Skip to main content
PMC home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2019 Oct 5;97(11):4488–4495. doi: 10.1093/jas/skz312

Effects of dietary energy level on appetite and central adenosine monophosphate-activated protein kinase (AMPK) in broilers

Xiyi Hu 1, Yufeng Wang 2, Ardashir Sheikhahmadi 3, Xianlei Li 1, Johan Buyse 2, Hai Lin 1, Zhigang Song 1,✉
PMCID: PMC6827410  PMID: 31586423

Abstract

Adenosine monophosphate-activated protein kinase (AMPK) acts as a sensor of cellular energy changes and is involved in the control of food intake. A total of 216 1-d-old broilers were randomly allotted into 3 treatments with 6 replicates per treatment and 12 broilers in each cage. The dietary treatments included 1) high-energy (HE) diet (3,500 kcal/kg), 2) normal-energy (NE) diet (3,200 kcal/kg), and 3) low-energy (LE) diet (2,900 kcal/kg). The present study was conducted to investigate the effects of dietary energy level on appetite and the central AMPK signal pathway. The results showed that a HE diet increased average daily gain (ADG), whereas a LE diet had the opposite effect (P < 0.05, N = 6). The average daily feed intake (ADFI) of the chickens fed the LE diet was significantly higher than that of the control (P < 0.05, N = 6). Overall, the feed conversion rate gradually decreased with increasing dietary energy level (P < 0.05, N = 6). Moreover, the chickens fed the LE and HE diets demonstrated markedly improved urea content compared with the control group (P < 0.0001, N = 8). The triglyceride (TG) content in the LE group was obviously higher than that in the HE group but showed no change compared with the control (P = 0.0678, N = 8). The abdominal fat rate gradually increased with increased dietary energy level (P = 0.0927, N = 8). The HE group showed downregulated gene expression levels of liver kinase B1 (LKB1), neuropeptide Y (NPY), cholecystokinin (CCK), and glucocorticoid receptor (GR) in the hypothalamus compared with the control group (P < 0.05, N = 8). However, LE treatment significantly increased the mRNA level of AMP-activated protein kinase α2 (AMPKα2) compared with other groups (P = 0.0110, N = 8). In conclusion, a HE diet inhibited appetite and central AMPK signaling. In contrast, a LE diet activated central AMPK and appetite. Overall, the central AMPK signal pathway and appetite were modulated in accordance with the energy level in the diet to regulate nutritional status and maintain energy homeostasis in birds.

Keywords: AMPK, appetite, broiler, diet, energy level, hypothalamus

Introduction

The regulation of voluntary food intake in animals and humans is complex and involves central and peripheral regulatory mechanisms (Lenard and Berthoud, 2008). In the central nervous system (CNS), the hypothalamus is the brain region that regulates food intake and energy homeostasis (Gustavo et al., 2013), and the arcuate nucleus (ARC) of the hypothalamus is believed to play a crucial role in these processes (Sam et al., 2012). Arcuate nucleus contains 2 populations of neurons with opposing effects on food intake (Chaudhri et al., 2008). Central neural circuits and peripheral target tissues regulate appetite and body weight in a coordinated manner, involving negative feedback. Peripheral metabolic hormones released by the gastrointestinal tract during digestion act as episodic satiety signals and regulate appetite and energy metabolism by targeting hypothalamic nuclei (Joanne et al., 2012; Romana et al., 2013).

Hypothalamic 5′-adenosine monophosphate-activated protein kinase (AMPK), composed of α, β, and γ subunits (Hardie et al., 2012), senses intracellular metabolic stress, increases the cellular AMP:ATP ratio, and integrates diverse hormonal and nutritional signals to maintain energy balance (Gustavo et al., 2013). During metabolic stress, AMPK simultaneously shuts down ATP-consuming biosynthetic processes, such as lipid oxidation, and facilitates ATP-producing catabolic processes, such as triglyceride (TG) and protein synthesis, to promote ATP generation (Kola et al., 2006; Kim and Choung, 2012; Liu et al., 2018). Increasing evidence has shown that AMPK has a central role in mediating the appetite-modulating and metabolic effects of several hormones and substances (Kola et al., 2006). Studies have found that AMPK activation or deactivation in the hypothalamus increases or decreases food intake (Andersson et al., 2004; Minokoshi et al., 2004). High-fat diet-induced obesity can alter AMPK activity in the hypothalamus and skeletal muscle (Martin et al., 2006).

Appetite and energy intake following food or supplement consumption reduce hunger and enhance satiety by delayed gastric emptying and thermogenesis induced by a high-energy (HE) diet (Crovetti et al., 1998; Wang et al., 2008; Mansour et al., 2012). Seyedeh and Fahimeh (2019) found that consumption of an high energy diet (HED) cannot significantly affect hunger but can increase fullness compared with an low energy diet. Adenosine monophosphate-activated protein kinase plays a critical role in regulating energy metabolism, but few studies have been conducted on the effect of different energy levels in diet on central AMPK and appetite. Thus, we hypothesized that the higher level of energy in diet would decrease the level of AMPK expression, resulting in higher weight gain, and that the low-energy (LE) diet would have the opposite effect. To test these hypotheses, this experiment evaluated the performance, physiological parameters, and gene expression of broilers receiving HE and LE diets.

Materials and Methods

Animals

One-day-old male broiler chicks were obtained from a local hatchery and housed in cages in an environmentally controlled room. At the beginning, the rearing temperature was 35 °C, which was reduced by 2 °C to 3 °C per week according to the age of the broilers until it reached 23 °C. The ambient humidity was 40% to 50%. The temperature and humidity were adjusted with the growth of the broilers. The illumination procedure was performed according to 23 h of illumination and 1 h of darkness. The composition and nutrient levels of the diets of the chickens used in the experiment are listed in Table 1. All the chickens had free access to food and water during the rearing period. This study was approved by Shandong Agricultural University and carried out in accordance with the Guidelines for Experimental Animals of the Ministry of Science and Technology (Beijing, China).

Table 1.

Composition and nutrient levels of the experimental diets (air dry basis)

Items Content
LE NE HE
Ingredients
 Corn 52.38 45.0704 37.8652
 Soybean meal 40.45 41.7 42.88
 Soybean oil 2.83 8.85 14.86
 Limestone 1.155 1.123 1.0849
 CaHPO4 1.925 1.965 2.012
 Choline chloride 0.25 0.25 0.25
 NaCl 0.3 0.3 0.3
 DL-Met 0.21 0.2316 0.2379
 Mineral premix1 0.2 0.2 0.2
 Vitamin premix1 0.3 0.3 0.3
 L-Lys·H2SO4 0 0.01 0.01
 L-Thr 0 0 0
 Total 100 100 100
Nutrient levels2
 ME (MJ/kg) 2.9 3.2 3.5
 CP 23 23 23
 Ca 1 1 1
 NPP 0.45 0.45 0.45
 Lys 1.204 1.23 1.24
 Met 0.541 0.56 0.561
 Met + Cys 0.896 0.908 0.909
 Thr 0.864 0.864 0.865
 Trp 0.295 0.298 0.301
Open in a new tab

1Vitamin premix and mineral premix provided the following per kilogram of diet: VA 9,000 IU, VD3 2,000 IU, VE 11.0 IU, VK 1.00 mg, thiamine 1.20 mg, riboflavin 5.80 mg, niacin 66.0 mg, pantothenic acid 10.0 mg, pyridoxine 2.60 mg, biotin 0.20 mg, folic acid 0.70 mg, VB12 0.012 mg, Mn 100 mg, Zn 75.0 mg, Fe 80.0 mg, I 0.65 mg, Cu 8.00 mg, Se 0.35 mg.

2Nutrient levels were calculated.

Experiment Protocol and Sample Collection

At 1 d of age, 216 chickens with similar body weight were divided into 3 groups. Each group had 6 replicates, and each replicate had 12 chickens. The chickens were randomly subjected to one of the following 3 treatments: 1) feeding with a HE diet (3,500 kcal/kg); 2) feeding with a normal-energy (NE) diet (3,200 kcal/kg); and 3) feeding with a LE diet (2,900 kcal/kg). At 21 d of age, 2 chickens from each replicate were selected and sacrificed (N = 12). A blood sample was drawn from a wing vein with a heparinized syringe. Plasma was obtained by centrifugation at 400 g for 10 min at 4 °C and then stored at −20 °C. Hypothalamus was collected according to the method described by Yuan et al. (2009). The cut was 4 to 5 mm deep and parallel to the base of the brain (Higgins et al., 2010). After being flash-frozen in liquid nitrogen, the hypothalamus samples were stored at −80 °C.

Plasma Measurements

The concentrations of glucose (No. F006), urea (No. C013-2), total cholesterol (TCHO, No. A111), high-density lipoprotein cholesterol (HDL-C, No. A112), and low-density lipoprotein cholesterol (LDL, No. A113), and TG (No. A110) were measured spectrophotometrically by colorimetric enzymatic methods using commercial diagnostic kits (Jiancheng Bioengineering Institute, Nanjing, P.R. China). Plasma glucose content was measured using the glucose oxidase method. Plasma urea content was determined using the urease method. Plasma TCHO content was measured using the COD-PAP method. Plasma HDL-C and LDL were determined according to the kit instructions. Plasma TG content was measured by the GPO-PAP enzymatic method.

RNA Isolation and Analysis

Gene expression in the hypothalamus was quantified through quantitative real-time PCR. Total RNA was isolated with Trizol (Invitrogen, San Diego, CA). The hypothalamus was ground into powder in liquid nitrogen, and 1 mL Trizol was added. Precooled chloroform was used to extract RNA. The supernatant was transferred to a new centrifuge tube, and isopropanol was added to precipitate RNA. RNA precipitates were rinsed twice with 75% ethanol, then diluted with diethyl pyrocarbonate-treated water. All operations were performed on ice. RNA quality was determined by agarose gel electrophoresis, and the RNA was quantified with a biophotometer (Eppendorf, Germany). RT reactions (10 µL) contained 500 ng of total RNA, 5 mmol/L MgCl2, 1 µL of RT buffer, 1 mmol/L dNTP, 2.5 U AMV, 0.7 nmol/L oligo d(T), and 10 U ribonuclease inhibitor (Takara, Dalian, China). Real-time PCR analysis was carried out with an Applied Biosystems 7500 real-time PCR system (Applied Biosystems, Foster, CA). Each RT reaction served as a template in a 20 µL PCR containing 0.2 µmol/L of each primer and SYBR Green master mix (Takara). The primer sequences are listed in Table 2. The primers were designed for exon–intron junctions using Primer 5.0 software. Real-time PCRs were performed at 95 °C for 10 s of predenaturation, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing and extension at 60 °C for 40 s. A standard curve was plotted to calculate the efficiency of real-time PCR primers. β-Actin was used as the normalization gene, and the results of the relative mRNA quantification were verified using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels. mRNA expression was quantitated through the comparative CT method (2−ΔΔCT) in accordance with the method described by Livak and Schmittgen (2001). The specificity of the amplification product was verified using melting curve analysis and DNA sequencing.

Table 2.

Gene-specific primers of related genes

Gene name1 Accession number Primer sequences, 5′→3′ Product size
LKB1 NM_001045833 F: TGAGAGGGATGCTTGAATACGA 158
R: ACTTGTCCTTTGTTTCTGGGC
NPY NM_205473 F: CTCTGAGGCACTACATCAACC 142
R: ACCACATCGAAGGGTCTTCAA
AMPKα1 NM_001039603 F: CGGAGATAAACAGAAGCACGAG 125
R: CGATTCAGGATCTTCACTGCAAC
AMPK α 2 DQ34039 F: GGGACCTGAAACCAGAGAACG 215
R: ACAGAGGAGGGCATAGAGGATG
CCK NM_001001741 F: CAGCAGAGCCTGACAGAACC 121
R: AGAGAACCTCCCAGTGGAACC
GR NM_001030731 F: AACCTGCTCTGGCTGACTTCTC 121
R: CCCATCACTTTCGCATCTGTTT
α-Actin NM_205518.1 F: CTGGCACCTAGCACAATGAA 123
R: CTGCTTGCTGATCCACATCT
GAPDH NM_204305 F:ACATGGCATCCAAGGAGTGAG 266
R:GGGGAGACAGAAGGGAACAGA
FAS J03860 F: CTATCGACACAGCCTGCTCCT 107
R: CAGAATGTTGACCCCTCCTACC
POMC NM_001031098 F: CGCTACGGCGGCTTCA 88
R: TCTTGTAGGCGCTTTTGACGAT
Open in a new tab

1 LKB1, liver kinase B1; NPY, neuropeptide Y; AMPKα1, AMP-activated protein kinase α1; AMPKα2, AMP-activated protein kinase α2; CCK, cholecystokinin; GR, glucocorticoid receptor; GAPDH, glyceraldehyde phosphate dehydrogenase; FAS, fatty acid synthase; POMC, proopiomelanocortin.

Statistical Analysis

Treatments were analyzed by 1-way ANOVA using the GLM procedure within the SAS statistical software (version 8.02; SAS Institute Inc., Cary, NC). When differences among individual means were found in ANOVA tests (P < 0.05), means were compared by Tukey’s test. The results are presented as mean and standard error of the mean.

Results

Effects of Dietary Energy Levels on the Performance of Broilers

After 21 d of feeding, the average daily gain (ADG) of the chickens fed the HE diet was significantly higher than that of the LE- and NE-diet-fed chickens (P ˂ 0.05, Table 3). Meanwhile, the LE chickens demonstrated significantly decreased ADG compared with NE chickens after 1 and 3 wk of feeding (P ˂ 0.05, Table 3). However, the average daily feed intake (ADFI) of the chickens fed the LE diet was significantly higher than that of the control group (P ˂ 0.05, Table 3). The ADFI of the HE group was unaffected at days 7, 14, and 21 compared to the control and LE groups (P > 0.05, Table 3). At days 7, 14, and 21, the average body weight (ABW) of the HE group was significantly higher than that of the LE- and NE-diet-fed chickens (P ˂ 0.05, Table 3), and at the age of 21 d, the LE diet group had significantly lower body weight than the normal diet group (P ˂ 0.05, Table 3). At 0–7 d old, the feed intake (FI) of the LE diet group was significantly higher than that of the other 2 groups (P ˂ 0.05, Table 3). During the whole experimental stage, the LE diet significantly increased the feed conversion rate (FCR), and the HE diet significantly reduced the FCR at 0–7, 7–14, and 0–21 d compared with the control (P ˂ 0.05, Table 3).

Table 3.

Effects of dietary energy levels on the performance of broiler chickens

Dietary treatment1
Item2 LE NE HE P-value
ABW, g per bird
 Day 7 157.78 ± 1.32b 162.01 ± 1.39b 169.79 ± 1.80a 0.0002
 Day 14 419.10 ± 7.09b 438.06 ± 8.24b 469.51 ± 6.78a 0.0008
 Day 21 785.13 ± 11.84c 846.53 ± 12.41b 917.98 ± 11.08a <0.0001
ADG, g/d per bird
 Day 0 to 7 17.08 ± 0.19c 17.78 ± 0.21b 19.09 ± 0.25a <0.0001
 Day 0 to 14 26.81 ± 0.65b 28.61 ± 0.60b 31.09 ± 0.53a 0.0015
 Day 0 to 21 35.23 ± 0.78c 38.52 ± 0.60b 42.07 ± 0.62a <0.0001
ADFI, g/d per bird
 Day 0 to 7 18.59 ± 0.12a 17.48 ± 0.37b 17.94 ± 0.13ab 0.0201
 Day 0 to 14 31.21 ± 0.28a 29.10 ± 0.48b 29.90 ± 0.44ab 0.0206
 Day 0 to 21 47.03 ± 0.67a 45.11 ± 0.48b 45.90 ± 0.53ab 0.0894
FI, g per pen
 Day 0 to 7 1,561.33 ± 10.42a 1,468.33 ± 37.38b 1,485.50 ± 22.80b 0.0285
 Day 7 to 14 3,613.67 ± 60.81 3,420.00 ± 61.20 3,438.67 ± 94.47 0.1580
 Day 14 to 21 6,386.33 ± 167.17 6,480.00 ± 64.74 6,528.00 ± 63.46 0.6579
 Day 0 to 21 11,561.33 ± 217.87 11,368.33 ± 120.38 11,452.17 ± 158.51 0.7291
FCR
 Day 0 to 7 1.09 ± 0.01a 0.98 ± 0.02b 0.94 ± 0.01c <0.0001
 Day 7 to 14 1.20 ± 0.02a 1.03 ± 0.02b 0.97 ± 0.004c <0.0001
 Day 14 to 21 1.50 ± 0.02a 1.32 ± 0.007b 1.24 ± 0.04b <0.0001
 Day 0 to 21 1.32 ± 0.01a 1.17 ± 0.01b 1.10 ± 0.02c <0.0001
Open in a new tab

1LE, low-energy diet (2,900 kcal/kg); NE, normal-energy diet (3,200 kcal/kg); HE, high-energy diet (3,500 kcal/kg).

2ABW, average body weight; ADG, average daily gain; ADFI, average daily feed intake; FI, feed intake; FCR, feed conversion rate.

a,bMean values in a row sharing no common superscript are significantly different (P < 0.05).

Effects of Dietary Energy Levels on the Plasma Parameters and Organ Index of Broilers

Compared with the control group, the chickens fed the LE and HE diets demonstrated improved urea content, in which the LE diet group had a higher content (P ˂ 0.05, Table 4). The TG content in the LE group was higher than that in the HE group (P ˂ 0.05, Table 4). Dietary energy levels demonstrated no effect on GLU, TCHO, HDL, or LDL content in the plasma of broiler chickens (P > 0.1, Table 4).

Table 4.

Effects of dietary energy levels on the plasma parameters of broiler chickens1

LE NE HE P-value
UREA, mmol/L 0.75 ± 0.04a 0.50 ± 0.02c 0.61 ± 0.02b <0.0001
GLU, mmol/L 14.08 ± 0.20 13.83 ± 0.26 13.67 ± 0.35 0.5809
TG, mmol/L 0.33 ± 0.05a 0.24 ± 0.03ab 0.21 ± 0.02b 0.0678
TCHO, mmol/L 2.87 ± 0.11 2.80 ± 0.14 2.91 ± 0.17 0.8527
HDL, mmol/L 1.75 ± 0.08 1.70 ± 0.09 1.81 ± 0.09 0.6614
LDL, mmol/L 0.30 ± 0.03 0.26 ± 0.04 0.28 ± 0.03 0.6880
Open in a new tab

1LE, low-energy diet (2,900 kcal/kg); NE, normal-energy diet (3,200 kcal/kg); HE, high-energy diet (3,500 kcal/kg); GLU, glucose; TG, triglycerides; TCHO, total cholesterol; HDL, high-density lipoprotein cholesterol; LDL, low-density lipoprotein cholesterol.

a,bMean values in a row sharing no common superscript are significantly different (P < 0.05).

Compared with the control group, HE and LE treatment significantly reduced the spleen index of 21-d-old broiler chickens (P < 0.05, Table 5). The abdominal fat rate increased with the increase in dietary energy level (0.05 < P < 0.1, Table 5). Dietary energy treatment demonstrated no significant effect on the heart, liver, gallbladder, or bursa indexes (P > 0.1, Table 5).

Table 5.

Effects of dietary energy levels on the organ indexes of broiler chickens1

LE NE HE P-value
Abdominal fat 1.05 ± 0.09 1.28 ± 0.08 1.33 ± 0.10 0.0927
Heart 0.44 ± 0.01 0.48 ± 0.02 0.49 ± 0.03 0.1231
Liver 2.80 ± 0.10 3.08 ± 0.16 2.99 ± 0.12 0.2861
Spleen 0.07 ± 0.004b 0.10 ± 0.016a 0.06 ± 0.006b 0.0211
Gallbladder 0.048 ± 0.006 0.065 ± 0.013 0.06 ± 0.009 0.4231
Bursa of Fabricius 0.20 ± 0.02 0.22 ± 0.03 0.24 ± 0.02 0.3975
Open in a new tab

1LE, low-energy diet (2,900 kcal/kg); NE, normal-energy diet (3,200 kcal/kg); HE, high-energy diet (3,500 kcal/kg); The organ index was a percentage to BW and expressed as %.

a,bMean values in a row sharing no common superscript are significantly different (P < 0.05).

Effects of Dietary Energy Level on Appetite and Central AMPK in Broiler Chickens

The gene expression levels of liver kinase B1 (LKB1), neuropeptide Y (NPY), cholecystokinin (CCK), fatty acid synthase (FAS), and glucocorticoid receptor (GR) in the hypothalamus of the 21-d-old broilers in the HE group were significantly downregulated compared with those in the control group (P < 0.05, Fig. 1). The HE treatment had no significant effect on the mRNA level of AMP-activated protein kinase α1 (AMPKα1) or AMP-activated protein kinase α2 (AMPKα2) compared with the control (P > 0.1, Fig. 1). Low-energy treatment significantly increased the gene expression of AMPKα2 in the hypothalamus of 21-d-old broiler chickens (P < 0.05, Fig. 1) and demonstrated no significant effect on the mRNA levels of other genes (P > 0.1, Fig. 1). Compared to the HE group, the LE group showed obviously upregulated AMPKα1 expression in the hypothalamus (P < 0.05, Fig. 1). Dietary energy level exerted no effect on the gene expression of proopiomelanocortin (POMC) in broilers (P > 0.1, Fig. 1).

Figure 1.

Figure 1.

Open in a new tab

Effects of dietary energy level on the mRNA expression of LKB1, NPY, AMPKα1, AMPKα2, CCK, GR, POMC, and FAS in the hypothalami of 21-d-old broiler chickens. Values were obtained from duplicates of each sample; values are means ± SEM (n = 8); a,bmeans with different letters differ significantly (P < 0.05) as shown by ANOVA. LKB1, liver kinase B1; GR, glucocorticoid receptor; AMPKα1, AMPK alpha 1 subunit; AMPKα2, AMPK alpha 2 subunit; NPY, neuropeptide Y; POMC, proopiomelanocortin; CCK, cholecystokinin; FAS, fatty acid synthase.

Discussion

Effects of Dietary Energy Level on the Performance, Plasma Parameters, and Organ Index of Broiler Chickens

Appetite is largely dependent on the interoceptive sense of whether energy levels are adequate. When energy levels are perceived as adequate, feeding drive is low, and when energy levels are perceived as inadequate, the feeding drive kicks into high gear (Lora et al., 2017). The homeostatic control of appetite is mediated by the biological need to maintain the body’s energy stores (Joanne et al., 2012). In our study, the ADFI of the LE group was higher than that of the control group. This result is consistent with research on poultry (Liu et al., 2017) and mammals (Murtaugh et al., 2007). Feed intake increased with decreased nutrient density, supporting the prevailing viewpoint that FI in broilers is regulated on the basis of nutrient density (Nielsen, 2004). The difference between groups is probably due to the dietary energy deficiency that promotes feeding behavior to meet the body’s energy needs. These results show that broilers can adjust the feed intake according to the energy state of the diet and are consistent with previous research (Yuan et al., 2008; Liu et al., 2017). Feeding on the HE diets increased body weight gain, which is in agreement with studies in humans and animals (West and York, 1998; Murtaugh et al., 2007; Yuan et al., 2008). In addition, early studies on broilers have found that HE diets improved broiler BW gain (Grover et al., 1972; Reece and McNaughton, 1982; Zhao et al., 2009). The favorable effect of HE on BW gain should be ascribed to the high energy ingestion. On the other hand, a high energy level in the diet may also increase lipid accumulation in the bodies of broilers (Deaton and Lott, 1985; Summers et al., 1992; Nahashon et al., 2005). Yuan et al. (2008) found that HED chickens had significantly higher plasma insulin levels and that dietary energy levels were associated with impaired glucose-insulin balance. Unfortunately, in this study, we did not measure the insulin level in plasma, but we suspected that the body weight gain caused by a HE diet may be related to insulin imbalance.

In this study, we found that the abdominal fat rate (as a percentage of BW) presented a gradually increasing trend with increasing dietary energy level, indicating that the HE level in the diet promoted abdominal fat deposition. Some studies have found that the contents of BW gain changed toward a higher proportion of adipose tissue rather than skeletal muscle in HED treatment (Yuan et al., 2008). Overall, high energy intake is the most fundamental reason (Eits et al., 2002). In addition, compared with carbohydrate and protein in diet, dietary fat is easier to deposit (Lean and James, 1988; Horton et al., 1995). Surprisingly, in this study, we found that LE and HE treatments significantly reduced the spleen index, which might indicate that the spleen is more sensitive to metabolic disorders.

Blood biochemical parameters can reflect the function and metabolism of nutrients in the body (He et al., 2015; Liu et al., 2015). Blood urea nitrogen (BUN) is the main end product of protein metabolism in vivo, and decreased BUN indicates that more proteins are being synthesized (Kim et al., 2013). The results of this study showed that the plasma urea was significantly increased on the HE and LE diets, indicating that a large proportion of proteins in chickens are catabolic. Lipid accumulation in cells depends on the balance between lipogenesis and lipolysis of TG, which is controlled by nutrition and hormones (Kersten, 2001). The concentration of TG in serum may reflect the status of lipid metabolism in the body (He et al., 2015). In this study, we found that the plasma TG was significantly increased in the LE diet compared with the HE group, reflecting that a high dietary energy level promoted fat deposition and that the LE diet lessened lipid accumulation. These results show that reserved energy is mobilized when the energy content in the diet is low and cannot meet the growth requirements of the body for the maintenance of normal physiological functions.

Effects of Dietary Energy Level on Appetite and Central AMPK in Broiler Chickens

Two key appetite-regulating neuronal populations in ARC regulate nutritional status signals and influence energy homeostasis in birds. One population of neurons suppresses appetite through the release of POMC, as well as cocaine- and amphetamine-regulated transcript (Boswell, 2005; Cai et al., 2015), whereas the other group of neurons stimulates appetite through the release of NPY and agouti-related peptide (Broberger et al., 1998; Romana et al., 2013). In our study, the results showed that the gene expression of NPY in the hypothalamus of broilers fed the HE diet was significantly lower than that in the control group, and the mRNA level of POMC demonstrated no significant change, suggesting that the appetite of chickens fed the HE diet was markedly suppressed through the inhibition of NPY expression. However, there was no change in feed intake, probably because the increased BW gain concealed the suppressing effect of the HE diet.

The effect of glucocorticoids is mediated by ligand-dependent activation of GR, which is expressed in almost every cell type. Activated GR acts as a transcription factor that controls the level of target gene expression and modulates intracellular signaling pathways (Herrlich, 2001; Karin and Chang, 2001; Hafezi-Moghadam et al., 2002). In this study, we found that GR transcription was decreased in the HE group, and thus, the GR pathway was blocked. Many studies have shown that stress increases GR gene expression in birds, accompanied by weight loss (Hu et al., 2019). Our results showed that a HE diet could reduce the production of glucocorticoids and alleviate environmental stress in the same feeding environment. Fatty acid synthase, a main lipogenic enzyme (Li et al., 2016), can alter the rates of biosynthesis and hydrolysis of fatty acids (Smith et al., 2003). Fatty acid synthase catalyzes the last step in the fatty acid biosynthetic pathway, which is believed to be a determinant of the maximal capacity of a tissue, liver in particular, to synthesize fatty acids by de novo lipogenesis (Postic and Girard, 2008). The results of this study showed that dietary HE treatment significantly downregulated the gene expression of FAS in the hypothalamus compared with the controls. These results may be related to tissue-specific regulation of FAS gene expression; however, its mechanism needs to be further studied.

Gut hormones are believed to contribute to short-term feelings of satiety and hunger (Badman and Flier, 2005), which may reduce food intake by decreasing hypothalamic orexigenic signaling and increasing anorectic signaling (Batterham et al., 2002; Jobst et al., 2004). Cholecystokinin, a gastrointestinal hormone, is released from the proximal intestine following nutrient ingestion, particularly fat, and acts as a signal of satiation, reducing meal size by suppressing orexigenic neurons (Matzinger et al., 1999; Bi and Moran, 2002). Cholecystokinin is a gut peptide that has long been established as a postprandial satiety signal and an anorexic factor in avian species (Panchanathan et al., 2006). Liu et al. (2012) found that a decrease in feed intake in corticosterone-exposed hens was not related to the central or peripheral expression level of CCK. In this study, we found that the gene expression of hypothalamic CCK was significantly decreased by feeding on the HE diet. Obviously, this result is inconsistent with the anorexic effect of CCK. It should be noted that the differences in the translation rate of CCK mRNA are still unknown, and its activity may depend on differential posttranslational processing rather than differential expression (Sayegh et al., 2014).

Adenosine monophosphate-activated protein kinase is a ubiquitously expressed kinase found in a number of important hypothalamic nuclei, including ARC, ventral medial hypothalamus (VMH), paraventricular nucleus (PVN), and lateral hypothalamus (LH) (Minokoshi et al., 2004; López et al., 2008). Once phosphorylated on threonine 172 in the α-catalytic subunit, AMPK activity increases, and then it functions as an intracellular energy sensor, switching off ATP-consuming pathways and switching on ATP-producing pathways, such as glucose uptake and fatty acid oxidation (Steinberg and Kemp, 2009). Liver kinase B1 is a major AMPK kinase that is constitutively active and phosphorylates AMPK at the Thr172 site of the subunit (Hawley et al., 1996, 2003; Hong et al., 2003; Woods et al., 2003; Shaw et al., 2004). Kohno et al. (2011) found that AMPK activates NPY neurons in the hypothalamic ARC to increase food intake in rats, which is consistent with our findings. In our study, HE diet treatment significantly decreased LKB1 and AMPKα1 gene expression in the hypothalamus compared to the control group. At the same time, LE diet treatment significantly increased the gene expression of AMPKα2. These results revealed that the central AMPK signal pathway was restrained by the administration of the HE diet, which restrained lipid oxidation and promoted lipid synthesis. Conversely, the central AMPK signaling pathway in chickens fed the LE diet was activated, promoting catabolism and generating more energy.

In conclusion, the HE diet suppressed the appetite and the AMPK signal pathway in the hypothalamus, whereas the LE diet activated central AMPK.

Funding

This work was supported by the National Key R&D Program of China (2018YFD0501401-3), the National Natural Science Foundation of China (31472115), the Shandong Province Agricultural Industry Technology (SDAIT-11-08), and Funds of the Shandong “Double Tops” program.

Conflict of Interest

None Declared.

Literature Cited

  1. Andersson U., Filipsson K., Abbott C. R., Woods A., Smith K., Bloom S. R., Carling D., and Small C. J.. 2004. AMP-activated protein kinase plays a role in the control of food intake. J. Biol. Chem. 279:12005–12008. doi: 10.1074/jbc.C300557200 [DOI] [PubMed] [Google Scholar]
  2. Badman M. K., and Flier J. S.. 2005. The gut and energy balance: visceral allies in the obesity wars. Science 307:1909–1914. doi: 10.1126/science.1109951 [DOI] [PubMed] [Google Scholar]
  3. Batterham R. L., Cowley M. A., Small C. J., Herzog H., Cohen M. A., Dakin C. L., Wren A. M., Brynes A. E., Low M. J., Ghatei M. A., . et al. 2002. Gut hormone PYY(3-36) physiologically inhibits food intake. Nature 418:650–654. doi: 10.1038/nature00887 [DOI] [PubMed] [Google Scholar]
  4. Bi S., and Moran T. H.. 2002. Actions of CCK in the controls of food intake and body weight: lessons from the CCK-A receptor deficient OLETF rat. Neuropeptides 36:171–181. doi: 10.1054/npep.2002.0895 [DOI] [PubMed] [Google Scholar]
  5. Boswell T. 2005. Regulation of energy balance in birds by the neuroendocrine hypothalamus. J. Poult. Sci. 42:161–181. [Google Scholar]
  6. Broberger C., Johansen J., Johansson C., Schalling M., and Hökfelt T.. 1998. The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proc. Natl. Acad. Sci. USA 95:15043–15048. doi: 10.1073/pnas.95.25.15043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cai G., Mo C., Huang L., Li J., and Wang Y.. 2015. Characterization of the two CART genes (CART1 and CART2) in chickens (Gallus gallus). PLoS One 10:e0127107. doi: 10.1371/journal.pone.0127107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chaudhri O. B., Field B. C., and Bloom S. R.. 2008. Gastrointestinal satiety signals. Int. J. Obes. 70:239–255. doi: 10.1146/annurev.physiol.70.113006.100506 [DOI] [PubMed] [Google Scholar]
  9. Crovetti R., Porrini M., Santangelo A., and Testolin G.. 1998. The influence of thermic effect of food on satiety. Eur. J. Clin. Nutr. 52:482–488. doi: 10.1038/sj.ejcn.1600578 [DOI] [PubMed] [Google Scholar]
  10. Deaton J. W., and Lott B. D.. 1985. Age and dietary energy effect on broiler abdominal fat deposition. Poult. Sci. 64:2161–2164. doi: 10.3382/ps.0642161 [DOI] [PubMed] [Google Scholar]
  11. Eits R. M., Kwakkel R. P., Verstegen M. W., Stoutjesdijk P., and De Greef K. H.. 2002. Protein and lipid deposition rates in male broiler chickens: separate responses to amino acids and protein-free energy. Poult. Sci. 81:472–480. doi: 10.1093/ps/81.4.472 [DOI] [PubMed] [Google Scholar]
  12. Grover R. M., Anderson D. L., and Damon R. A.. 1972. The effects of bird density, dietary energy, light intensity, and cage level on the reproductive performance of heavy type chickens in wire cages. Poult. Sci. 51:565–575. doi: 10.3382/ps.0510565 [DOI] [Google Scholar]
  13. Gustavo D. P., Ropelle E. R., and Rocha G. Z.. 2013. The role of neuronal AMPK as a mediator of nutritional regulation of food intake and energy homeostasis. Metabolism 62:171–178. doi: 10.1016/j.metabol.2012.07.001 [DOI] [PubMed] [Google Scholar]
  14. Hafezi-Moghadam A., Simoncini T., Yang Z., Limbourg F. P., Plumier J. C., Rebsamen M. C., Hsieh C. M., Chui D. S., Thomas K. L., Prorock A. J., . et al. 2002. Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat. Med. 8:473–479. doi: 10.1038/nm0502-473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hardie D. G., Ross F. A., and Hawley S. A.. 2012. AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 13:251–262. doi: 10.1038/nrm3311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hawley S. A., Boudeau J., Reid J. L., Mustard K. J., Udd L., Mäkelä T. P., Alessi D. R., and Hardie D. G.. 2003. Complexes between the LKB1 tumor suppressor, STRAD alpha/beta and MO25 alpha/beta are upstream kinases in the AMP-activated protein kinase cascade. J. Biol. 2:28. doi: 10.1186/1475-4924-2-28 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hawley S. A., Davison M., Woods A., Davies S. P., Beri R. K., Carling D., and Hardie D. G.. 1996. Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J. Biol. Chem. 271:27879–27887. doi: 10.1074/jbc.271.44.27879 [DOI] [PubMed] [Google Scholar]
  18. He J., Dong L., Xu W., Bai K., Lu C., Wu Y., Huang Q., Zhang L., and Wang T.. 2015. Dietary tributyrin supplementation attenuates insulin resistance and abnormal lipid metabolism in suckling piglets with intrauterine growth retardation. PLoS One 10:e0136848. doi: 10.1371/journal.pone.0136848 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Herrlich P. 2001. Cross-talk between glucocorticoid receptor and AP-1. Oncogene 20:2465–2475. doi: 10.1038/sj.onc.1204388 [DOI] [PubMed] [Google Scholar]
  20. Higgins S. E., Ellestad L. E., Trakooljul N., McCarthy F., Saliba J., Cogburn L. A., and Porter T. E.. 2010. Transcriptional and pathway analysis in the hypothalamus of newly hatched chicks during fasting and delayed feeding. BMC Genomics 11:162. doi: 10.1186/1471-2164-11-162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hong S. P., Leiper F. C., Woods A., Carling D., and Carlson M.. 2003. Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases. Proc. Natl. Acad. Sci. USA 100:8839–8843. doi: 10.1073/pnas.1533136100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Horton T. J., Drougas H., Brachey A., Reed G. W., Peters J. C., and Hill J. O.. 1995. Fat and carbohydrate overfeeding in humans: different effects on energy storage. Am. J. Clin. Nutr. 62:19–29. doi: 10.1093/ajcn/62.1.19 [DOI] [PubMed] [Google Scholar]
  23. Hu X., Wang Y., Sheikhahmadi A., Li X., Buyse J., Lin H., and Song Z.. 2019. Effects of glucocorticoids on lipid metabolism and AMPK in broiler chickens’ liver. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 232:23–30. doi: 10.1016/j.cbpb.2019.02.001 [DOI] [PubMed] [Google Scholar]
  24. Joanne A. H., Dovey T. M., Blundell J. E., and Halford J. C.. 2012. CNS regulation of appetite. Neuropharmacology 63:3–17. doi: 10.1016/j.neuropharm.2012.01.007 [DOI] [PubMed] [Google Scholar]
  25. Jobst E. E., Enriori P. J., and Cowley M. A.. 2004. The electrophysiology of feeding circuits. Trends Endocrinol. Metab. 15:488–499. doi: 10.1016/j.tem.2004.10.007 [DOI] [PubMed] [Google Scholar]
  26. Karin M., and Chang L.. 2001. AP-1–glucocorticoid receptor crosstalk taken to a higher level. J. Endocrinol. 169:447–451. doi: 10.1677/joe.0.1690447 [DOI] [PubMed] [Google Scholar]
  27. Kersten S. 2001. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2:282–286. doi: 10.1093/embo-reports/kve071 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim H., and Choung S. Y.. 2012. Anti-obesity effects of Boussingaulti gracilis Miers var. pseudobaselloides Bailey via activation of AMP-activated protein kinase in 3T3-L1 cells. J. Med. Food 15:811–817. doi: 10.1089/jmf.2011.2126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kim J. S., Ingale S. L., Lee S. H., and Kim K. H.. 2013. Effects of energy levels of diet and β-mannanase supplementation on growth performance, apparent total tract digestibility and blood metabolites in growing pigs. Anim. Feed Sci. Technol. 186:64–70. doi: 10.1016/j.anifeedsci.2013.08.008 [DOI] [PubMed] [Google Scholar]
  30. Kohno D., Sone H., Tanaka S., Kurita H., Gantulga D., and Yada T.. 2011. AMP-activated protein kinase activates neuropeptide Y neurons in the hypothalamic arcuate nucleus to increase food intake in rats. Neurosci. Lett. 499:194–198. doi: 10.1016/j.neulet.2011.05.060 [DOI] [PubMed] [Google Scholar]
  31. Kola B., Boscaro M., Rutter G. A., Grossman A. B., and Korbonits M.. 2006. Expanding role of AMPK in endocrinology. Trends Endocrinol. Metab. 17:205–215. doi: 10.1016/j.tem.2006.05.006 [DOI] [PubMed] [Google Scholar]
  32. Lean M. E., and James W. P.. 1988. Metabolic effects of isoenergetic nutrient exchange over 24 hours in relation to obesity in women. Int. J. Obes. 12:15–27. doi: 10.1016/0306-9192(88)90025-5 [DOI] [PubMed] [Google Scholar]
  33. Lenard N. R., and Berthoud H. R.. 2008. Central and peripheral regulation of food intake and physical activity: pathways and genes. Obesity 16(Suppl. 3):S11–S22. doi: 10.1038/oby.2008.511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li X. K., Wang J. Z., Wang C. Q., Zhang C. H., Li X., Tang C. H., and Wei X. L.. 2016. Effect of dietary phosphorus levels on meat quality and lipid metabolism in broiler chickens. Food Chem. 205:289–296. doi: 10.1016/j.foodchem.2016.02.133 [DOI] [PubMed] [Google Scholar]
  35. Liu Q. W., Feng J. H., Chao Z., Chen Y., Wei L. M., Wang F., Sun R. P., and Zhang M. H.. 2015. The influences of ambient temperature and crude protein levels on performance and serum biochemical parameters in broilers. J. Anim. Physiol. Anim. Nutr. (Berl) 100:301–308. doi: 10.1111/jpn.12368 [DOI] [PubMed] [Google Scholar]
  36. Liu L., Song Z., Sheikhahmadi A., Jiao H., and Lin H.. 2012. Effect of corticosterone on gene expression of feed intake regulatory peptides in laying hens. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 162:81–87. doi: 10.1016/j.cbpb.2012.04.005 [DOI] [PubMed] [Google Scholar]
  37. Liu L., Wang X., and Jiao H.. 2017. Glucocorticoids induced high fat diet preference via activating hypothalamic AMPK signaling in chicks. Gen. Comp. Endocrinol. 249:40–47. doi: 10.1016/j.ygcen.2017.02.018 [DOI] [PubMed] [Google Scholar]
  38. Liu B., Yang T., and Luo Y.. 2018. Oat β-glucan inhibits adipogenesis and hepatic steatosis in high fat diet induced hyperlipidemic mice via AMPK signaling. J. Funct. Foods 41:72–82. doi: 10.1016/j.jff.2017.12.045 [DOI] [Google Scholar]
  39. Livak K. J., and Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  40. López M., Lage R., Saha A. K., Pérez-Tilve D., Vázquez M. J., Varela L., Sangiao-Alvarellos S., Tovar S., Raghay K., Rodríguez-Cuenca S., . et al. 2008. Hypothalamic fatty acid metabolism mediates the orexigenic action of ghrelin. Cell Metab. 7:389–399. doi: 10.1016/j.cmet.2008.03.006 [DOI] [PubMed] [Google Scholar]
  41. Lora K. H., and Lam D. D.. 2017. An appetite for life: brain regulation of hunger and satiety. Curr. Opin. Pharmacol. 37:100–106. doi: 10.1016/j.coph.2017.09.002 [DOI] [PubMed] [Google Scholar]
  42. Mansour M. S., Ni Y. M., Roberts A. L., Kelleman M., Roychoudhury A., and St-Onge M. P.. 2012. Ginger consumption enhances the thermic effect of food and promotes feelings of satiety without affecting metabolic and hormonal parameters in overweight men: a pilot study. Metabolism 61:1347–1352. doi: 10.1016/j.metabol.2012.03.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Martin T. L., Alquier T., Asakura K., Furukawa N., Preitner F., and Kahn B. B.. 2006. Diet-induced obesity alters AMP kinase activity in hypothalamus and skeletal muscle. J. Biol. Chem. 281:18933–18941. doi: 10.1074/jbc.M512831200 [DOI] [PubMed] [Google Scholar]
  44. Matzinger D., Gutzwiller J. P., Drewe J., Orban A., Engel R., D’Amato M., Rovati L., and Beglinger C.. 1999. Inhibition of food intake in response to intestinal lipid is mediated by cholecystokinin in humans. Am. J. Physiol. 277:R1718–R1724. doi: 10.1152/ajpregu.1999.277.6.R1718 [DOI] [PubMed] [Google Scholar]
  45. Minokoshi Y., Alquier T., Furukawa N., Kim Y. B., Lee A., Xue B., Mu J., Foufelle F., Ferré P., Birnbaum M. J., . et al. 2004. AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428:569–574. doi: 10.1038/nature02440 [DOI] [PubMed] [Google Scholar]
  46. Murtaugh M. A., Herrick J. S., Sweeney C., Baumgartner K. B., Guiliano A. R., Byers T., and Slattery M. L.. 2007. Diet composition and risk of overweight and obesity in women living in the southwestern United States. J. Am. Diet. Assoc. 107:1311–1321. doi: 10.1016/j.jada.2007.05.008 [DOI] [PubMed] [Google Scholar]
  47. Nahashon S. N., Adefope N., Amenyenu A., and Wright D.. 2005. Effects of dietary metabolizable energy and crude protein concentrations on growth performance and carcass characteristics of French guinea broilers. Poult. Sci. 84:337–344. doi: 10.1093/ps/84.2.337 [DOI] [PubMed] [Google Scholar]
  48. Nielsen B. L. 2004. Behavioural aspects of feeding constraints: do broilers follow their gut feelings? Appl. Anim. Behav. Sci. 86:251–260. doi: 10.1016/j.applanim.2004.02.005 [DOI] [Google Scholar]
  49. Panchanathan V., Chaudhri G., and Karupiah G.. 2006. Protective immunity against secondary poxvirus infection is dependent on antibody but not on CD4 or CD8 T-cell function. J. Virol. 80:6333–6338. doi: 10.1128/JVI.00115-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Postic C., and Girard J.. 2008. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice. J. Clin. Invest. 118:829–838. doi: 10.1172/JCI34275 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Reece F. N., and McNaughton J. L.. 1982. Effects of dietary nutrient density on broiler performance at low and moderate environmental temperatures. Poult. Sci. 61:2208–2211. doi: 10.3382/ps.0612208 [DOI] [PubMed] [Google Scholar]
  52. Romana S., Ashley S. E., and Andrews Z. B.. 2013. AMPK and the neuroendocrine regulation of appetite and energy expenditure. Mol. Cell. Endocrinol. 366:215–223. doi: 10.1016/j.mce.2012.06.012 [DOI] [PubMed] [Google Scholar]
  53. Sam A. H., Troke R. C., Tan T. M., and Bewick G. A.. 2012. The role of the gut/brain axis in modulating food intake. Neuropharmacology 63:46–56. doi: 10.1016/j.neuropharm.2011.10.008 [DOI] [PubMed] [Google Scholar]
  54. Sayegh A. I., Washington M. C., Raboin S. J., Aglan A. H., and Reeve J. R. Jr. 2014. CCK-58 prolongs the intermeal interval, whereas CCK-8 reduces this interval: not all forms of cholecystokinin have equal bioactivity. Peptides 55:120–125. doi: 10.1016/j.peptides.2014.02.014 [DOI] [PubMed] [Google Scholar]
  55. Seyedeh P. M., and Fahimeh H.. 2019. Dietary energy density and appetite: a systematic review and meta-analysis of clinical trials. Nutrition 69:110551. doi: 10.1016/j.nut.2019.110551 [DOI] [PubMed] [Google Scholar]
  56. Shaw R. J., Kosmatka M., Bardeesy N., Hurley R. L., Witters L. A., DePinho R. A., and Cantley L. C.. 2004. The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proc. Natl. Acad. Sci. USA 101:3329–3335. doi: 10.1073/pnas.0308061100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Smith S., Witkowski A., and Joshi A. K.. 2003. Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 42:289–317. doi: 10.1016/S0163-7827(02)00067-X [DOI] [PubMed] [Google Scholar]
  58. Steinberg G. R., and Kemp B. E.. 2009. AMPK in health and disease. Physiol. Rev. 89:1025–1078. doi: 10.1152/physrev.00011.2008 [DOI] [PubMed] [Google Scholar]
  59. Summers J. D., Spratt D., and Atkinson J. L.. 1992. Broiler weight gain and carcass composition when fed diets varying in amino acid balance, dietary energy, and protein level. Poult. Sci. 71:263–273. doi: 10.3382/ps.0710263 [DOI] [PubMed] [Google Scholar]
  60. Wang G. J., Tomasi D., Backus W., Wang R., Telang F., Geliebter A., Korner J., Bauman A., Fowler J. S., Thanos P. K., . et al. 2008. Gastric distention activates satiety circuitry in the human brain. Neuroimage 39:1824–1831. doi: 10.1016/j.neuroimage.2007.11.008 [DOI] [PubMed] [Google Scholar]
  61. West D. B., and York B.. 1998. Dietary fat, genetic predisposition, and obesity: lessons from animal models. Am. J. Clin. Nutr. 67(3 Suppl): 505S–512S. doi: 10.1093/ajcn/67.3.505S [DOI] [PubMed] [Google Scholar]
  62. Woods A., Johnstone S. R., Dickerson K., Leiper F. C., Fryer L. G., Neumann D., Schlattner U., Wallimann T., Carlson M., and Carling D.. 2003. LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr. Biol. 13:2004–2008. doi: 10.1016/j.cub.2003.10.031 [DOI] [PubMed] [Google Scholar]
  63. Yuan L., Lin H., Jiang K. J., Jiao H. C., and Song Z. G.. 2008. Corticosterone administration and high-energy feed results in enhanced fat accumulation and insulin resistance in broiler chickens. Br. Poult. Sci. 49:487–495. doi: 10.1080/00071660802251731 [DOI] [PubMed] [Google Scholar]
  64. Yuan L., Ni Y., Barth S., Wang Y., Grossmann R., and Zhao R.. 2009. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity. Brain Res. 1273:18–28. doi: 10.1016/j.brainres.2009.03.052 [DOI] [PubMed] [Google Scholar]
  65. Zhao J. P., Chen J. L., Zhao G. P., Zheng M. Q., Jiang R. R., and Wen J.. 2009. Live performance, carcass composition, and blood metabolite responses to dietary nutrient density in two distinct broiler breeds of male chickens. Poult. Sci. 88:2575–2584. doi: 10.3382/ps.2009-00245 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES