Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2019 Nov 4;14(11):e0223800. doi: 10.1371/journal.pone.0223800

Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats

Jordânia M O Freire 1, Hellíada V Chaves 1, Alrieta H Teixeira 2, Luzia Herminia T de Sousa 1, Isabela Ribeiro Pinto 1, José Jackson do N Costa 3, Nayara Alves de Sousa 4, Karuza Maria A Pereira 5, Virgínia C C Girão 5, Vanessa C S Ferreira 6, João Evangelista de Ávila dos Santos 7, Mary Anne S Lima 7, Antônia T A Pimenta 7, Raquel de C Montenegro 8, Maria Elisabete A de Moraes 8, Vicente de P T Pinto 4, Gerardo C Filho 4, Mirna M Bezerra 4,8,*
Editor: Sakamuri V Reddy9
PMCID: PMC6827912  PMID: 31682614

Abstract

Periodontitis is an immuno-inflammatory disease, which can lead to tooth loss. This study aimed to investigate the efficacy of Platymiscium floribundum Vog., a Brazilian tree which has been used in folk medicine as an anti-inflammatory agent, in a pre-clinical trial of periodontitis in rats. Periodontitis was induced by placing a sterilized nylon (3.0) thread ligature around the cervix of the second left upper molar of the rats, which received (per os) P. floribundum extract (0.1, 1 or 10 mg/kg) or vehicle 1h before periodontitis-challenge and once daily during 11 days. Treatment with P. floribundum (10mg/kg) decreased alveolar bone loss, MPO activity nitrite/nitrate levels, oxidative stress, TNF-α, IL1-β, IL-8/CINC-1, and PGE2 gingival levels, and transcription of TNF-α, IL1-β, COX-2, iNOS, RANK, and RANKL genes, while elevated both BALP serum levels and IL-10 gingival levels. The animals did not show signs of toxicity throughout the experimental course. These findings show that P. floribundum has anti-inflammatory and anti-resorptive properties in a pre-clinical trial of periodontitis, representing an interesting biotechnological tool.

Introduction

Periodontitis is a complex immuno-inflammatory disease being characterized by periodontal ligament damage and alveolar bone loss, which can lead ultimately to tooth loss. Its complexity arises from the interplay between tooth-associated microbial biofilm and the host's immune-inflammatory response [1]. Due its prevalence, periodontitis has negative effects on the quality of life of the subjects.

Within inflamed periodontium a plethora of cells (epithelial cells, fibroblasts, leukocytes, osteoblasts, osteoclasts, and dendritic cells) release inflammatory mediators such as cytokines/chemokines (TNF-α, IL1-β, IL-8/CINC-1), as well as prostaglandins (PGE2), and nitric oxide (NO), which promote the breakdown of the tooth supporting tissues [2]. Also, it is worth mentioning that reactive oxygen species (ROS) can also play a role in this process [3].

The conventional treatment for periodontitis comprises the non-surgical (scaling and root planning) and surgical approaches. Furthemore, adjunct therapy with systemic nonsteroidal anti-inflammatory drugs and antibiotics is sometimes required [4]. However, this strategy has attracted a lot of criticisms because the side effects such as emerging of bacterial resistance, gastrointestinal bleeding as well as cardiovascular and renal effects [5]. In an attempt to overcome these limitations the search for safer therapeutic agents still continues.

Natural products isolated from plants are considered good alternatives to synthetic chemicals. Platymiscium floribundum Vog. (genus Platymiscium and family Fabaceae-Papilionoideae) is a medium sized tree which belongs to the Fabaceae-Papilionoideae family. In the Brazilian Northeast it is popularly known as “sacambu” and “jacaranda-do-litoral” and it has been used in folk medicine as an anti-inflammatory agent. Phytochemical investigation of this genus highlighted flavonoids, isoflavones and coumarins as main constituents [6–7].

The use of natural products in the management of periodontitis still lacks preclinical and clinical studies that can prove the efficacy and safety. Thus, the present study was aimed at investigating the unexplored efficacy of P. floribundum in a rat model of periodontitis. Also, we investigated the putative role of cytokines/chemokines PGE2, NO, and oxidative stress in P. floribundum efficacy. Additional, a systemic evaluation of the sub-chronic toxicity of P. floribundum was carried out.

Materials and methods

Animals

144 female Wistar rats (200–220g) were obtained from the Federal University of Ceara animal research facility. Rats were housed in polypropylene boxes with controlled temperature and 12 h-12 h light dark cycles with free acess to chow diet and water. All animal procedures followed a protocol in compliance with the guidelines from the Brazilian Society of Laboratory Animal Science (SBCAL) and which was approved by a standing Institutional Animal Care and Use Committee at School of Medicine, Federal University of Ceará, Sobral, Ceará, Brazil (Permit number: 05/2015).

Plant material

P. floribundum was collected in Acarape, Ceará State, Brazil. A voucher specimen (#31052) identified by Prof. Edson Paula Nunes is deposited at the Prisco Bezerra Herbarium, Federal University of Ceará, Brazil [8]. For this study we used part of the chloroformic extract (2.0 g) obtained from trunk heartwood (8,000.0 g) of P. floribundum.

Experimental protocol

Animals were divided into unchallenged and periodontitis-challenged groups (6 rats each) receiving (per os) either P. floribundum (0.1, 1 or 10 mg/kg) or vehicle (0.9% saline + 0.1% ethanol) 1h before periodontits-challenge and once daily during 11 days.

Periodontitis-challenge was performed, under anesthesia (i.p) (ketamine 90 mg/kg + xylazine 10 mg/kg), by placing a nylon thread (3.0 Nylpoint, Ceará, Brazil) around the second molar [9]. On the 11th day, rats were euthanized with an overdose of ketamine/xylazine (300:30mg/kg; i.p.). The maxillae were harvested to analyze the bone loss. P. floribundum 10 mg/kg was found to be the most effective dose at protecting against alveolar bone loss, and therefore this dose was chosen for hystopathological analyses, and for the quantification in gingival tissues of (1) Myeloperoxidase (MPO) activity, (2) nitrite/nitrate levels, (3) superoxide dismutase-SOD/catalase-CAT levels, (4) TNF-α, IL1-β, IL-8/CINC-1, IL-10, and PGE2 levels (ELISA), and (5) qRT-PCR for TNF-α, IL1-β, COX-2, iNOS, RANK and RANKL. All dosages were done on the 11th day, except for the MPO dosage that was done at the 6th hour.

Determination of bone remodeling

After 11 days of treatment, the maxillae were harvested and fixed in buffered formalin (10%). After 24 hour, the maxillas were defleshed and stained with methylene blue (1%), fixed in a piece of wax, and photographed. The morphometric analysis of bone resorption was performed using the ImageJ® Software (National Institute of Health, Bethesda, MD, USA), as described previously [10]. Further, serum levels of Bone Alkaline Phosphatase (BALP) were quantified as previously described [11] for analysis of bone formation.

Histopathological analysis of alveolar bone

The H&E-stained maxillae were semiquantitatively evaluated for the presence of cell infiltrate and osteoclasts, and state of preservation of cement and alveolar process. giving a (0–3) score grade for each of these parameters [9].

Scanning Electron Microscopic (SEM) of alveolar bone

The maxillae were fixed in Karnovisky for at least 6 hours, and then transferred to Cacodylate buffer. They were then cut into a diamond-shaped blade in a medial-distal plane to obtain the maxillary fragment (0.5 × 0.2 cm and 0.5 mm thick). The fragments were left in desiccator drying for 24 h and were assembled into gold dust plating stubs (Quorum Metallizer QT150ES, Quorum Technologies, Laughton, England) for Scanning Electron Microscopy (SEM inspect50, FEI, Hillsboro, Oregon, USA). The analysed region was that between the first and second molar.

MPO activity

MPO activity was analyzed in gingival tissues collected at 6th hour of periodontitis-challenge, as described by Bradley et al. [12]. The results were expressed as MPO activity/mg tissue.

NO production

The total nitrite/nitrate dosage was performed as an indicator of NO production in gingival samples by Griess reaction [13]. The values obtained were compared with those obtained for standard curve and expressed in NOx (μM).

SOD and CAT activity assessment

SOD was measured using a protocol previously described [14]. The results are expressed in grams of SOD/mL. CAT activity was performed using a protocol described by Maehly and Chance [15]

Cytokines and PGE2 dosage

TNF-α, IL-1β, IL-8/CINC-1, and IL-10 levels were evaluated in gingival samples using commercial kits DuoSet ELISA (R&D Systems Inc., MN, USA). In the same way, the determination of PGE2 was performed by ELISA, using R&D Systems®, Kit Parameter TMPGE2 Assay (catalog PKGE004B, USA kit). Both kits were used according to manufacturer's instructions. The results were arranged as pg/mL.

RNA isolation and quantitative real-time PCR

Total RNA was extracted from gingival samples using the TRIzol reagent (Invitrogen, São Paulo, Brazil). The reverse transcription was performed using SuperScript IV Reverse Transcriptase (Invitrogen, São Paulo, Brazil) following the manufacturer’s instructions.

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in StepOne Real-Time PCR thermocycler (Applied Biosystems,Warrington, UK) using SYBRR Green Master Mix (Applied Biosystems, Warrington, UK), as indicated by the manufacturer. The relative gene expression was determined using the 2-ΔΔCt method [16], with GAPDH (S-GGACCAGGTTGTCTCCTGTG/A-CATTGAGAGCAATGCCAGCC) as the housekeeping gene. The primers pairs used in this study were: TNF-α (S-CGGGGTGATCGGTCCCAACAAG/ A-GTGGTTTGCTACGACGTGGGC), IL1-β (S-TGCTGTCTGACCCATGTGAG/ A-CCAAGGCCACAGGGATTTTG), COX-2 (S-TCCAGTATCAGAACCGCATTGCCT/A AGCAAGTCCGTGTTCAAGGAGGAT), iNOS (S-AGGCACAAGACTCTGACACC/ A-GGTAGGGTAGAGGAGGGGAG), RANK (S-AGGGAAAACGCTGACAGCTAA/ A-CCAACACAATGGTCCCCTGA), and RANKL (S-GCCAACCGAGACTACGGCAA / A-GAACATGAAGCGGGAGGCG).

Toxicity assessment

After 11 days of treatment, rats were anesthetized and blood samples were collected from the right ventricle and centrifuged for dosing of total alkaline phosphatase (TALP), creatinine, alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Dosages were done following the manufacturer's instructions (Labtest®, Lagoa Santa, MG, Brazil). Additionally, after euthanasia, heart, stomach, liver and kidneys were removed for histopathological analysis (H&E).

Statistical analysis

All data were normalized using the Shapiro-Wilk normality test. Results were showed as mean±standard error (SEM) or as median, when appropriate. ANOVA followed by the Tukey test or Games-Howell test were used to compare the means and the Kruskal-Wallis and Dunn tests were used to compare the medians. P <0.05 was considered significant. Analyzes were performed using IBM SPSS Statistics for Windows, Version 20.0. Software Armonk, NY or GraphPad Prism 6, San Diego, CA, USA.

Results

Effect of P. floribundum on alveolar bone loss

Administration of P. floribundum (10 mg/kg) 1 hour before the placement of the ligature and for 11 days resulted in a significant inhibition (p<0.001) of alveolar bone loss (Fig 1A), compared to the groups that received only the vehicle (non-treated group). Periodontitis-challenge was associated with alveolar bone resorption, root exposition and loss of interdental contact (Fig 1B [b]), when compared to unchallenged group (Fig 1B [a]). These findings were confirmed by the histopathological analysis (H&E), which showed an intense inflammatory cell influx, reabsorption of the alveolar bone with partial destruction of the cementum and presence of osteoclasts (Fig 1B [f]), receiving median scores of 2 (2–3) (Table 1). P. floribundum (10 mg/kg) decreased root exposition and loss of interdental contact (Fig 1B [i]), when compared to non-treated group (Fig 1B [b]). Also, the histopathological analysis (H&E) depicted a discrete inflammatory cellular infiltrate, partial preservation of the alveolar process, preserved cement, and reduction of osteoclasts number (Fig 1B [j]), receiving scores from 0–1 (Table 1). These values were statistically different (P < 0.001), when compared with the non-treated group. When analyzing the region between the first and second molar by using Scanning Electron Microscopy (SEM) in both 65x and 350x magnification, respectively, it can be seen that periodontitis-challenge was associated with an irregular topography (Fig 1B [g-h]), when compared to the bone tissue from unchallenged group (Fig 1B [c-d]). The rats treated with P. floribundum (10 mg/kg) (Fig 1B [k-1]) showed regular tissue topography, when compared to non-treated group (Fig 1B [g-h]).

Fig 1.

Fig 1

Open in a new tab

(A) Effect of P. floribundum (0.1; 1 or 10 mg/kg) on alveolar bone loss in experimental periodontitis. Naive: animals without periodontitis; NT: animals subjected to periodontitis and treated with vehicle (0.9% saline + 0.1% ethanol). P. floribundum: rats submitted to periodontitis and treated with P. floribundum (0.1; 1 or 10 mg/kg), respectively. Data are shown as mean ± SEM (n = 6 for each treatment). *P < 0.000039 versus naive; **P < 0.001 versus NT, (ANOVA; Games-Howell). (B) Effect of P. floribundum (0.1; 1 or 10 mg/kg) on the macroscopic view (first column), histological aspects (second column), and Scanning Electron Microscopy (SEM) (third columm) of periodontium. (a–d) normal maxilla (naive), showing the integrity of its components (C—Cementum; D–Dentin, and AB—Alveolar Bone). (e–h) maxilla from rats subjected to periodontitis and receiving only vehicle (0.9% saline + 0.1% ethanol) presenting severe bone resorption, inflammatory infiltrate in the gingiva and periodontal ligament, extensive destruction of cementum, total resorption of the alveolar process (f), and irregularity in the bone tissue (g—h). (i–l) maxilla from rats subjected to periodontitis and treated with P. floribundum (10 mg/kg) showing discrete cellular influx and preservation of cementum and alveolar process (j) and regular tissue topography (k–l). Black arrows indicate alveolar bone resorption. HE magnification (100x); MEV magnification 65x: c, g, and k; MEV magnification 350x: d, h, and i.

Table 1. Effect of P. floribundum on histopathology (H&E) in the maxilla from rats subjected to periodontitis.

P. floribundum
Naive NT 0.1 1 10
Median and Variation 0 (0–0) 2 (2–3) * 2 (1–3)* 1 (0–2)* 0 (0–1)**
Open in a new tab

*P <0.001 versus naive

**P <0.001 versus non-treated group (NT) (Kruskal-Wallis; post hoc Dunn’s Test).

Also, periodontitis-challenge was associated with a decrease in BALP levels, which was prevented by the P. floribundum (10 mg/kg) injection, when compared with the non-treated group (Fig 1C).

Effect of P. floribundum on MPO activity

A subset of rats was euthanized at the 6th hour for analysis of MPO activity, where it was found a significant increase in MPO activity, when compared to naive group (Fig 2). P. floribundum (10 mg/kg) decreased MPO activity, when compared with to non-treated group (Fig 3).

Fig 2. Effect of P. floribundum on the serum alkaline phosphatase levels.

Fig 2

Open in a new tab

Data represent the mean ± SEM of six animals for each group. *p<0.001 versus naive; **p<0.012 versus non-tretaed (NT) (ANOVA; post hoc Games-Howell).

Fig 3. Effect of P. floribundum (10mg/kg) on gingival myeloperoxidase (MPO) activity.

Fig 3

Open in a new tab

Data are shown as mean ± SEM (n = 6 for each treatment). *P < 0.000023 versus naive; **P < 0.01046 versus non-treated NT, (ANOVA; Tukey).

Periodontitis-challenged group displayed a significant increase in nitrite/nitrate levels (P < 0.05) (Fig 4A). Also, it was found a significant reduction in SOD (P<0.0003) and CAT (P < 0.007) levels, when compared to naive group (Fig 4B and 4C). P. floribundum (10 mg/kg) decreased nitrite/nitrate levels (P < 0.0317) (Fig 4A), and it increased both markers for oxidative stress (SOD and CAT) (P < 0.013 and P < 0.002, respectively) (Fig 4B and 4C), when compared with to non-treated group.

Fig 4.

Fig 4

Open in a new tab

(A) Effect of P. floribundum (10mg/kg) on gingival nitrite/nitrate levels (NOx). Data are shown as mean ± SEM (n = 6 for each treatment). *P < 0. 0015 versus naive; **P < 0. 0317 versus non-treated (NT) (ANOVA; Tukey). (B) Effect of P. floribundum (10mg/kg) on gingival SOD (B) and CAT (C) levels. Data are shown as mean ± SEM (n = 6 for each treatment). * P < 0.0003 versus naive; ** p< 0.013 versus NT (ANOVA; Tukey). *P < 0.007 versus naive; **P < 0.002 versus non-treated (NT) (ANOVA; Games-Howell).

Effects of P. floribundum on both cytokines and PGE2 levels

Periodontits-challenge was associated with increased levels of TNF-α (P < 0.00001), IL-1β (P < 0.000001), and IL-8/CINC-1 (P < 0.017), when compared to the naive group (Fig 5A–5C). Still, it was observed a significant (P < 0.01) decrease in gingival levels of IL-10, when compared to naive group (Fig 5D). Also, it was found significantly (P<0.0001) higher gingival PGE-2 levels in non-treated rats, when compared to the naive group. P. floribundum (10 mg/kg) injection decreased the levels of both proinflammatory cytokines and PGE2, and increased IL-10 levels (Fig 5E).

Fig 5.

Fig 5

Open in a new tab

Effects of P. floribundum on TNF-α (A), IL-1β (B), IL-8/CINC-1 (C), IL-10 (D), and PGE2 levels in gingival tissues. Data are shown as mean ± SEM (n = 6 for each treatment). *P < 0.00001 versus Naive and **P < 0.001 versus NT for TNF-α; *P < 0.017 versus Naive and **P < 0.05 versus NT for IL-8; *P < 0.000001 versus Naive and **P < 0.0000001 versus NT for IL-1β; *P < 0.000 versus Naive and **P < 0.004 versus NT for PGE2; *P < 0,01 versus Naive and **P < 0.02 versus NT for IL-10 (ANOVA; Games-Howell; post hoc Tukey).

Effects of P. floribundum on the mRNA levels of TNF-α, IL-1β, COX-2, iNOS, RANK, and RANK-L

Periodontitis-challenged group expressed a significant increase in the mRNA levels of TNF-α (P<0.001), IL-1β (P<0.0000001), COX-2 (P<0.000004), iNOS (p< 0.007), RANK (P<0.036), and RANK-L (P<0.05), when compared to naive group (Fig 6A–6F). P. floribundum (10 mg/kg) injection significantly reduced the mRNA levels of TNF-α, IL-1β, COX-2, iNOS, RANK (P<0.036), and RANK-L, when compared to the vehicle group (P < 0.001; P < 0.0000001; P < 0.000004; P < 0.001; P < 0.039; and P < 0.036, respectively) (Fig 6A–6F).

Fig 6. Effect of P. floribundum (10mg/kg) on the mRNA levels of TNF-α, IL-1β, COX-2, iNOS, RANK, and RANK-L in gingival tissues from rats subjected to periodontitis.

Fig 6

Open in a new tab

Data are shown as mean ± SEM (n = 6 for each treatment). A. * P < 0.001 versus Naive; **P < 0.001 versus NT. B. *P < 0.0000001 versus Naive; **P < 0.0000001 versus NT. C. * P < 0.000004 versus Naive; **P < 0.000004 versus NT. D. * P < 0.007 versus Naive; ** P < 0.001 versus NT. E. *P < 0.036 versus Naive; ** P < 0.039 versus NT. F. * P < 0.05 versus Naive; ** P < 0.036 versus NT (ANOVA; Tukey; Games-Howell, respectively).

Evaluation of P. floribundum toxicity

During the 11 days of treatment with P. floribundum the animals do not showed any signs of toxicity or mortality. The serum levels of Total Alkaline Phosphatase (TALP), creatinine, as well as serum levels of liver enzymes (AST and ALT) were unchanged, when compared to non-treated animals (Table 2).

Table 2. Evaluation of treatment with P. floribundum on biochemical parameters in rats submitted to induction of periodontitis.

P. floribundum
Parameters Naive NT 0.1 1 10
Total Alkaline Phosphatase 87.86 ± 9.79 84.54 ± 6.62 87.30 ± 7.40 64.93 ± 4.32 65.60 ± 4.96
Creatinine 11.56 ± 0.26 12.73 ± 0.55 12.60 ± 0.67 13.60 ± 0.24 13.72 ± 0.68
AST (U/I) 114.4 ± 7.262 123.8 ± 7.667 103.6 ± 3.125 99.93 ± 4.581 102.2 ±2.615
ALT (U/I) 38.67 ± 2.539 33.46 ± 0.8512 40.00 ± 3.36 37.50 ± 2.61 38.38 ± 1.840
Open in a new tab

Data represent the mean ± S.E.M. (ANOVA; Tukey's).

The histopathological analysis of the liver and kidney from animals treated with P. floribundum (10 mg/kg) depicted reversible and harmless changes, including: mild cellular swelling, few haemorrhagic areas, and areas of discrete congestion (Fig 7D and 7F), when compared to the vehicle treated group. However, all these histological changes are considered reversible. The heart and gastric mucosa of the animals did not show any histopathological changes (Fig 7B–7H).

Fig 7. Photomicrographs of organs from rats subjected to periodontitis and treated with P. floribundum (10mg/kg).

Fig 7

Open in a new tab

(A) Heart, (C) Liver, (E) Kidney, and (G) Stomach from non-treated (NT) group (rats receiving only vehicle). (B) Heart, (D) Liver, (F) Kidney, and (H) Stomach from rats treated P. floribundum (10mg/kg). Black circles indicate cellular swelling, few hemorrhagic areas (D), areas of discrete congestion (F). Magnification 100x.

Discussion

Herein we have demonstrated the anti-inflammatory and anti-resorptive effect of P. floribundum in a ligature-induced periodontitis in rats. In this study P. floribundum (10 mg/kg) reduced alveolar bone loss and increased the serum levels of BALP, an isoenzyme of alkaline phosphatase considered a marker of bone formation. Furthermore, P. floribundum (10mg/kg) decreased MPO activity, TNF-α, IL1-β, IL-8/CINC-1, and PGE2 gingival levels, oxidative stress, and transcription of TNF-α, IL1-β, COX-2, iNOS, RANK and RANKL genes, while elevated IL-10 gingival levels. Additional, the animals did not show signs of toxicity throughout the experimental course.

Several species of Fabaceae family shows pharmacological activities, thus being a promising source of new bioactive products. Many of these plants are used in popular medicine showing effects such as expectorant, analgesic, treatment of asthma and abdominal pain [17–18]. Although P. floribundum is popularly used as an anti-inflammatory [19], the literature has few studies concerning its mechanism of action. In this regard, phytochemical investigations demonstrated the induction of apoptosis by flavonoids from P. floribundum in HL-60 human leukemia cells [6]. Further, it was reported P. floribundum antifungal, DNA-damaging and anticholinesterasic activities [7]. The use of natural products in the management of periodontitis still lacks preclinical and clinical studies that can prove its efficacy and safety. P. floribundum was chosen to be studied because it has been used in the Brazilian Northeast in folk medicine as an anti-inflammatory agent and no previous pharmacology study was reported yet. Indeeed, the present study is the first demonstration of both efficacy and safety of P. floribundum as anti-inflammatory agent.

BALP has been implicated in bone formation [20]. In the present study, P. floribundum (10 mg/kg) increased serum levels of BALP, which suggests that it may promote bone formation and prevent alveolar bone loss. P. floribundum have some secondary metabolites such as flavonoids, isoflavones, and coumarins [7], and some authors have shown that these metabolites are able to decrease inflammatory mediators during bone resorption [21].

MPO activity was used as a marker of inflammatory cell infiltrates (especially neutrophils) in the inflamed periodontium. According to Palm et al. [22], MPO may be used as a biomarker of periodontitis and high saliva MPO concentrations may suggest periodontal tissue destruction. In the present study, periodontitis-challenge was associated with a significant increase in MPO activity. P. floribundum (10 mg/kg) decreased MPO acivity, suggesting that the efficacy of P. floribundum may be associated with reduction of neutrophil influx.

The periodontitis-associated microbiota can activate resident and recruited inflammatory cells to secrete proinflammatory cytokines/chemokines, which stimulate bone resorption by stimulating the activity of osteoclasts [23]. Indeed, these cytokines increase the recruitment and activity of these cells through improved production of a key osteoclastogenic factor, the Receptor Activator of Nuclear Factor κ B Ligand (RANK-L) and favor bone damage [2]. Also, some authors have suggested the potential involvement of both pro- and anti-inflammatory cytokines in the regulation of the chronic inflammatory periodontitis. In fact, our research group recently showed that ligature-induced periodontitis in rats was related to a significant decrease in gingival levels of IL-10, an anti-inflammatory cytokine [24] In the preset study, P. floribundum (10mg/kg) decreased TNF-α, IL1-β, and IL-8/CINC-1 gingival levels and transcription of TNF-α, IL1-β, RANK and RANKL genes, while elevated IL-10 gingival levels, which suggestes that the protective effect of P. floribundum may be related to the modulation of both pro- and anti-inflammatory cytokines levels in gingival tissue.

The biosynthesis of PGE2 is close related to pro-inflammatory cytokines activity. Some authors showed that the biosynthesis of PGE2 is increased in inflamed gingiva and this synthesis is enhanced by pro-inflammatory cytokines (TNF-α, IL-1β), creating a vicious circle in states of inflammatory osteolysis, promoting alveolar bone loss [2]. Sánchezz et al. [25] suggested the salivary levels of both IL-1β and PGE2 as biomarkers of periodontal status. Our research group recently demonstrated that periodontitis-challenge in rats is associated with both high gingival PGE-2 levels and increased periodontal immunostaining for its processing enzyme COX-2 [26]. In the present study, we demonstrated that ligature-induced periodontitis rats expressed a significant increase in the mRNA of COX-2. P. floribundum reduced both PGE2 levels and the transcription of COX-2 genes in inflamed gingival tissues, which suggests that its antiresorptive effects are, at least in part, related to inhibition of COX-2.

Both preclinical and clinical trials support the hypothesis that the inhibition of prostaglandins with nonsteroidal anti-inflammatory drugs (NSAIDs) slows periodontitis progression [27]. Once selective COX-2 inhibitors had a better risk-benefit ratio than the standard NSAIDs, we performed the histophatological analysis of the gastric mucosa of P. floribundum treated-rats, which showed no evidence of macroscopic and microscope alterations. Our present data is significant considering that gastric mucosal damage is a common side effect of NSAIDs.

Since NO has been shown to have dual effects during inflammatory processes, it would not be different in the periodontitis. While some authors suggested that NO plays an important role in the destruction of periodontal tissues [28], Martins et al. [29] demonstrated that NO donors decreased inflammation and bone loss in a model of periodontits in rats. Pro-inflammatory cytokines participate in the amplification of the inflammatory response during periodontitis disease by the transcription of the inducible nitric oxide synthase (iNOS) that results in the production of high amounts of NO [30] In the present study, periodontitis-challenged rats displayed a significant increase in nitrite/nitrate levels and expressed a significant increase in the mRNA of iNOS in gingival tissue, which was reduced by the treatment with P. floribundum (10 mg/kg).

In order to keep the ROS levels in a normal range, enzymatic mechanisms such as SOD and CAT are activated continuously. Here we demonstrated that rats with periodontitis showed a significant reduction in both SOD and CAT levels, when compared to naive rats. P. floribundum increased both markers for oxidative stress. These data are in accordance with previous results of our group showing the antioxidant effect of natural extracts from Stemodia maritima L. and Calendula offinalis [24], [31]

Considering the growing interest in natural products, research concerning not only the efficacy but also the toxicity profile of these products is very encouraged [32–33]. Hence, in the present study, we performed biochemical analysis in peripheral blood from rats 11 days after daily injection of P. floribundum. Further, we evaluated the integrity (H&E) of heart, liver and kidneys from rats that received P. floribundum. Neither biochemical analysis nor the histopathological ones revealed any signs of toxicity.

In conclusion, P. floribundum reduces inflammatory markers associated with periodontitis, such as bone loss, pro-inflammatory cytokines, and oxidative stress. Our findings suggest that this natural product-based, may act in different pathways involved in inflammatory process during periodontitis. Thus, P. floribundum may offer a huge of possibilities for planning a supportive periodontal therapy, being promising to the oral health care industry.

Supporting information

S1 Dataset. Dataset from Fig 1.

(RAR)

Click here for additional data file. (49.4KB, rar)
S2 Dataset. Data set from Fig 2.

(RAR)

Click here for additional data file. (56.1KB, rar)
S3 Dataset. Dataset from Fig 3.

(RAR)

Click here for additional data file. (36.6KB, rar)
S4 Dataset. Dataset from Fig 4.

(RAR)

Click here for additional data file. (256.1KB, rar)
S5 Dataset. Dataset from Fig 5.

(RAR)

Click here for additional data file. (994.3KB, rar)
S6 Dataset. Dataset from Fig 6.

(RAR)

Click here for additional data file. (1,009.6KB, rar)
S7 Dataset. Dataset from Table 1.

(PZF)

Click here for additional data file. (227.9KB, pzf)
S8 Dataset. Dataset from Table 2.

(PZF)

Click here for additional data file. (1.1MB, pzf)

Acknowledgments

The authors thank Anderson Weiny Barbalho Silva and Alana Nogueira Godinho for excellent technical support. We also gratefully thank the Analylitc Central of Federal University of Ceará, Ceará, Brazil, for SEM analysis.

Data Availability

All relevant data are within the manuscript and Supporting Information files.

Funding Statement

This work was supported by Brazilian grants from Conselho Nacional de Pesquisa (CNPq) (grant #471974/2013-7), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes) and Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico (Funcap) (Capes/Funcap grant # AE1-0052- 000180100/2011), and Instituto de Biomedicina do Semi-Árido Brasileiro (INCT-IBISAB). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Hajishengallis G. The inflammophilic character of the periodontitis‐associated microbiota. Mol Oral Microbiol. 2014; 29 (6): 248–257. 10.1111/omi.12065 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Trindade F, Oppenheim FG, Helmerhorst EJ, Amado F, Gomes PS, Vitorino R. Uncovering the molecular networks in periodontitis. Proteomics Clin Appl. 2014; 8 (9–10): 748–761. 10.1002/prca.201400028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sukhtankar L, Kulloli A, Kathariya R, Shetty S. Effect of non-surgical periodontal therapy on superoxide dismutase levels in gingival tissues of chronic periodontitis patients: A clinical and spectophotometric analysis. Dis Markers. 2013; 34 (5): 305–311. 10.3233/DMA-130978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Uslu MÖ, Eltas A, Marakoğlu İ, Dündar S, Şahin K., Özercan İ H. Effects of diode laser application on inflammation and mpo in periodontal tissues in a rat model. J Appl Oral Sci. 2018; 26 (0): e20170266 10.1590/1678-7757-2017-0266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Buommino E, Scognamiglio M, Donnarumma G, Fiorent A. Recent advances in natural product-based anti-biofilm approaches to control infections. Mini Rev Med Chem. 2014; 14 (14): 1169–1182. 10.2174/1389557515666150101095853 [DOI] [PubMed] [Google Scholar]
  • 6.Militão GCG, Dantas INF, Pessoa C, Falcão MJC, Silveira ER, Curi R, et al. Induction of apoptosis by pterocarpans from Platymiscium floribundum in HL-60 human leukemia cells. Life Sci. 2006; 78 (20): 2409–2417. 10.1016/j.lfs.2005.09.044 [DOI] [PubMed] [Google Scholar]
  • 7.Cardoso-Lopes EM, Carreira RC, Agripino DG, Torres LMB, Cordeiro I, Bolzani VS, et al. Screening for antifungal, DNA-damaging and anticholinesterasic activities of Brazilian plants from the Atlantic Rainforest: Ilha do Cardoso State Park. Rev. Bras. Farmacogn. 2008; 18: 655–660. [Google Scholar]
  • 8.Veloso PA, Pimenta ATA, De Sousa FM, Falcão MJC, Gramosa NV, Da Silva JR, et al. New flavonoids and coumarins from Platymiscium floribundum Vogel. J. Braz. Chem. Soc. 2012; 23 (7): 1239–1243. 10.1590/S0103-50532012000700007 [DOI] [Google Scholar]
  • 9.Bezerra MM, De Lima V, Alencar VB, Vieira IB, Brito GAC, Ribeiro RA, et al. Selective Cyclooxygenase-2 Inhibition Prevents Alveolar Bone Loss. J Periodontol. 2000; 71(6): 1009–1014. 10.1902/jop.2000.71.6.1009 [DOI] [PubMed] [Google Scholar]
  • 10.Kuhr A, Popa-Wagner A, Schmoll H, Schwahn C, Kocher T. Observations on experimental marginal periodontitis in rats. J Periodontal Res. 2004; 39 (2): 101–106. 10.1111/j.1600-0765.2004.00710.x [DOI] [PubMed] [Google Scholar]
  • 11.Whitby LG, Moss DW. Analysis of heat inactivation curves of alkaline phosphatase isoenzymes in serum. Clin Chim Acta. 1975; 59: 361–367 10.1016/0009-8981(75)90012-1 [DOI] [PubMed] [Google Scholar]
  • 12.Bradley PP, Christensen RD, Rothstein G. Cellular and extracellular myeloperoxidase in pyogenic inflammation. Blood. 1982; 60 (3): 618–622. [PubMed] [Google Scholar]
  • 13.Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol. 1988; 141(7): 2407–2412. [PubMed] [Google Scholar]
  • 14.Beauchamp C, Fridovich I. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem. 1971; 44 (1): 276–287. 10.1016/0003-2697(71)90370-8 [DOI] [PubMed] [Google Scholar]
  • 15.Maehly AC. The assay of catalases and peroxidases. Methods Biochem Anal. 1954; 1(0): 357–424. [DOI] [PubMed] [Google Scholar]
  • 16.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25: 402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 17.La VD, Tanabe S, Bergeron C, Gafner S, Grenier D. Modulation of matrix metalloproteinase and cytokine production by licorice isolates licoricidin and licorisoflavan A: potential therapeutic approach for periodontitis. J Periodontol. 2011; 82 (1): 122–128. 10.1902/jop.2010.100342 [DOI] [PubMed] [Google Scholar]
  • 18.Messier C, Epifano F, Genovese S, Grenier D. Licorice and its potential beneficial effects in common oro‐dental diseases. Oral Dis. 2012; 18 (1): 32–39. 10.1111/j.1601-0825.2011.01842.x [DOI] [PubMed] [Google Scholar]
  • 19.Falcão MJC, Pouliquem YBM, Lima MAS, Gramosa NV, Costa-Lotufo LV, Militão GCG, et al. Cytotoxic flavonoids from Platymiscium floribundum. J Nat Prod. 2005; 68 (3): 423–426. 10.1021/np049854d [DOI] [PubMed] [Google Scholar]
  • 20.Whyte MP. Physiological role of alkaline phosphatase explored in hypophosphatasia. Ann N Y Acad Sci. 2010; 1192 (1): 190–200. 10.1111/j.1749-6632.2010.05387.x [DOI] [PubMed] [Google Scholar]
  • 21.Chang PC, Chao YC, Hsiao MH, Chou HS, Jheng YH, Yu XH, et al. Inhibition of Periodontitis Induction Using a Stimuli‐Responsive Hydrogel Carrying Naringin. J Periodontol. 2017; 88 (2): 190–196. 10.1902/jop.2016.160189 [DOI] [PubMed] [Google Scholar]
  • 22.Palm F, Lahdentausta L, SORSA T, Tervahartiala T, Gokel P, Buggle F, et al. Biomarkers of periodontitis and inflammation in ischemic stroke: A case-control study. Innate Immun. 2014; 20 (5): 511–518. 10.1177/1753425913501214 [DOI] [PubMed] [Google Scholar]
  • 23.Belibasakis GN, Bostanci N. The RANKL-OPG system in clinical periodontology. J Clin Periodontol. 2012; 39 (3): 239–248. 10.1111/j.1600-051X.2011.01810.x [DOI] [PubMed] [Google Scholar]
  • 24.Teixeira AH, Freire JM, de Sousa LH, Parente AT, de Sousa NA, Arriaga A, et al. Stemodia maritima L. extract decreases inflammation, oxidative stress, and alveolar bone loss in an experimental periodontitis rat model. Front Physiol. 2017; 8 (1): 988 10.3389/fphys.2017.00988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sánchez GA, Miozza VA, Delgado A, Busch L. Salivary IL‐1β and PGE 2 as biomarkers of periodontal status, before and after periodontal treatment. J Clin Periodontol. 2013; 40 (12): 1112–1117. 10.1111/jcpe.12164 [DOI] [PubMed] [Google Scholar]
  • 26.Ribeiro DDSF, de Oliveira Freire JM, Teixeira AH, do Val DR, de Freitas AR, Gomes FI, et al. Tocoyena sellowiana extract decreases bone loss in an experimental model of periodontitis in rats: Putative role for cyclooxygenase-2 and IL-1β inhibition. Biomed Pharmacother. 2018; 98 (1): 863–872. 10.1016/j.biopha.2018.01.011 [DOI] [PubMed] [Google Scholar]
  • 27.Azoubel MCF, Sarmento VA, Cangussu V, Azoubel E, Bittencourt S, Cunha FQ, et al. Adjunctive benefits of systemic etoricoxib in non-surgical treatment of aggressive periodontitis: short-term evaluation. J Periodontol. 2008; 79 (9):1719–1725. 10.1902/jop.2008.080019 [DOI] [PubMed] [Google Scholar]
  • 28.Sundar NM, Krishnan V, Krishnaraj S, Hemalatha VT, Alam MN. Comparison of the salivary and the serum nitric oxide levels in chronic and aggressive periodontitis: a biochemical study. J Clin Diagn Res. 2013; 7 (6): 1223 10.7860/JCDR/2013/5386.3068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Martins CS, Leitão RF, Costa DV, Melo IM, Santos GS, Lima V, et al. Topical HPMC/S-nitrosoglutathione solution decreases inflammation and bone resorption in experimental periodontal disease in rats. PLoS One. 2016; 11(4): e0153716 10.1371/journal.pone.0153716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Van't Hof RJ, Ralston SH. Nitric oxide and bone. Immunology. 2001; 103 (3): 255–261. 10.1046/j.1365-2567.2001.01261.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Alexandre JTM, Sousa LHT, Lisboa MRP, Furlaneto FA, do Val DR, Marques M, et al. Anti-inflammatory and antiresorptive effects of Calendula officinalis on inflammatory bone loss in rats. Clin Oral Investig. 2018; 22(6): 2175–2185. 10.1007/s00784-017-2308-7 [DOI] [PubMed] [Google Scholar]
  • 32.Val DR, Bezerra MM, Silva AA, Pereira KM, Rios LC, Lemos JC, et al. Tephrosia toxicaria Pers. reduces temporomandibular joint inflammatory hypernociception: The involvement of the HO-1 pathway. Eur J Pain. 2014; 18 (9): 1280–1289. 10.1002/j.1532-2149.2014.488.x [DOI] [PubMed] [Google Scholar]
  • 33.Varela-López A, Bullón P, Giampieri F, Quiles J. Non-nutrient, naturally occurring phenolic compounds with antioxidant activity for the prevention and treatment of periodontal diseases. Antioxidants (Basel). 2015; 4 (3): 447–481. 10.3390/antiox4030447 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Sakamuri V Reddy

5 Aug 2019

PONE-D-19-17659

Protective effect of the extract from Platymiscium floribundum Vogin a pre-clinical trial of periodontitis in rats is based on its anti-resorptive, antioxidant, and anti-inflammatory properties

PLOS ONE

Dear Dra Freire,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

ACADEMIC EDITOR: The manuscript is reviewed at the editorial level and by an expert reviewer. Though, they have identified the significance of the study, however suggested several changes to the manuscript content to improve the presentation quality.  The authors should show bone loss in periodontitis and treatment conditions clearly. Additional editor remarks and comments from a reviewer are noted below for authors response carefully for further consideration.

We would appreciate receiving your revised manuscript by Sep 19 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Dr. Sakamuri V. Reddy

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Additional Editor Comments (if provided):

The authors demonstrated protective effect of the extract from a tree P. floribundum Vog reduced inflammatory markers of periodontitis in rats including bone loss, cytokines, antioxidant and oxidative stress implicating the use in periodontal therapy. Title: please rephrase the title as “Protective effect of Platymiscium floribundum Vogin tree extract on periodontitis inflammation in rats”. Short title: “Effects of P. floribundum extract on periodontitis in rats”. Abstract-simplify introduction and methodology described; revise the conclusion sentence: “…..associated with periodontitis.” Methods-(122) Revises the subtitles: Determination of bone remodeling (line 150) SOD and CAT activity assessment. Fig.1B-Effect of P. floribundum (0.1; 1 or 10 mg/kg) on the macroscopic view (first column), histological aspects (second column, and Scanning Electron Microscopy (SEM) (third columm) of periodontiumlabel the panels. I suggest the authors to label the Fig.1B panels and show by arrows the bone loss observed under periodontitis condition and treatment conditions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Although the manuscript is interesting in the inhibitory effects of the extracts from Platymiscium Floribundum Vogin on periodontitis there are serious problems. The authors should be addressing them.

1) The paper indicated that the tree extract inhibited the inflammation and alveolar bone resorption. However, it is unclear how the inhibitory mechanism on bone resorption is. Is the extract directly or indirectly osteoclasts or osteoblasts? If the extract is mediated by anti-inflammation and resulting in the bone resorbing inhibition what cytokine is mainly inhibition? The authors should be speculated the inhibitory mechanism in discussion section in according to the known mechanism of the extract on anti-inflammation.

2) The authors should try to use the combination of some inhibitors or neutralized antibodies such as COX2 inhibitor, NOS inhibitor or anti-TNFalpha antibody with the extract in periodontitis model animal

3) p18, line297: Is FAT correct, not but TALP?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2019 Nov 4;14(11):e0223800. doi: 10.1371/journal.pone.0223800.r002

Author response to Decision Letter 0

16 Sep 2019

To Dr. Sakamuri V. Reddy

Academic Editor

PLOS ONE

September 14th, 2019

Subject: Manuscript Reference Number: PONE-D-19-17659

Dear Dr. Sakamuri V. Reddy,

Thank you very much for your letter with the reviewers’ comments on the manuscript mentioned above.

We tried to address all the comments raised and we really hope that our answers will clarify these points. The reviewers' comments are reproduced in BLACK; our responses are detailed below in BLUE.

We are grateful for your help in improving the quality of our study and we hope that this revised version of the manuscript is suitable for acceptance in PLOS ONE.

Yours sincerely,

Mirna Marques Bezerra

Author to Correspondence

Manuscript Reference Number: PONE-D-19-17659

Additional Editor Comments

The authors demonstrated protective effect of the extract from a tree P. floribundum Vog reduced inflammatory markers of periodontitis in rats including bone loss, cytokines, antioxidant and oxidative stress implicating the use in periodontal therapy.

Title: please rephrase the title as “Protective effect of Platymiscium floribundum Vog in tree extract on periodontitis inflammation in rats”.

ANSWER: The title was rephrased. Please, see the revised version of the manuscript with tracked changes.

Short title: “Effects of P. floribundum extract on periodontitis in rats”.

ANSWER: The short title was rephrased. Please, see the revised version of the manuscript with tracked changes.

Abstract - simplify introduction and methodology described.

ANSWER: The introduction and methodology described in the Abstract were simplified. Please, see the revised version of the manuscript with tracked changes.

Revise the conclusion sentence: “…..associated with periodontitis.”

ANSWER: The conclusion sentence was revised. Please, see the revised version of the manuscript with tracked changes (lines 475-476).

Methods - (122) Revises the subtitles: Determination of bone remodeling (line 150) SOD and CAT activity assessment.

ANSWER: The subtitles were revised: Determination of bone remodeling (line 172); SOD and CAT activity assessment (line 200).

Fig.1B - Effect of P. floribundum (0.1; 1 or 10 mg/kg) on the macroscopic view (first column), histological aspects (second column, and Scanning Electron Microscopy (SEM) (third columm) of periodontium label the panels. I suggest the authors to label the Fig.1B panels and show by arrows the bone loss observed under periodontitis condition and treatment conditions.

ANSWER: Fig. 1B panels are labeled and we show with black arrows the bone loss observed under periodontitis condition and treatment conditions (Please, see the revised version of the manuscript with tracked changes).

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Although the manuscript is interesting in the inhibitory effects of the extracts from Platymiscium Floribundum Vog in on periodontitis there are serious problems. The authors should be addressing them.

ANSWER: We really appreciate the interest of the reviewer in our data. We tried to address all the comments raised.

1) The paper indicated that the tree extract inhibited the inflammation and alveolar bone resorption. However, it is unclear how the inhibitory mechanism on bone resorption is. Is the extract directly or indirectly osteoclasts or osteoblasts? If the extract is mediated by anti-inflammation and resulting in the bone resorbing inhibition what cytokine is mainly inhibition? The authors should be speculated the inhibitory mechanism in discussion section in according to the known mechanism of the extract on anti-inflammation.

ANSWER: In order to make our answer clear enough we will answer this question considering the three issues raised by the Reviewer #1, as follows:

(A) Is the extract directly or indirectly osteoclasts or osteoblasts?

(B) If the extract is mediated by anti-inflammation and resulting in the bone resorbing inhibition what cytokine is mainly inhibition?

(C) The authors should be speculated the inhibitory mechanism in discussion section in according to the known mechanism of the extract on anti-inflammation.

(A) Is the extract directly or indirectly osteoclasts or osteoblasts?

ANSWER: It has been shown that in the bone remodeling cycle, bone formation is coupled with bone resorption to maintain the bone health (Florencio-Silva et al., Biomed Res Int. (2015) 2015:421746). The success of this process involves a complex cross-talk between bone cells (osteoblasts and osteoclasts) and immune system cells (T lymphocytes, macrophages, and neutrophils) (Dar HY et al., Front. Biosci. (Landmark Ed). (2018) 23:464-492). During bone loss diseases, such as periodontitis, inflammation promotes a disruption in the balance between bone formation/bone degradation in towards of resorption (Hienz et al., J Immunol Res. 2015; 2015:615486). In response to inflammation-induced bone loss, neutrophils are usually the first cell type migrating to damage sites. Activated neutrophils can secrete a plethora of inflammatory mediators, such as, chemokines, cytokines, reactive oxygen species, prostaglandins, and small molecules (nitric oxide), which are able to act as immunomodulatory factors, then amplifying the inflammatory response, leading to the occurrence of bone loss (Amarasekara et al., J Immunol Res. (2015) 2015:832127; Domazetovic et al., Clin Cases Miner Bone Metab. (2017) 14(2): 209-216; Lisowska et al., Drug Des Devel Ther. (2018) 12:1753-1758; Kalyanaraman et al., Nitric Oxide. (2018) 76:62-70). On the other hand, anti-inflammatory agents, such as, P. floribundum may positively disturb this process in favour of bone formation, which may be beneficial during bone disorders related to inflammation, suggesting its use as a potential bone-protecting agent.

In the present study we tried to understand the underlying mechanisms of the anti-inflammatory action of P. floribundum by using an in vivo system to assess both soft and hard tissue destruction. Our research group has shown in last years that the inflammation-induced bone loss during periodontitis in rats is a complex process, which involves many players (Freitas, et al., Biomedicine & pharmacotherapy (2018) 98:863-872; Teixeira et al., Frontiers in Physiology (2017) 8:988; Sousa et al., Journal of Periodontology (2016) 87:1206-1216). Indeed, in the present study P. floribundum reduced bone loss and this action was due to its broad anti-inflammatory action including decreased MPO activity, TNF-α, IL1-β, IL-8/CINC-1, and PGE2 gingival levels, oxidative stress, and transcription of TNF-α, IL1-β, COX-2, iNOS, RANK and RANKL genes, while increasing both IL-10 gingival levels and bone alkaline phosphatase (BALP) serum levels. Considering our current data we can speculate that the inhibitory mechanism on bone resorption promoted by P. floribundum in the present study may be indirectly on both bone cells (osteoclasts and osteoblasts), and it might be related to the anti-inflammatory action of P. floribundum, including: reducing of both neutrophils infiltrate (evaluated by the levels of MPO), and the amount of pro-inflammatory mediators, while increasing the synthesis of IL-10, an anti-inflammatory cytokine.

Therefore, understanding the communication between the immune systems and the skeletal is important for the discovery and development of novel anti-reabsortive drugs and it will clarify the known signal transduction pathways.

(B) If the extract is mediated by anti-inflammation and resulting in the bone resorbing inhibition what cytokine is mainly inhibition?

The network of inflammatory cytokines produced during inflammation induces an uncoupling of bone formation and resorption, resulting in significant bone loss (Amarasekara et al., J Immunol Res. (2015) 2015:832127). Ferreira et al (1993) (Br J Pharmacol. 110(3):1227-31) developed the concept that, in rats, inflammatory stimuli cause mechanical hypernociception by a well-defined sequential release of cytokines. These authors showed that among cytokines, TNF-α has a pivotal role in the development of inflammatory hyperalgesia. Indeed, the first cytokine released is TNF-α, which triggers the release of IL-6/IL-1β and cytokine-induced neutrophil chemoattractant-1 (CINC-1) (human IL-8-related chemokine), which is responsible for stimulation of the synthesis of prostaglandins (Cunha et al., Br. J. Pharmacol. (1991) 104: 765–767; Cunha et al., Br. J. Pharmacol. (1992) 107: 660–664; Lorenzetti et al., Eur. Cytokine Network (2002)13: 456–461).

During periodontitis cytokine involvement is well known, and these molecules, particularly tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) may amplify the inflammatory response, causing tissue destruction and bone loss. TNF-α and IL-1β are the first to appear in periodontitis pathways and they are associated with inflammatory cell migration (Hoare et al., Mediators Inflamm. (2019) 2019:1029857). Also, the release of TNF-α and IL-1β during periodontitis activates osteoblasts and osteoclasts to produce COX2-mediated prostaglandin E2 (PGE2), triggering bone resorption (Yu et al., J Periodontal Res. (2016) 51(1):38-49). Further, preclinical and clinical trials have proven the protective effect of both TNF-α and IL-1β inhibitors on periodontitis (Lima et al., J. Periodontol. (2004) 75: 156–162; Holmlund et al., J Clin. Periodontol. (2004) 31: 475–482). Therefore, the inhibition of cytokine production or action appears to constitute a real target for a new therapeutic approach to control the inflammatory bone diseases such as periodontitis.

Thus, considering the previous data showing the central role of TNF-α during inflammatory response by activating the cascade of cytokine release, which consequently amplifies the degree of inflammation, and its involvement during periodontitis, we may speculate that TNF-α could be the main cytokine involved in the anti-inflammatory efficacy of P. floribundum.

(C) The authors should be speculated the inhibitory mechanism in discussion section in according to the known mechanism of the extract on anti-inflammation.

Answer: Although P. floribundum is popularly used as an anti-inflammatory [19], the literature has few studies concerning its mechanism of action. In this regard, phytochemical investigations demonstrated the induction of apoptosis by flavonoids from P. floribundum in HL-60 human leukemia cells (reference number 6 - Militão et al., Life Sci. (2006); 78 (20): 2409-2417). Further, it was reported P. floribundum antifungal, DNA-damaging and anticholinesterasic activities (reference number 7 - Cardoso-Lopes Rev. Bras. Farmacogn. 2008; 18: 655-660). The use of natural products in the management of periodontitis still lacks preclinical and clinical studies that can prove its efficacy and safety. P. floribundum was chosen to be studied because it has been used in the Brazilian Northeast in folk medicine as an anti-inflammatory agent and no previous pharmacology study was reported yet. Indeed, the present study is the first demonstration of both efficacy and safety of P. floribundum as an anti-inflammatory agent. In keeping with this assumption, we included a sentence in the discussion section mentioning this issue (Please, see the revised version of the manuscript with tracked changes, lines 391-405).

2) The authors should try to use the combination of some inhibitors or neutralized antibodies such as COX2 inhibitor, NOS inhibitor or anti-TNFalpha antibody with the extract in periodontitis model animal.

ANSWER: We really appreciate the interest of the reviewer in our protocol elaboration. The main idea of our research group is to develop a natural product, which may provide a better risk/benefit ratio in the treatment of periodontitis. Herein, we carefully draw a suggestion that P. floribundum has a regulatory role in inflammation-induced bone loss during periodontitis, reducing the main inflammatory mediators that orchestrates bone loss. Indeed, P. floribundum decreased TNF-α and PGE2 gingival levels, and transcription of TNF-α, COX-2, and iNOS genes. Therefore, considering these data, and keeping in mind the 3R Principle (Russel and Burch, 1959), which suggests the reduction of the animal numbers whenever possible, we did not consider the possibility of use the combination of some inhibitors or neutralized antibodies such as COX2 inhibitor, NOS inhibitor or anti-TNFalpha antibody with the extract in periodontitis model animal.

3) p18, line 297: Is FAT correct, not but TALP?

ANSWER: The acronym FAT is not correct and it was replaced by the correct acronym TALP. Please, see the revised version of the manuscript with tracked changes (line 349).

Attachment

Submitted filename: Response to reviewers.doc

Click here for additional data file. (64.5KB, doc)

Decision Letter 1

Sakamuri V Reddy

30 Sep 2019

Protective effect of Platymiscium floribundum Vog in tree extract on periodontitis inflammation in rats.

PONE-D-19-17659R1

Dear Dr. Freire,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Dr. Sakamuri V. Reddy

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have almost addressed and revised the pointed-out problems. The reviewer recommend it.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Acceptance letter

Sakamuri V Reddy

23 Oct 2019

PONE-D-19-17659R1

Protective effect of Platymiscium floribundum Vog in tree extract on periodontitis inflammation in rats.

Dear Dr. Freire:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Sakamuri V. Reddy

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Dataset. Dataset from Fig 1.

    (RAR)

    Click here for additional data file. (49.4KB, rar)
    S2 Dataset. Data set from Fig 2.

    (RAR)

    Click here for additional data file. (56.1KB, rar)
    S3 Dataset. Dataset from Fig 3.

    (RAR)

    Click here for additional data file. (36.6KB, rar)
    S4 Dataset. Dataset from Fig 4.

    (RAR)

    Click here for additional data file. (256.1KB, rar)
    S5 Dataset. Dataset from Fig 5.

    (RAR)

    Click here for additional data file. (994.3KB, rar)
    S6 Dataset. Dataset from Fig 6.

    (RAR)

    Click here for additional data file. (1,009.6KB, rar)
    S7 Dataset. Dataset from Table 1.

    (PZF)

    Click here for additional data file. (227.9KB, pzf)
    S8 Dataset. Dataset from Table 2.

    (PZF)

    Click here for additional data file. (1.1MB, pzf)
    Attachment

    Submitted filename: Response to reviewers.doc

    Click here for additional data file. (64.5KB, doc)

    Data Availability Statement

    All relevant data are within the manuscript and Supporting Information files.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES