % |
|---|---|
| Corn | 59.50 |
| Soybean meal (48.5% CP) | 22.50 |
| Wheat bran | 10.00 |
| Oil powder | 2.00 |
| Fish meal | 2.00 |
| Dicalcium phosphate | 1.75 |
| Calcium carbonate | 1.00 |
| Salt | 0.40 |
| Choline chloride | 0.15 |
| L-Lysine·HCl | 0.20 |
| Mineral and vitamin premix1 | 0.50 |
| Total | 100.00 |
| Nutrients composition2 | |
| Digestible energy, MJ kg-1 | 13.58 |
| Crude protein, % | 16.85 |
| Ash, % | 6.12 |
| Calcium, % | 1.11 |
| Total phosphorus, % | 0.73 |
| Available phosphorus, % | 0.49 |
| Total lysine, % | 0.91 |
1Premix provided per kilogram of diet: 100 mg of Zn from zinc sulfate, 30 mg of Mn from manganese sulfate, 90 mg of Fe from ferrous sulfate, 5.4 mg of Cu from copper sulfate, 0.30 mg of Se from sodium selenite, and 0.25 mg of I from potassium iodide; 10,000 IU of vitamin A, 2,000 IU of vitamin D3, 44 IU of vitamin E, 14.50 mg of niacin, 13.00 mg of pantothenic acid, 6.00 mg of riboflavin, 2.50 mg of vitamin K, 25 µg of vitamin B12, 1.80 mg of pyridoxine, 1.70 mg of folic acid, 1.00 mg of thiamine, and 0.20 mg of biotin.
2The contents of crude protein, ash, calcium, and total phosphorus were measured values, the contents of digestible energy, available phosphorus and lysine were calculated values.
On day 7 of age, offspring (DLY, Duroc × Landrace Yorkshire) were assigned within sow treatments to either the piglet control diet (pCON) or piglet control diet supplemented with 800 mg kg-1 MOS (pMOS) for 28 d (end at day 35 of age). Thus, there were four piglet treatment groups (n = 15 litters per group): sCON-pCON, sCON-pMOS, sMOS-pCON, and sMOS-pMOS. The piglet control diet (Table 2) was formulated to meet or exceed nutrient requirements of piglets with an average body weight of 3–5 kg and 5–10 kg (NRC, 1998), and MOS was incorporated in the pMOS diet via corn substitution. Piglets, weaned at day 20 of age, were fed the same experimental diets pre- and post-weaning according to the experiment design and had ad libitum access to feed and water. From day 7 to day 19 of age, piglets were fed the experimental diets as extra nutrition beyond sow milk, while the experimental diets as their sole nutrition source from day 20 to day 35 of age. All piglets were kept in their own original pens (farrowing crates) before and after weaning. In the present study, the MOS (Actigen) was provided by Alltech, Inc. (Nicholasville, KY), and the MOS supplementation contents were determined according to the previous study (Che et al., 2012b) and the company’s recommendation.
Table 2.
Composition and nutrients levels of piglet basal diet (as-fed basis)
| Ingredient | Amount, % |
|---|---|
| Extruded corn | 25.50 |
| Select wheat flour | 24.50 |
| Spray-dried plasma protein | 5.00 |
| Extruded soybean meal | 18.50 |
| White fish meal | 7.00 |
| Soybean oil | 3.50 |
| Sucrose | 2.50 |
| Whey powder | 5.00 |
| Lactose | 5.00 |
| Limestone | 0.80 |
| Calcium hydrogen phosphate | 0.70 |
| Mineral and vitamin premix1 | 1.00 |
| Antibiotic2 | 1.00 |
| Total | 100.00 |
| Nutrients composition3 | |
| Digestible energy, MJ kg-1 | 14.28 |
| Crude protein, % | 20.97 |
| Ash, % | 4.67 |
| Calcium, % | 0.88 |
| Total phosphorus, % | 0.64 |
| Available phosphorus, % | 0.48 |
| Total lysine, % | 1.41 |
1Premix provided per kilogram of diet: 0.35 mg of Se from sodium selenite, 28 mg of Mn from manganese sulfate, 145 mg of Zn from zinc oxide, 175 mg of Fe from ferrous sulfate,100 mg of Cu from copper sulfate, and 0.28 mg of I from calcium iodide; 11,000 IU of vitamin A, 800 IU of vitamin D3, 44 IU of vitamin E, 2.4 mg of vitamin K, 33 mg of pantothenic acid, 55 mg of niacin, 10 mg of riboflavin, and 44 µg of vitamin B12.
2Provided 0.11 g of oxytetracycline and 0.15 g of neomycin as neomycin sulfate per kilogram of diet.
3The contents of crude protein, ash, calcium, and total phosphorus were measured values, the contents of digestible energy, available phosphorus and lysine were calculated values.
Sample Collection
The blood sample was obtained as described by our previous study (Duan et al., 2016). Briefly, the blood samples were obtained from six piglets per piglet group (one piglet per litter) by anterior vena cava puncture on day 35 of age. The blood sample was centrifuged at 1,500 × g for 10 min, and then the serum was collected and stored in −20 °C until analysis. On day 35 of age, six piglets at average body weight from six litters (one piglet per litter) were killed by a lethal injection of sodium pentobarbital. The abdomen was immediately opened, about 5 g digesta samples from the middle section of jejunum, ileum, cecum, and colon were collected and kept in sterile tubes and immediately frozen at −80 °C for microbial amount analysis. The jejunum-related intestinal mesenteric lymph and the middle section of jejunum tissue were collected and immediately frozen at −80 °C for real-time quantitative polymerase chain reaction (PCR) analysis. Another middle section (about 6 cm) of jejunum was cut lengthwise, washed away the remained chyme with phosphate-buffered saline, the mucosa was removed by gently scraping and stored at −80 °C until analysis.
Microbial Amount Analysis
The Lactobacillus, E. coli, and total bacteria amount in jejunum, ileum, cecum, and colon digesta were analyzed by quantitative PCR as described by our laboratory previous studies (Han et al., 2012; Chen et al., 2013). Briefly, bacterial DNA was extracted from digesta using Stool DNA Kit (Omega Bio-tek, Doraville, United States) according to the manufacturer’s instruction. For PCR, the information of the primer and probe were presented in Table 3. Real-time quantitative PCR was carried out on a CFX-96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.) using optical grade 96-well plates. For detecting total bacteria, the reaction volume was 25 μL including 12.5 μL SYBR Premix Ex Taq (2×Conc.), 9.5 μL ddH2O, 1 μL each of forward and reverse primers (100 nM) and 1 μL DNA. For detecting Lactobacillus and E. coli, the reaction volume was 20 μL with 8 μL real-MasterMix (2.5 ×Conc.), 1 μL of forward and 1 μL of reverse primers (100 nM), 1 μL probe enhancer solution (20 ×Conc.), 0.3 μL probe (100 nM), 1 μL DNA and 7.7 μL ddH2O. The number of Lactobacillus, E. coli, and total bacteria in digesta samples were calculated by the standard curve method as our laboratory previous studies (Han et al., 2012; Chen et al., 2013).
Table 3.
Primers and probes sequences were used for Lactobacillus, Escherichia coli and total bacteria analysis
| Primers | Nucleotide sequence, 5'-3' | Annealing temperature, °C | Product size, bp |
|---|---|---|---|
| Total bacteria | 60 | 200 | |
| Forward | ACTCCTACGGGAGGCAGCAG | ||
| Reverse | ATTACCGCGGCTGCTGG | ||
| Lactobacillus | 60 | 126 | |
| Forward | GAGGCAGCAGTAGGGAATCTTC | ||
| Reverse | CAACAGTTACTCTGACACCCGTTCTTC | ||
| Probe | AAGAAGGGTTTCGGCTCGTAAAACTCTGTT | ||
| Escherichia coli | 60 | 96 | |
| Forward | CATGCCGCGTGTATGAAGAA | ||
| Reverse | CGGGTAACGTCAATGAGCAAA | ||
| Probe | AGGTATTAACTTTACTCCCTTCCTC |
Cytokines and Secretory Immunoglobulin A Contents Analyses
The concentration of interleukin (IL) -2, IL-4, IL-10, tumor necrosis factor (TNF)-α, interferon (IFN)-γ in piglet serum and the content of secretory immunoglobulin A (sIgA) in jejunal mucosa at day 35 of age were detected by porcine enzyme-linked ELISA kit (R&D Systems China Company Limited) according to the manufacture’s protocol. All assays were performed in 96-well plates and absorbance was measured at 450 nm by using an enzyme-labeled meter (Thermo Electron Corporation, Varioskan, Waltham, MA). The total protein content was measured by Coomassie brilliant blue (Nanjing Jiancheng, China) to normalize sIgA content.
mRNA Relative Expression Level Analysis
The mRNA relative expression level of toll-like receptor 2 (TLR2), toll-like receptor 4 (TLR4), interleukin 8 (IL-8), nuclear factor-κB p65 (NF-κB p65) and peroxisome proliferator-activated receptor gamma (PPAR-γ) in the intestinal mesenteric lymph and jejunum were analyzed by real-time quantitative PCR as described by Chen et al. (2012). Briefly, the total RNA extraction and cDNA performance in the intestinal mesenteric lymph and jejunum using Trizol Reagent (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The SYBR Premix Ex TaqII reagents (TaKaRa, Dalian, China) were used to Gene mRNA level analysis by quantitative real-time PCR on a CFX-96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). Target gene mRNA relative expression levels were calculated using the 2–ΔΔCT method and corrected for the expression of the housekeeping gene β-actin. The specific primers of analysis gene were presented in Table 4.
Table 4.
Primer sequences were used for real-time PCR1
| Gene | Primer sequences, 5′–3′ | Product size, bp | Annealing temperature, °C | GenBank accession no. |
|---|---|---|---|---|
| TLR2 | Forward: AGTTGAAGACGCTCCCAGATG | 170 | 62.5 | AB 085935.1 |
| Reverse: GAAGGACAGGAAGTCACAGGA | ||||
| TLR4 | Forward: TCAGTTCTCACCTTCCTCCTG | 166 | 59.5 | GQ 503242.1 |
| Reverse: GTTCATTCCTCACCCAGTCTTC | ||||
| NF-κB p65 | Forward: TACGACCTGAATGCTGTGCG | 130 | 60.0 | NM 001114281 |
| Reverse: TGAGCTCTGCAGTGTTGGG | ||||
| PPAR-γ | Forward: ATCCCATTCCCGAGAGCTGA | 170 | 59.8 | NM 214379 |
| Reverse: ATTGCCATGAGGGAGTTGGA | ||||
| IL-8 | Forward: TGAGAGTGATTGAGAGTGGA | 155 | 58.8 | NM 213867 |
| Reverse: CTGCTGTTGTTGTTGCTTCTC | ||||
| β-actin | Forward: TCTGGCACCACACCTTCT | 114 | 56.0 | DQ 178122 |
| Reverse: TGATCTGGGTCATCTTCTCAC |
1TLR = toll-like receptor; IL = interleukin; NF-κB p65 = nuclear factor-κB p65; PPAR-γ = peroxisome proliferator-activated receptor gamma.
Statistical Analysis
Data were analyzed as a randomized complete block design as a 2 × 2 factorial treatment arrangement by ANOVA using the GLM procedure of SAS (release 9.0; SAS Institute). The statistical model included the effects of sow diet treatment (sCON or sMOS), piglet diet treatment (pCON or pMOS), and their interactions. Individual piglet was used as the experimental unit. Treatment differences were compared using the least-squares means with a Tukey adjustment. The P ≤ 0.05 was considered significant, and 0.05 < P ≤ 0.1 was considered a trend.
Results
As showed in Table 5, piglet diet MOS increased or tended to increase Lactobacillus amount in the ileum digesta (P < 0.01) and jejunum digesta (P = 0.07), respectively; tended to decrease the E. coli amount in jejunum digesta (P = 0.06) and cecum digesta (P = 0.08). Both sow and piglet diets add MOS (sMOS-pMOS) increased Lactobacillus amount but decreased E. coli amount in jejunum digesta (P < 0.05) compared with the sCON-pCON treatment group. For the bacteria amount, there was no other significant difference was found in sow diet MOS, piglet diet MOS or their interaction in these four intestinal segments digesta (P > 0.1).
Table 5.
Effect of dietary supplementation of mannan oligosaccharide to sow or piglet on copy numbers of Lactobacillus, E. coli and total bacteria in chyme of jejunum, ileum, cecum and colon (mean ± SD)1
| Dietary treatment2 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sow diets | Piglet diets | Piglet treatments | P-value3 | ||||||||
| Item4 | sCON | sMOS | pCON | pMOS | sCON-pCON | sCON-pMOS | sMOS-pCON | sMOS-pMOS | S | P | S×P |
| No. | 12 | 12 | 12 | 12 | 6 | 6 | 6 | 6 | |||
| Lactobacillus | |||||||||||
| Jejunum | 8.01 ± 0.86 | 8.11 ± 0.91 | 7.73 ± 0.84 | 8.41 ± 0.77 | 7.63 ± 0.94a | 8.38 ± 0.63 | 7.83 ± 0.80 | 8.44 ± 0.99b | 0.73 | 0.07 | 0.84 |
| Ileum | 7.08 ± 0.89 | 7.21 ± 1.23 | 6.44 ± 0.93a | 7.86 ± 0.57b | 6.46 ± 0.87 | 7.71 ± 0.24 | 6.43 ± 1.01 | 8.01 ± 0.77 | 0.73 | <0.01 | 0.63 |
| Cecum | 8.22 ± 0.88 | 8.68 ± 0.45 | 8.21 ± 0.86 | 8.69 ± 0.48 | 7.82 ± 1.04b | 8.62 ± 0.50 | 8.60 ± 0.44 | 8.76 ± 0.50 a | 0.14 | 0.12 | 0.30 |
| Colon | 9.42 ± 0.54 | 9.44 ± 0.31 | 9.39 ± 0.31 | 9.45 ± 0.54 | 9.40 ± 0.42 | 9.43 ± 0.66 | 9.39 ± 0.20 | 9.48 ± 0.41 | 0.91 | 0.76 | 0.90 |
| E. coli | |||||||||||
| Jejunum | 6.67 ± 0.38 | 6.52 ± 0.21 | 6.72 ± 0.35 | 6.47 ± 0.21 | 6.83 ± 0.45a | 6.52 ± 0.25 | 6.62 ± 0.23 | 6.43 ± 0.18b | 0.27 | 0.06 | 0.63 |
| Ileum | 6.32 ± 0.61 | 6.42 ± 0.66 | 6.57 ± 0.61 | 6.14 ± 0.60 | 6.45 ± 0.54 | 6.17 ± 0.73 | 6.72 ± 0.72 | 6.12 ± 0.48 | 0.68 | 0.12 | 0.55 |
| Cecum | 7.08 ± 0.68 | 7.00 ± 0.79 | 7.32 ± 0.60 | 6.74 ± 0.75 | 7.48 ± 0.57a | 6.61 ± 0.48b | 7.13 ± 0.63 | 6.84 ± 0.99 | 0.88 | 0.08 | 0.47 |
| Colon | 7.05 ± 0.63 | 7.05 ± 0.66 | 7.09 ± 0.57 | 7.01 ± 0.71 | 7.18 ± 0.42 | 6.92 ± 0.82 | 7.01 ± 0.74 | 7.09 ± 0.66 | 0.98 | 0.78 | 0.58 |
| Total bacteria | |||||||||||
| Jejunum | 9.16 ± 0.37 | 9.43 ± 0.46 | 9.34 ± 0.45 | 9.23 ± 0.42 | 9.11 ± 0.27 | 9.20 ± 0.46 | 9.57 ± 0.48 | 9.26 ± 0.40 | 0.15 | 0.54 | 0.25 |
| Ileum | 9.78 ± 0.56 | 9.71 ± 0.79 | 9.75 ± 0.70 | 9.74 ± 0.67 | 9.83 ± 0.65 | 9.73 ± 0.50 | 9.67 ± 0.81 | 9.75 ± 0.85 | 0.82 | 0.98 | 0.77 |
| Cecum | 11.19 ± 0.28 | 11.02 ± 0.44 | 11.01 ± 0.37 | 11.21 ± 0.36 | 11.12 ± 0.18 | 11.26 ± 0.36 | 10.88 ± 0.49 | 11.15 ± 0.39 | 0.31 | 0.25 | 0.71 |
| Colon | 13.61 ± 0.17 | 13.51 ± 0.19 | 13.62 ± 0.21 | 13.50 ± 0.14 | 13.70 ± 0.10 | 13.52 ± 0.18 | 13.53 ± 0.28 | 13.49 ± 0.10 | 0.19 | 0.14 | 0.36 |
1Sows were fed mannan oligosaccharide (MOS, Actigen, Alltech, Inc., Nicholasville, KY) from the 86th day of gestation until the end of lactation (day 20 post-farrowing), and piglets were fed it from day 7 to day 35 of age.
2Dietary treatments: sCON = sows fed control diet; sMOS = sows fed diet supplementation with 400 mg kg−1 MOS; pCON = piglets fed control diet; pMOS = piglets fed diet supplementation with 800 mg kg−1 MOS; sCON-pCON = sows fed control diet and piglets fed control diet; sCON-pMOS = sows fed control diet and piglets fed diet supplementation with 800 mg kg−1 MOS; sMOS-pCON = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed control diet; sMOS-pMOS = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed diet supplementation with 800 mg kg−1 MOS.
3S, sow dietary treatment; P, piglet dietary treatment; and S × P, the interaction effect of the sow and piglet dietary treatments.
4No., number of piglets; log10 counts of Lactobacillus, E. coli and total bacteria.
a,bMeans in the same row with different superscripts differ (P < 0.05) between the same dietary treatment.
The data for mRNA relative expression levels of TLR2, TLR4, NF- κB p65, PPAR-γ, and IL-8 in intestinal lymphatic and jejunum were shown in Table 6. Sow diet MOS increased NF-κB p65 mRNA level in jejunum (P = 0.02); decreased TLR2, TLR4 and IL-8 mRNA levels (P < 0.05) and tended to decrease NF-κB p65 mRNA level in intestinal lymphatic (P = 0.07). However, piglet diet MOS did not significantly change these genes expression levels in the two tissues (P > 0.1). The interaction effect between sow and piglet diets were found on the mRNA levels of NF- κB p65 (P = 0.03) and IL-8 (P = 0.02) in the jejunum, of which piglet diet MOS increased NF- κB p65 mRNA level (P < 0.05) based on sow control diet (sCON) rather than sow MOS diet (sMOS); whereas, piglet diet MOS increased IL-8 mRNA level (P < 0.05) based on sow control diet (sCON) but decreased IL-8 mRNA level (P < 0.05) based on sow MOS diet (sMOS). Sow diet MOS also increased sIgA content in piglet jejunum mucosa compared with control (P = 0.04, Table 7).
Table 6.
Effect of dietary supplementation of mannan oligosaccharide to sow or piglet on mRNA relative expression level of TLR signaling pathway-related genes in the jejunum and intestinal lymphatic (mean ± SD)1
| Dietary treatment2 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sow diets | Piglet diets | Piglet treatments | P-value3 | ||||||||
| Item4 | sCON | sMOS | pCON | pMOS | sCON-pCON | sCON-pMOS | sMOS-pCON | sMOS-pMOS | S | P | S×P |
| No. | 12 | 12 | 12 | 12 | 6 | 6 | 6 | 6 | |||
| Jejunum | |||||||||||
| TLR2 | 1.00 ± 0.20 | 1.08 ± 0.31 | 1.00 ± 0.24 | 0.88 ± 0.24 | 1.00 ± 0.20 | 0.97 ± 0.23 | 1.17 ± 0.29 | 0.95 ± 0.31 | 0.78 | 0.63 | 0.70 |
| TLR4 | 1.00 ± 0.27 | 0.86 ± 0.19 | 1.00 ± 0.25 | 0.86 ± 0.21 | 1.00 ± 0.30 | 0.87 ± 0.20 | 0.87 ± 0.16 | 0.75 ± 0.18 | 0.57 | 0.58 | 0.98 |
| IL-8 | 1.00 ± 0.41 | 0.99 ± 0.21 | 1.00 ± 0.27 | 1.05 ± 0.41 | 1.00 ± 0.32a | 1.51 ± 0.6b | 1.39 ± 0.17b | 1.01 ± 0.19a | 0.76 | 0.71 | 0.02 |
| NF-κB p65 | 1.00 ± 0.19a | 1.18 ± 0.13b | 1.00 ± 0.21 | 1.09 ± 0.10 | 1.00 ± 0.17a | 1.30 ± 0.16b | 1.37 ± 0.18b | 1.31 ± 0.10b | 0.02 | 0.12 | 0.03 |
| PPAR-γ | 1.00 ± 0.21 | 0.86 ± 0.15 | 1.00 ± 0.23 | 1.01 ± 0.17 | 1.00 ± 0.21 | 0.86 ± 0.17 | 0.76 ± 0.12 | 0.88 ± 0.15 | 0.20 | 0.93 | 0.15 |
| Intestinal lymphatic | |||||||||||
| TLR2 | 1.00 ± 0.19a | 0.77 ± 0.23b | 1.00 ± 0.20 | 0.95 ± 0.32 | 1.00 ± 0.07 | 1.06 ± 0.28 | 0.87 ± 0.25 | 0.71 ± 0.20 | 0.04 | 0.75 | 0.49 |
| TLR4 | 1.00 ± 0.26a | 0.74 ± 0.16b | 1.00 ± 0.16 | 1.14 ± 0.40 | 1.00 ± 0.18 | 1.42 ± 0.27 | 0.97 ± 0.14 | 0.82 ± 0.23 | 0.02 | 0.49 | 0.16 |
| IL-8 | 1.00 ± 0.15a | 0.46 ± 0.12b | 1.00 ± 0.57 | 1.07 ± 0.35 | 1.00 ± 0.16 | 0.84 ± 0.10 | 0.36 ± 0.09 | 0.46 ± 0.10 | < 0.01 | 0.78 | 0.13 |
| NF-κB p65 | 1.00 ± 0.14 | 0.88 ± 0.14 | 1.00 ± 0.10 | 0.97 ± 0.14 | 1.00 ± 0.1 | 0.96 ± 0.10 | 0.87 ± 0.14 | 0.86 ± 0.15 | 0.07 | 0.66 | 0.86 |
| PPAR-γ | 1.00 ± 0.35 | 1.10 ± 0.27 | 1.00 ± 0.39 | 1.21 ± 0.26 | 1.00 ± 0.13 | 1.87 ± 0.39 | 1.78 ± 0.53 | 1.63 ± 0.36 | 0.39 | 0.25 | 0.12 |
1Sows were fed mannan oligosaccharide (MOS, Actigen, Alltech, Inc., Nicholasville, KY) from the 86th day of gestation until the end of lactation (d 20 post-farrowing), and piglets were fed it from day 7 to day 35 of age.
2Dietary treatments: sCON = sows fed control diet; sMOS = sows fed diet supplementation with 400 mg kg−1 MOS; pCON = piglets fed control diet; pMOS = piglets fed diet supplementation with 800 mg kg−1 MOS; sCON-pCON = sows fed control diet and piglets fed control diet; sCON-pMOS = sows fed control diet and piglets fed diet supplementation with 800 mg kg−1 MOS; sMOS-pCON = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed control diet; sMOS-pMOS = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed diet supplementation with 800 mg kg−1 MOS.
3S, sow dietary treatment; P, piglet dietary treatment; and S×P, the interaction effect of the sow and piglet dietary treatments.
4No., number of piglets; TLR, toll-like receptor; IL, interleukin; NF-κB p65, nuclear factor-κB p65; PPAR-γ, peroxisome proliferator-activated receptor gamma.
a,b Means in the same row with different superscripts differ (P < 0.05) between the same dietary treatment.
Table 7.
Effect of dietary supplementation of mannan oligosaccharide to sow or piglet on secretory immunoglobulin A (sIgA) in piglet jejunum mucosa (mean ± SD)1
| Dietary treatment2 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sow diets | Piglet diets | Piglet treatments | P-value3 | ||||||||
| Item4 | sCON | sMOS | pCON | pMOS | sCON-pCON | sCON-pMOS | sMOS-pCON | sMOS-pMOS | S | P | S×P |
| No. | 12 | 12 | 12 | 12 | 6 | 6 | 6 | 6 | |||
| sIgA, mg/g pro. | 4.97 ± 0.74a | 6.87 ± 1.12b | 5.61 ± 1.44 | 6.16 ± 1.23 | 4.48 ± 0.50 | 5.56 ± 0.52 | 6.98 ± 0.76 | 6.77 ± 1.49 | 0.04 | 0.61 | 0.45 |
1Sows were fed mannan oligosaccharide (MOS, Actigen, Alltech, Inc., Nicholasville, KY) from the 86th day of gestation until the end of lactation (d 20 post-farrowing), and piglets were fed it from day 7 to day 35 of age.
2Dietary treatments: sCON = sows fed control diet; sMOS = sows fed diet supplementation with 400 mg kg−1 MOS; pCON = piglets fed control diet; pMOS = piglets fed diet supplementation with 800 mg kg−1 MOS; sCON-pCON = sows fed control diet and piglets fed control diet; sCON-pMOS = sows fed control diet and piglets fed diet supplementation with 800 mg kg−1 MOS; sMOS-pCON = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed control diet; sMOS-pMOS = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed diet supplementation with 800 mg kg−1 MOS.
3S, sow dietary treatment; P, piglet dietary treatment; and S×P, the interaction effect of the sow and piglet dietary treatments.
4No., number of piglets; sIgA, mg/g pro., secretory immunoglobulin A concentration (mg/g protein) in piglet jejunum mucosa on day 35 of age.
a,bMeans in the same row with different superscripts differ (P < 0.05) between the same dietary treatment.
The concentrations of cytokines in piglet serum were shown in Table 8. The sow diet MOS decreased IL-2 (P < 0.01) and IL-4 (P < 0.01) concentrations in piglet serum rather than IL-10, TNF-α or IFN-γ (P > 0.1). Piglets diet MOS decreased the contents of IL-2 (P = 0.03), IL-4 (P = 0.01) and IFN-γ (P < 0.01) while increased IL-10 (P < 0.01) content in piglet serum. The interaction effects between sows and piglet diets on IL-4 (P = 0.02), IL-10 (P < 0.01), and IFN-γ (P = 0.08) were observed, of which both sow and piglet diets add MOS (sMOS-pMOS) decreased IL-4 and IFN-γ (P < 0.05) contents compared with control group (sCON-pCON) but reversely increased Il-10 content (P < 0.05).
Table 8.
Effect of dietary supplementation of mannan oligosaccharide to sow or piglet on IL-2, IL-4, IL-10, TNF-α, and IFN-γ contents in piglet serum on day 35 of ages (mean ± SD)1
| Dietary treatment2 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sow diets | Piglet diets | Piglet treatments | P-value3 | ||||||||
| Item4 | sCON | sMOS | pCON | pMOS | sCON-pCON | sCON-pMOS | sMOS-pCON | sMOS-pMOS | S | P | S×P |
| No. | 12 | 12 | 12 | 12 | 6 | 6 | 6 | 6 | |||
| IL-2, ng/L | 139.24 ± 10.54a | 110.32 ± 11.31b | 129.49 ± 16.13a | 120.96 ± 11.93b | 146.58 ± 6.58a | 131.90 ± 8.46b | 112.40 ± 14.70c | 107.83 ± 5.96c | < 0.01 | 0.03 | 0.23 |
| IL-4, ng/L | 16.44 ± 3.05a | 12.21 ± 1.31b | 15.54 ± 3.43a | 12.85 ± 2.10b | 18.21 ± 1.80a | 13.80 ± 2.65bc | 12.33 ± 1.36c | 12.09 ± 1.40c | < 0.01 | 0.01 | 0.02 |
| IL-10, ng/L | 66.15 ± 2.91 | 67.95 ± 8.58 | 63.65 ± 4.17a | 70.73 ± 5.98b | 65.82 ± 4.00a | 66.49 ± 1.69a | 61.48 ± 3.37a | 76.04 ± 4.90b | 0.14 | < 0.01 | < 0.01 |
| TNF-α, ng/L | 117.28 ± 15.11 | 114.02 ± 12.47 | 119.22 ± 13.48 | 111.89 ± 13.49 | 118.11 ± 16.14 | 116.29 ± 15.57 | 120.55 ± 11.15 | 107.50 ± 10.90 | 0.61 | 0.24 | 0.37 |
| IFN-γ, ng/L | 491.77 ± 64.88 | 473.05 ± 26.75 | 516.40 ± 39.90a | 442.11 ± 17.65b | 535.58 ± 51.24a | 437.00 ± 22.91cd | 497.22 ± 6.03b | 448.88 ± 10.64c | 0.33 | < 0.01 | 0.08 |
1Sows were fed mannan oligosaccharide (MOS, Actigen, Alltech, Inc., Nicholasville, KY) from the 86th day of gestation until the end of lactation (day 20 post-farrowing), and piglets were fed it from day 7 to day 35 of age.
2Dietary treatments: sCON = sows fed control diet; sMOS = sows fed diet supplementation with 400 mg kg−1 MOS; pCON = piglets fed control diet; pMOS = piglets fed diet supplementation with 800 mg kg−1 MOS; sCON-pCON = sows fed control diet and piglets fed control diet; sCON-pMOS = sows fed control diet and piglets fed diet supplementation with 800 mg kg−1 MOS; sMOS-pCON = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed control diet; sMOS-pMOS = sows fed diet supplementation with 400 mg kg−1 MOS and piglets fed diet supplementation with 800 mg kg−1 MOS.
3S, sow dietary treatment; P, piglet dietary treatment; and S×P, the interaction effect of the sow and piglet dietary treatments.
4No., number of piglets; IL, interleukin, TNF-α, tumor necrosis factor alfa, IFN-γ, interferon gamma.
a,bMeans in the same row with different superscripts differ (P < 0.05) between the same dietary treatment.
Discussion
MOS, derived from Saccharomyces cerevisiae cell wall, has been considered a prebiotic to promote animal growth by preventing pathogens attachment and promoting intestinal health (Spring et al., 2015). Our previous study found that sow diet and (or) their offspring diet supplementation MOS could improve piglet growth performance and body immune (Duan et al., 2016). However, the effects of sow and (or) piglet diet MOS on intestinal microorganism and immunity are largely unclear. Thus, the current study next investigated these aspects.
In the animal intestine, most pathogenic microorganisms, such as E. coli and Salmonella species, possess type 1 fimbriae (mannose-specific lectin) which can bind to the mannose-rich epithelial surface of the intestine (Baumler et al., 1997; Finuance et al., 1999). Previous studies indicated that the mechanism of MOS prevention pathogens attachment in the animal intestine is that MOS can serve as a decoy to bind with type 1 fimbriae bacterial pathogens (Firon et al., 1983; Spring et al., 2015). Meanwhile, among the complex intestinal microflora composition, pathogenic microorganisms always competed with beneficial bacteria, such as Lactobacillus and Bifidobacterium (Halas and Nochta, 2012; Patil, et al., 2015). In the present study, piglet diet MOS increased or tended to increase the beneficial bacteria Lactobacillus amount in the ileum and jejunum digesta; tended to decrease the pernicious microorganism E. coli amount in the jejunum and cecum digesta. These results were partly similar with previous studies in pigs, which indicated that dietary MOS supplementation increased Lactobacilli and (or) decreased enterobacteria numbers (Rekiel et al., 2007; Castillo et al., 2008). The above information indicated that MOS supplementation in piglet diet was beneficial to regulate intestinal bacteria. Interestingly, the present study found that piglet diet MOS showed a stronger effect in regulating microbe in the small intestine (jejunum and ileum) than in the hind intestine (cecum and colon). This phenomenon was partly consistent with the finding of Poeikhampha and Bunchasak (2011) who demonstrated that nursery pig diet MOS supplementation did not affect the population of lactic acid bacteria and E. coli amount in the cecum or rectum. This phenomenon might be partly associated with the steady-state of microflora. Halas and Nochta (2012) reviewed that diet MOS could reduce harmful bacteria in the hind intestine when the harmful bacteria amount is high, such as in post-infection. Additionally, in the present study, sow diet MOS did not change the intestinal microbe amount, while both sow and piglet diets added MOS (sMOS-pMOS) increased Lactobacillus amount and decreased E. coli amount in jejunum digesta compared with sCON-pCON treatment group. This data suggested that MOS add in sow diet alone cannot affect their offspring intestinal microbe, while played an assist function when their offspring diet also added with MOS.
In the host, the microbiota can modulate the local intestine immunity (Halas and Nochta, 2012). Secretory immunoglobulin A (sIgA) plays an important role in intestinal mucosal defense and protects mucosal surfaces against pathogenic microorganism colonization and invasion (Schley and Field, 2002; Tlaskalová-Hogenová et al., 2004). In the present study, sow diet MOS significantly increased sIgA content in piglet jejunum mucosa, which suggested that sow diet MOS had a beneficial effect on their offspring intestinal mucosal immunity. This result was similar to previous studies in rats (Kudoh et al., 1999) and dogs (Swanson et al., 2002). All the above information implied that diet MOS possesses the potential to enhance the intestine mucosal immune competence by increasing sIgA content. Additionally, in the intestinal immune, the intestine itself and related-intestinal lymphatic played critical immune roles, such as in inflammation (Salmi and Jalkanen, 2005; Garrett et al., 2010). Study in porcine alveolar macrophages found that MOS could alleviate inflammation by decreasing proinflammatory cytokine TNF-α (Che et al., 2012a). In the present study, sow diet MOS decreased the proinflammatory cytokine IL-8 mRNA level in piglet intestinal lymphatic, suggesting that MOS added in the sow diet might enhance their offspring intestinal immunity by decreasing inflammation. It was well studied that TLR superfamily molecules played critical roles in intestinal inflammation (Hausmann et al., 2002). The main pathway was that TLRs activate NF-κB p65 and finally promote proinflammatory cytokines (IL-8 and TNF-α) expression (Takeda and Akira, 2004), which could be inhibited by PPAR-γ (Verma et al., 1995). In the present study, sow diet MOS decreased or tended to decrease TLR2, TLR4, IL-8 (P < 0.05) and NF- κB p65 (P = 0.07) mRNA levels while did not affect PPAR-γ mRNA level in piglet intestinal lymphatic. Thus, it was suggested that sow diet MOS decreased their offspring inflammation in intestinal lymphatic might be partly associated with suppression TLR2/ TLR4/ NF-κB p65 pathway (rather than PPAR-γ). The effect of diet MOS in down-regulating TLR4 and the proinflammatory cytokines genes expression was also found in broiler chicken intestine (Munyaka et al., 2012). The underlying mechanism might be related to the activation of mannose receptors by MOS (Che et al., 2012a), but needs further exploration.
It was reported that the local intestine immunity could further initiate the systemic immune response (Halas and Nochta, 2012). Our previous study found that sow or piglet diets supplementation MOS increased the systemic innate immunity (such as lysozyme and complement) in piglet at weaning and on day 35 of age (Duan et al., 2016). Meanwhile, the piglet diet directly added with MOS could decrease serum inflammation-related cytokines under the lipopolysaccharide (LPS)-stimulation (Che et al., 2012a). However, the effects of sow and (or) piglet diets MOS on inflammation-related cytokines are largely unclear. In the current study, in the piglet serum, sow diet MOS decreased proinflammatory cytokines (IL-2 and IL-4) contents; while piglet diet MOS decreased proinflammatory cytokines (IL-2, IL-4, and IFN-γ) contents and increased anti-inflammatory cytokine (IL-10) content; meanwhile, the interaction between sows and piglet diets on IL-4 and IL-10 were also observed. The above results implied that sow or piglet diet MOS could enhance systemic immunity by improving inflammation-related cytokines; moreover, the sow and piglet diets both added with MOS was more beneficial than adding alone.
In conclusion, piglet diet supplementation with MOS regulated intestinal microbe by increasing beneficial bacteria Lactobacillus amount in the ileum and jejunum digesta and decreasing pernicious bacteria E. coli amount in the jejunum and cecum digesta. Especially, in comparison to piglet diet supplementation with MOS alone, both sow and piglet diets supplementation with MOS showed more significant effect in increasing Lactobacillus amount and decreasing E. coli amount in the jejunum digesta. However, sow diet alone supplementation MOS did not show this improvement effect on their offspring intestinal microbe. Additionally, sow diet MOS enhanced their offspring intestine mucosal immune competence by increasing secretory IgA content, and decreased proinflammatory cytokine IL-8 mRNA expression level might in association with suppression TLR2, TLR4, and NF-κB p65 pathway in their offspring intestinal lymphatic. Finally, sow diet MOS, especially the piglet MOS, could enhance systemic inflammation immunity by increasing anti-inflammatory cytokine (IL-10) content and (or) decreasing proinflammatory cytokines (IL-2 and IL-4) contents in piglet serum; moreover, the sow and piglet diets both added with MOS was more beneficial than adding alone. Thus, sow and/or piglet diet MOS might improve intestinal microbe, suppress intestinal, and systemic inflammation in the piglet.
Acknowledgments
We sincerely acknowledge the Alltech, Inc. (Nicholasville, KY).
Footnotes
This research was financially supported by National Key Research and Development Program of China (2018YFD0500605), National Natural Science Foundation of China (31372324), and the Science and Technology Support Program of Sichuan Province (2013NC0010).
Conflict of Interest
None declared.
Literature Cited
- Baumler A. J., Tsolis R. M., and Heffron F.. 1997. Fimbrial adhesins of Salmonella typhimurium. Role in bacterial interactions with epithelial cells. Adv. Exp. Med. Biol. 412:149–158. [PubMed] [Google Scholar]
- Castillo M., Martín-Orúe S. M., Taylor-Pickard J. A., Pérez J. F., and Gasa J.. 2008. Use of mannan- oligosaccharides and zinc chelate as growth promoters and diarrhea preventative in weaning pigs: effects on microbiota and gut function. J. Anim. Sci. 86:94–101. doi: 10.2527/jas.2005-686 [DOI] [PubMed] [Google Scholar]
- Che T. M., Johnson R. W., Kelley K. W., Dawson K. A., Moran C. A., and Pettigrew J. E.. 2012a. Effects of mannan oligosaccharide on cytokine secretions by porcine alveolar macrophages and serum cytokine concentrations in nursery pigs. J. Anim. Sci. 90:657–668. doi: 10.2527/jas.2011-4310 [DOI] [PubMed] [Google Scholar]
- Che T. M., Johnson R. W., Kelley K. W., Van Alstine W. G., Dawson K. A., Moran C. A., and Pettigrew J. E.. 2011. Mannan oligosaccharide modulates gene expression profile in pigs experimentally infected with porcine reproductive and respiratory syndrome virus. J. Anim. Sci. 89:3016–3029. doi: 10.2527/jas.2010-3366 [DOI] [PubMed] [Google Scholar]
- Che T. M., Song M., Liu Y., Johnson R. W., Kelley K. W., Van Alstine W. G., Dawson K. A., and Pettigrew J. E.. 2012b. Mannan oligosaccharide increases serum concentrations of antibodies and inflammatory mediators in weanling pigs experimentally infected with porcine reproductive and respiratory syndrome virus. J. Anim. Sci. 90:2784–2793. doi: 10.2527/jas.2011-4518 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Y., Chen D., Tian G., He J., Mao X., Mao Q., and Yu B.. 2012. Dietary arginine supplementation alleviates immune challenge induced by Salmonella enterica serovar Choleraesuis bacterin potentially through the toll-like receptor 4-myeloid differentiation factor 88 signalling pathway in weaned piglets. Br. J. Nutr. 108:1069–1076. doi: 10.1017/S0007114511006350 [DOI] [PubMed] [Google Scholar]
- Chen H., Mao X., He J., Yu B., Huang Z., Yu J., Zheng P., and Chen D.. 2013. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br. J. Nutr. 110:1837–1848. doi: 10.1017/S0007114513001293 [DOI] [PubMed] [Google Scholar]
- Duan X. D., Chen D. W., Zheng P., Tian G., Wang J. P., Mao X. B., Yu J., He J., Li B., Huang Z. Q., Ao Z. G., and Yu B.. 2016. Effects of dietary mannan oligosaccharide supplementation on performance and immune response of sows and their offspring. Anim. Feed Sci. Tech. 218:17–25. doi: 10.1016/j.anifeedsci.2016.05.002 [DOI] [Google Scholar]
- Finuance M. C., Dawson K. A., Spring P., and Newman K. E.. 1999. The effect of mannan oligosaccharide on the composition of the microflora in turkey poults. Poult. Sci. 78 (Suppl. 1):77(Abstr.). [Google Scholar]
- Firon N., Ofek I., and Sharon N.. 1983. Carbohydrate specificity of the surface lectins of Escherichia coli, Klebsiella pneumoniae, and Salmonella typhimurium. Carbohydr. Res. 120:235–249. doi: 10.1016/0008-6215(83)88019-7 [DOI] [PubMed] [Google Scholar]
- Garrett W. S., Gordon J. I., and Glimcher L. H.. 2010. Homeostasis and inflammation in the intestine. Cell 140:859–870. doi: 10.1016/j.cell.2010.01.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Halas V., and Nochta I.. 2012. Mannan oligosaccharides in nursery pig nutrition and their potential mode of action. Animals (Basel). 2:261–274. doi: 10.3390/ani2020261 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han G. Q., Xiang Z. T., Yu B., Chen D. W., Qi H. W., Mao X. B., Chen H., Mao Q., and Huang Z. Q.. 2012. Effects of different starch sources on Bacillus spp. in intestinal tract and expression of intestinal development related genes of weanling piglets. Mol. Biol. Rep. 39:1869–1876. doi: 10.1007/s11033-011-0932-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hausmann M., Kiessling S., Mestermann S., Webb G., Spöttl T., Andus T., Schölmerich J., Herfarth H., Ray K., Falk W., . et al. 2002. Toll-like receptors 2 and 4 are up-regulated during intestinal inflammation. Gastroenterology 122:1987–2000. doi: 10.1053/gast.2002.33662 [DOI] [PubMed] [Google Scholar]
- Kudoh K., Shimizu J., Ishiyama A., Wada M., Takita T., Kanke Y., and Innami S.. 1999. Secretion and excretion of immunoglobulin A to cecum and feces differ with type of indigestible saccharides. J. Nutr. Sci. Vitaminol. (Tokyo). 45:173–181. doi: 10.3177/jnsv.45.173 [DOI] [PubMed] [Google Scholar]
- Lu H., Wilcock P., Adeola O., and Ajuwon K. M.. 2019. Effect of live yeast supplementation to gestating sows and nursery piglets on postweaning growth performance and nutrient digestibility. J. Anim. Sci. 97:2534-2540. doi: 10.1093/jas/skz150 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Munyaka P. M., Echeverry H., Yitbarek A., Camelo-Jaimes G., Sharif S., Guenter W., House J. D., and Rodrigez-Lecompte J. C.. 2012. Local and systemic innate immunity in broiler chickens supplemented with yeast-derived carbohydrates. Poult. Sci. 91:2164–2172. doi: 10.3382/ps.2012-02306 [DOI] [PubMed] [Google Scholar]
- NRC 1998. Nutrient requirements of swine. 10th rev. ed. Washington (DC): Natl. Acad. Press. doi: 10.17226/6016 [DOI] [Google Scholar]
- Patil A. K, Kumar S., Verma A. K., and Baghel R. P. S.. 2015. Probiotics as feed additives in weaned pigs: a review. Livest. Res. Int. 3(2):31–39. [Google Scholar]
- Poeikhampha T., and Bunchasak C.. 2011. Comparative effects of sodium gluconate, mannan oligosaccharide and potassium diformate on growth performances and small intestinal morphology of nursery pigs. Asian-Aust. J. Anim. Sci. 24:844–850. doi: 10.5713/ajas.2011.10334 [DOI] [Google Scholar]
- Rekiel A., Wiecek J., Bielecki W., Gajewska J., Cichowicz M., Kulisiewicz J., Batorska M., Roszkowski T., and Beyga K.. 2007. Effect of addition of feed antibiotic flavomycin or prebiotic BIO-MOS on production results of fatteners, blood biochemical parameters, morphometric indices of intestine and composition of microflora. Arch. Tierz. Dummerstorf. 50:172–180. [Google Scholar]
- Salmi M., and Jalkanen S.. 2005. Lymphocyte homing to the gut: attraction, adhesion, and commitment. Immunol. Rev. 206:100–113. doi: 10.1111/j.0105-2896.2005.00285.x [DOI] [PubMed] [Google Scholar]
- Schley P. D., and Field C. J.. 2002. The immune-enhancing effects of dietary fibres and prebiotics. Br. J. Nutr. 87 (Suppl 2):S221–S230. doi: 10.1079/BJN/2002541 [DOI] [PubMed] [Google Scholar]
- Spring P., Wenk C., Connolly A., and Kiers A.. 2015. A review of 733 published trials on Bio-Mos®, a mannan oligosaccharide, and Actigen®, a second generation mannose rich fraction, on farm and companion animals. J. Appl. Anim. Nutr. 3:1–11. doi: 10.1017/jan.2015.6 [DOI] [Google Scholar]
- Swanson K. S., Grieshop C. M., Flickinger E. A., Bauer L. L., Healy H. P., Dawson K. A., Merchen N. R., and Fahey G. C. Jr. 2002. Supplemental fructooligosaccharides and mannanoligosaccharides influence immune function, ileal and total tract nutrient digestibilities, microbial populations and concentrations of protein catabolites in the large bowel of dogs. J. Nutr. 132:980–989. doi: 10.1093/jn/132.5.980 [DOI] [PubMed] [Google Scholar]
- Takeda K., and Akira S.. 2004. TLR signaling pathways. Semin. Immunol. 16:3–9. doi: 10.1016/j.smim.2003.10.003 [DOI] [PubMed] [Google Scholar]
- Tlaskalová-Hogenová H., Stepánková R., Hudcovic T., Tucková L., Cukrowska B., Lodinová-Zádníková R., Kozáková H., Rossmann P., Bártová J., Sokol D., . et al. 2004. Commensal bacteria (normal microflora), mucosal immunity and chronic inflammatory and autoimmune diseases. Immunol. Lett. 93:97–108. doi: 10.1016/j.imlet.2004.02.005 [DOI] [PubMed] [Google Scholar]
- Verma I. M., Stevenson J. K., Schwarz E. M., Van Antwerp D., and Miyamoto S.. 1995. Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9:2723–2735. doi: 10.1101/gad.9.22.2723 [DOI] [PubMed] [Google Scholar]