Abstract
Dengue virus type 1 (DENV-1) Asian and American/African (AM/AF) genotypes were reported to be co-circulating in southern and western states of India based on envelope (E) gene sequencing of few representative samples. The objective of the present study was to develop a one-step real-time RT-PCR to discriminate between Asian and AM/AF genotypes of DENV-1 and investigate the spatio-temporal distribution of the DENV-1 genotypes in southern and western states of India. A one-step real-time RT-PCR to discriminate the Asian and AM/AF genotypes of DENV-1 was developed and validated using 40 samples (17 Asian and 23 AM/AF), for which the envelope (E) gene sequence data was available. DENV-2, DENV-3 and DENV-4 isolates, one each and DENV negative samples (n=17) were also tested by the assay. Additional 296 samples positive for DENV-1 from selected Southern and Western states of India were genotyped using the real-time RT-PCR assay. Among the samples used for validation, the genotyping results were concordant with sequencing results for 39 samples. In the one discordant sample which was positive for AM/AF by sequencing, the genotyping assay tested positive for both Asian and AM/AF genotype. DENV-2, DENV-3 and DENV-4 isolates were not reactive in the assay. None of the DENV negative samples were positive (sensitivity 100% and specificity 98.2%). A total of 336 samples (40 samples with sequence data and 296 samples without sequence data) were used for spatio-temporal distribution analysis. The results revealed that the Asian genotype was the predominant genotype in Tamil Nadu and Kerala, the southern states. The AM/AF genotype was the predominant genotype in Maharashtra, a western state of India. In Nashik district of Maharashtra, Asian genotype was observed in 32.6% of DENV-1 samples during 2017 while the same decreased to 7.3% during 2018. In Pune district, Asian genotype was observed in 40.0% of DENV-1 samples during 2018 only. To conclude, a one step real-time RT-PCR has been developed for discriminating Asian and AM/AF genotypes of DENV-1. This assay can act as a complement to sequencing but not a substitute and can be utilized in resource limited settings as for molecular surveillance of DENV-1. DENV-1 Asian genotype was the dominant genotype in South India while, AM/AF genotype was dominant in Western India.
Keywords: Dengue virus, Asian genotype, American/African genotype, real-time RT-PCR
1. Introduction
Dengue virus (DENV) has four antigenically distinct serotypes (DENV-1 to DENV-4) and each serotype has multiple genotypes. Genotypes within serotypes differ in their fitness and replication potential in mosquitoes and humans [Vu et al., 2010]. Changes in the circulating serotypes of DENV and the genotypes within serotypes have been shown to be associated with the occurrence of major outbreaks/epidemics of DENV [Santiago et al., 2012; Tan et al., 2017; Villar et al., 2015; Saha et al., 2016; Cecilia et al., 2017; Patil et al., 2018]. Despite the observation that homotypic DENV infection is not bound to occur in the same individual again, recurrent outbreaks due to a single serotype are observed in a same geographical region and has been attributed to changes in the circulating genotype/clade of that particular serotype [Teoh et al., 2013; Dupont-Rouzeyrol et al., 2014].
Conventional as well as real-time based reverse transcriptase (RT)-PCR assays are available for serotyping of DENV but not for genotyping [Patil et al., 2018; Santiago et al., 2013]. Sequencing of E gene or C-PrM region or whole genome followed by phylogenetic analysis is generally performed to deduce the circulating genotypes of DENV [Kumar et al., 2010; Patil et al., 2011; Patil et al., 2012; Cecilia et al., 2017; Patil et al., 2018; Santiago et al., 2019]. Since the sequencing of DENV RNA is a time-consuming procedure requiring higher viral load, high quality RNA and is not economical, only a few samples which do not represent the entire outbreak/epidemic from an outbreak are processed for genotyping. This poses a limitation in understanding the role of different genotypes within a serotype in disease severity. When multiple genotypes of DENV serotype are circulating, the spatial and temporal dynamics of different genotypes are not understood completely.
DENV-1 has five genotypes namely Asian (GI), American/African (AM/AF) (GV), South Pacific (GIV), Malaysia (GIII) and Thailand (GII) genotypes (Goncalvez et al., 2002). Among the five genotypes, only Asian, AM/AF and South Pacific genotypes were reported to be circulating worldwide while in India, only Asian and AM/AF were reported to be circulating. Only few sequences of Thailand and Malaysia genotypes are available in the GenBank [Villabona-Arenas et al., 2013; Cecilia et al., 2017; Patil et al; 2018]. DENV-1 has been the dominant serotype during the 2012 epidemic of dengue in Tamil Nadu and still continues to be the dominant even during 2017-2018 [Cecilia et al., 2017; Rose et al., 2019]. DENV-1 dominated 2014-2015 outbreak season in Karnataka, a southern state of India [Ahamed et al., 2019]. In the western region of India, DENV-1 emerged as predominant serotype along with DENV-3 during 2017-2018 [Patil et al., 2018]. DENV-1 AM/AF genotype was the only genotype circulating in India till 2012 while the emergence of DENV-1 Asian genotype was reported in the southern part of India during 2012. Asian genotype was the only observed DENV-1 genotype during 2012 and 2013 in Tamil Nadu and Kerala, southern states of India. In 2015, circulation of both the genotypes of DENV-1 was reported in the southern states [Cecilia et al., 2017; Ahamed et al., 2019; Pooja et al., 2017]. DENV-1 Asian genotype was first detected in the western region of India during 2017 and was co-circulating with AM/AF genotype [Patil et al., 2011, Patil et al., 2018].
Based on the limited sequences available from these studies, it is not possible to find out the dominant circulating genotype of DENV-1 and hence, the molecular epidemiology of DENV representing a complete outbreak is not usually understood. Hence, in the present study, a one-step real-time RT-PCR for discrimination of two genotypes of DENV-1 circulating in India (Asian and AM/AF) was developed, validated with known isolates and samples and used for investigating spatio-temporal dynamics and dominance of Asian and AM/AF genotypes in Western and Southern states of India.
2. Samples and Methods
2.1. Virus isolates and clinical samples
DENV-1 isolates/clinical samples with E gene sequence data obtained during different years from Western and Southern India available (n= 40) in the Dengue/Chikungunya Group, ICMR-National Institute of Virology were used for the valiadation of the one step real time RT-PCR assay. Among the 40 samples, 19 were sequenced during the current study. Virus isolates one each belonging to other serotypes (DENV-2, DENV-3 and DENV-4) and DENV negative clinical samples (n=17) were also used for validating the assay. Additionally, leftover RNA from clinical samples received for serotyping of dengue viruses and positive for DENV-1 but without sequence data (n= 296) were also used in the present study. Details of the virus isolates/clinical samples positive for DENV-1 used with their geographical locations were given in Table 1. A map of India indicating sampled states has been provided (Figure 1). Samples from the states of Karnataka, Kerala and Tamil Nadu were used for finding out the predominant genotype of DENV-1 circulating in the Southern region of India, while samples from the state of Maharashtra was used to study the DENV-1 genotypes circulating in the western part of India. The study was approved by the institutional ethics committee of ICMR-National Institute of Virology, Pune (NIV/IHEC/2015/D-7274, NIV/IEC/2018/D-8 and NIV/IEC/2018/D-34).
Table 1:
Geographical location and numbers of DENV-1 positive clinical samples/isolates tested in the assay and genotyping results
| State | District/City | Year | Number of samples/isolates tested | Numbers of positive samples |
||
|---|---|---|---|---|---|---|
| AM/AF | Asian | Dual | ||||
| Andhra Pradesh | Anantapur | 2015 | 4 | 4 | - | - |
| Gujarat | Surat | 2014 | 2 | 2 | - | - |
| Karnataka | Bengaluru | 2017 | 2 | 2 | - | - |
| 2018 | 4 | 3 | 1 | - | ||
| Kerala | Alappuzha | 2010 | 1 | 1 | - | - |
| Alappuzha | 2017 | 3 | - | 3 | ||
| Ernakulam | 2017 | 1 | 1 | - | - | |
| Kottayam | 2017 | 1 | - | 1 | ||
| Alappuzha | 2018 | 4 | - | 4 | - | |
| Pathanamthitta | 2018 | 1 | - | 1 | - | |
| Maharashtra | Pune | 2012 | 1 | 1 | - | - |
| 2013 | 6 | 6 | - | - | ||
| 2014 | 1 | 1 | - | - | ||
| 2017 | 31 | 31 | - | - | ||
| 2018 | 25 | 14 | 10 | 1 | ||
| Nashik | 2017 | 147 | 98 | 48 | 1 | |
| 2018 | 41 | 38 | 3 | - | ||
| Aurangabad | 2018 | 1 | 1 | - | - | |
| Kohlapur | 2018 | 4 | 4 | - | - | |
| Nagpur | 2018 | 1 | 1 | - | - | |
| Odisha | Bhubaneshwar | 2011 | 3 | 3 | - | - |
| Tamil Nadu | Tirunelveli | 2012 | 21 | 1 | 20 | - |
| Vellore | 2015 | 2 | 1 | 1 | - | |
| 2016 | 2 | 2 | - | - | ||
| 2017 | 5 | 4 | 2 | - | ||
| Coimbatore | 2017 | 5 | 2 | 3 | - | |
| Dindigul | 2017 | 4 | 1 | 3 | - | |
| Tiruppur | 2017 | 14 | 4 | 9 | 1 | |
Figure 1.
Geographical location of the sampled states indicating the districts/city. Map not to the scale.
2.2. E gene sequencing and Phylogenetic analysis
E gene sequencing of DENV-1 virus isolates and clinical samples positive for DENV-1 was performed as described earlier [Patil et al., 2011; Patil et al., 2018]. MEGA7.0 was used for multiple sequence alignment and phylogenetic analyses [Kumar et al., 2016]. The best-fit model for construction of phylogenetic tree was determined using model test option available in MEGA7.0. General time reversible (GTR) model was observed to be the best-fit model and used for generation of phylogenetic tree. Phylogenetic tree was constructed using DENV-1 E gene sequences available in GenBank from India (n = 46) and E gene sequences generated from the DENV-1 virus isolates/clinical samples positive for DENV-1 (n =19) in the laboratory during the present study along with the global sequences from GenBank (65 DENV-1) representing all genotypes. Genotypes were defined as group of viruses within a serotype with a nucleotide divergence of less than 6% [Rico-hesse, 1990]. A separate lineage is considered as a group of viruses within a genotype with a nucleotide divergence of less than 3% [Alfonso et al., 2012]. Nucleotide divergence within and between clusters was calculated using p-distance model implemented in MEGA7.0.
2.3. Designing of primers and probes for discrimination of DENV-1 genotypes
Whole genome sequence of DENV-1 for different genotypes available in the Virus Pathogen Database and Analysis Resource (ViPR) [Pickett et al., 2012] were downloaded, aligned using MAFT online version 7.0 [Katoh et al., 2017]. The consensus sequence for DENV-1 serotype and each genotype were generated from aligned sequences. From the consensus sequence for each genotype, regions with signature sequences specific for each genotype flanked by regions common in all genotypes were identified and used for designing of primers and probes. A set of common primers amplifying the signature sequences specific to all the genotypes of DENV-1 were designed. Two probes specific for each genotype were designed. The designed probes were synthesized as dual-labeled probes.
2.4. Validation of the primes and probes in one-step real-time RT-PCR for DENV-1 genotyping
The primers and probes were tested in a one-step real-time RT-PCR using RNA extracted from the virus isolates (n =33) and clinical samples (n =7) for which genotype was known based on sequencing data and phylogenetic analyses (n = 40; Asian 17; AM/AF 23). Moreover, the specificity of the assay was tested against virus isolates one each belonging to other serotypes and samples (n=17) negative for DENV.
2.5. One step real-time RT-PCR assay for discrimination of DENV-1 genotypes
Leftover RNA from clinical samples positive for DENV-1 but without sequence data (n= 296) were genotyped using the one step real-time RT-PCR assay. Briefly, 12.5 μl of 2x RT-PCR buffer and 0.5 μl of RT-PCR enzyme (Superscript III platinum one step qRT-PCR system, Invitrogen, CA, USA), 0.5 μM to 1.0 μM of common primers and probes specific for Asian and AM/AF genotypes of DENV-1 and 5 μl RNA in a total volume of 25 μl was used for real-time RT-PCR. The sequences of the primers and probes with their respective fluorescence dyes and quenchers were given in Table 2. The reaction was carried out in MX3005P real time PCR system. The reaction conditions were as follows: 50°C for 30 min, followed by 95°C for 2 min, and 40 cycles of amplification (15s at 95°C and 1 min at 60°C). Respective fluorescence signals for different genotypes were detected and samples which gave a cycle threshold (Ct) value of ≤37 was considered positive and genotypes assigned accordingly.
Table 2.
Position wise conservation of nucleotides in primers and probes among the analysed sequences of DENV-1
| Position | Primers | Probes# | ||||||
|---|---|---|---|---|---|---|---|---|
| D1Fa | D1Rb | Asianc | AMAFd | |||||
| Nucleotide | Number of sequences conserved (%)# | Nucleotide | Number of sequences conserved (%) | Nucleotide | Number of sequences conserved (%)* | Nucleotide | Number of sequences conserved (%)* | |
| 1 | G | 1633 (99.9) | G | 1630 (99.7) | T | 1242 (100) | A | 212 (66.2) |
| 2 | A | 1632 (99.9) | C | 1632 (99.9) | T | 1242 (100) | A | 200 (62.5) |
| 3 | A | 1630 (99.7) | T | 1622 (99.3) | T | 1241 (99.9) | T | 320 (100) |
| 4 | C | 1630 (99.7) | G | 1632 (99.9) | C | 1200 (96.6) | T | 306 (95.6) |
| 5 | A | 1633 (99.9) | T | 1634 (100) | G | 1234 (99.3) | T | 319 (99.7) |
| 6 | G | 1634 (100) | T | 1633 (99.9) | A | 1242 (100) | C | 311 (97.1) |
| 7 | A | 1634 (100) | A | 1634 (100) | C | 1242 (100) | A | 227 (70.9) |
| 8 | T (Y)* | 1580 (96.7) | T | 1607 (98.3) | C | 1237 (99.6) | A | 319 (99.7) |
| 9 | G | 1634 (100) | C (Y)* | 1403 (85.9) | C | 1242 (100) | C | 311 (97.1) |
| 10 | C | 1629 (99.6) | A | 1634 (100) | A | 1240 (99.8) | C | 307 (95.9) |
| 11 | A (R)* | 1549 (94.8) | A (R)* | 1363 (83.4) | A | 1240 (99.8) | C | 320 (100) |
| 12 | C | 1632 (99.9) | T | 1632 (99.9) | G | 1241 (99.9) | A | 320 (100) |
| 13 | C | 1632 (99.9) | C | 1634 (100) | A | 1242 (100) | A | 320 (100) |
| 14 | A | 1634 (100) | T | 1634 (100) | T | 1242 (100) | G | 320 (100) |
| 15 | T | 1634 (100) | C | 1599 (97.8) | G | 1242 (100) | A | 320 (100) |
| 16 | G | 1634 (100) | C | 1631 (99.8) | A | 1234 (99.3) | T | 320 (100) |
| 17 | C | 1613 (98.7) | C | 1632 (99.9) | A | 1166 (99.9) | G | 320 (100) |
| 18 | A | 1634 (100) | A | 1615 (98.8) | A | 1242 (100) | A | 320 (100) |
| 19 | A | 1634 (100) | T | 1632 (99.9) | A | 1231 (99.1) | G | 320 (100) |
| 20 | G | 1634 (100) | T | 1634 (100) | A | 1231 (99.1) | A | 320 (100) |
| 21 | A | 1633 (99.9) | C | 1630 (99.7) | G | 1242 (100) | A | 320 (100) |
| 22 | T | 1634 (100) | G | 1242 (100) | A | 320 (100) | ||
| 23 | G | 1632 (99.9) | A | 1238 (99.7) | G | 320 (100) | ||
| 24 | G | 1237 (99.6) | G | 320 (100) | ||||
| 25 | T | 1231 (99.1) | A | 312 (97.5) | ||||
| 26 | A | 1164 (93.7) | G | 320 (100) | ||||
| 27 | A | 1238 (99.7) | T | 320 (100) | ||||
| 28 | C | 1240 (99.8) | G | 320 (100) | ||||
| 29 | A | 314 (98.1) | ||||||
| 30 | C | 320 (100) | ||||||
The total number of DENV-1 sequences used for primer designing was 1634. The total number of sequences used for designing probe specific to Asian genotype was 1242. For AM/AF genotype, 320 sequences were used. The remaining 72 sequences among the 1634 DENV-1 sequences belonged to South Pacific genotype (data not shown).
Degenerate bases in the parenthesis are present in the primers
Position in the whole genome 1917-1937 and in the E gene 983-1003
Position in the whole genome 1973-1995 and in the E gene 1039-1061
Position in the whole genome 1924-1951 and in the E gene 1010-1037
Position in the whole genome 1942-1971 and in the E gene 1008-1037
2.6. Statistical analysis
The genotyping results from 336 samples (40 DENV-1 isolates/clinical samples with E gene sequence data and 296 DENV-1 positive samples without sequence data) were included in the analysis for finding out the prevalence and spatio-temporal distribution of DENV-1 genotypes in the western and southern states of India. Percentage of DENV-1 genotypes were calculated from the total number of DENV-1 samples genotyped from that district or state.
3. Results
3.1. Phylogenetic analysis of DENV-1
Phylogenetic analysis of DENV-1 was performed using 65 sequences from Indian strains (19 sequenced in the current study) and 65 global sequences. The accession numbers of the viruses sequenced in the present study were provided in supplementary table 1. The analyses revealed that sequences from Indian strains clustered in two genotypes (Figure 2). DENV-1 strains from the year 1962 to 2011 were found in AM/AF genotype while those collected during 2012-2017 were observed in both AM/AF and Asian genotypes. Within AM/AF genotype, Indian sequences clustered in five lineages: India I - India IV and Afro India. The inter lineage nucleotide divergence ranged from 3.0% to 5.7%. Strains collected after 2005 clustered within the India IV lineage.
Figure 2:
Phylogenetic tree of DENV-1 based on E gene sequences. All the sequences highlighted in Red are from India. Sequences that are underlined were available earlier and were genotyped by the one step real-time RT-PCR. Sequences with asterix and underlined were sequenced in the present study and genotyped by the one step real-time RT-PCR. Sequences with only asterix were sequenced in the present study, but not used for genotyping. Sixty five global sequences and 65 Indian sequences were used for generating the phylogenetic tree. The year ranges given in the Afro India, India I , India II and India III lineages within AM/AF genotype were given only for Indian isolates.
Among the Asian genotype sequences, the strains clustered into two lineages A and B. The inter lineage nucleotide divergence between the two lineages was 3.0%. The intra lineage nucleotide divergence within lineage A was 2.0% and lineage B was 1.8%. All the Indian sequences from 2012-2018 clustered with lineage A sequences which consisted of sequences from Sri Lanka, Singapore and Thailand strains collected during 2009 and afterward (Figure 2).
3.2. Primers and probes for discrimination of DENV-1 genotypes
Signature sequences specific to each genotype of DENV-1 flanked by consensus sequences common to both genotypes were identified in the E gene and found to be highly conserved (Figure 3 and Table 2) and were used for the designing of primers and probes for genotyping of DENV-1. The designed primer and probe sequences were provided in the Table 3.
Figure 3:
Consensus sequence for DENV-1 serotype and each genotype used in primer-probe designing. A total number of 1634 DENV-1 sequences were used to generate the consensus sequence. Among the 1634, 1242 were from Asian and 320 from AM/AF genotypes. Rest of the sequences belonged to South Pacific genotype (data not shown).
Table 3.
Primer and Probe sequences used for genotyping of DENV1 with their positions in the whole genome as well as the E gene
| Primers and Probes Name | Primers and Probes Nucleotide Sequence | Position in the Whole Genome | Position in the E Gene |
|---|---|---|---|
| Asian | TTTCGACCCAAGATGAAAAAGGAGTAAC | 1924-51 | 1010-37 |
| AM/AF | AATTTCAACCCAAGATGAGAAAGGAGTGAC | 1942-71 | 1008-37 |
| D1F | GAACAGAYGCRCCATGCAAGA | 1917-37 | 983-1003 |
| D1R | GCTGTTATYARTCTCCCATTCTG | 1973-95 | 1039-61 |
Probe for Asian genotype was labeled with 5’FAM and 3’ BHQ-1
Probe for AM/AF genotype was labeled with 5’HEX and 3’ BHQ-1
3.3. Validation results of the primer and probes in discriminating DENV-1 genotypes
The designed primer-probe set was tested in a one-step real-time RT-PCR assay using virus isolates or clinical samples for which the genotypes were known and E gene sequences were available: Asian genotype n = 17; AM/AF genotype n = 23. The genotyping results matched with the genotypes assigned on the basis of E gene phylogenetic analysis except for the one sample which was positive for both Asian and AM/AF genotype. The virus isolates belonging to other three serotypes as well as DENV negative samples by real time RT-PCR were not reactive in the assay (Sensitivity 100% and specificity 98.2%). The E gene sequence from the sample which was positive for both genotypes showed the presence of AM/AF by phylogenetic analysis (sequence accession number MH 594878) (Figure 2). The probes were specific and not reactive with other genotype.
3.4. Prevalence and spatio-temporal distribution of different DENV-1 genotypes in Western India
In the Pune district of Maharashtra, a western state of India, AM/AF genotype was the only genotype detected in limited DENV-1 samples received during 2012-2015. All the 31 DENV-1 positive samples tested from 2017 belonged to AM/AF genotype. Out of the 25 samples tested in 2018, 10 samples were positive for Asian genotype (40.0%) and 14 (56.0%) for AM/AF genotype. One sample (4.0%) was positive for both the genotypes (Table 1).
In Nashik district, AM/AF genotype was detected in 98 (66.8%) samples while Asian genotype was detected in 48 (32.6%) samples out of the 147 DENV-1 positive samples tested during 2017. One sample (0.6%) was positive for both the genotype. Out of the 31 samples tested during 2018, three samples (7.3%) were positive for Asian genotype while AM/AF genotype was detected in 38 (92.7% ) samples (Table 1).
DENV-1 samples from all the other districts of Maharashtra belonged to AM/AF genotype. Among the limited number of samples tested from the states of Gujarat (a western state) and Odisha (an eastern state), all were positive for AM/AF genotype (Table 1).
3.5. Prevalence of different DENV-1 genotypes in the southern states of India
In Tamil Nadu, among the DENV-1 positive samples tested from 2012, 90.5% belonged to Asian genotype while one each sample was positive for AM/AF and dual genotypes. Among the samples received during 2017 from different districts of Tamil Nadu, Asian genotype was the predominant genotype in all the districts except Vellore (Table 1).
Asian genotype was detected in higher numbers among the DENV-1 positive samples from Kerala during both 2017 and 2018 (Table 1).
Among the samples from the states of Karnataka and Andhra Pradesh, AF/AM genotype was detected in all samples except one which was positive for Asian genotype (Table 1).
4. Discussion
In the present study, a one-step real-time RT-PCR was developed to discriminate the Asian and AM/AF genotypes of DENV-1 and validated using isolates and clinical samples for which the sequences are available. To the best of our knowledge, this is first report to use a one-step real time RT-PCR to discriminate the Asian and AM/AF genotypes of DENV-1. The assay was observed to be very specific and sensitive in detecting Asian and AM/AF genotypes of DENV-1. Only one sample provided a discordant result. Though the assay detected the AM/AF genotype assigned on the basis of sequencing and phylogenetic analysis, the assay additionally detected Asian genotype in the discordant sample. Coinfection with multiple genotypes of DENV-1 has been reported in a dengue patient [Aaskov et al., 2007]. It is possible that the traditional Sanger sequencing method may not be able to detect the minor population in the sample and next-generation sequencing (NGS) method is required to validate the presence of two genotypes in the sample. However, NGS method also requires high quality RNA and is not cost effective. The present assay is a cost effective and less time-consuming one as compared to the sequencing methods. The assay provides an opportunity to study the spatio-temporal distribution of DENV-1 genotype circulating in a region and can be readily used by resource limited public health laboratories to monitor the changes in the circulating genotypes over time and can serve as a component of early warning systems for dengue. If large number of DENV-1 positive samples were available from an outbreak, the assay can be utilized to initially find out the number of samples positive for each genotype and can guide in selection of samples for sequencing. The assay can also be utilized to find out whether the infecting DENV-1 genotype is Asian or AM/AF in a patient and the role of the these genotypes in their ability to cause severe disease may be investigated. If a particular genotype is proved to be associated with severe disease, then this assay can serve to predict severe disease. Moreover, the assay can be utilized in experimental coinfection studies to investigate the effect of one genotype on the replication of the other genotype. For samples with lower viral load, the success rate for sequencing is limited [Santiago et al., 2019] and can be overcome with the present genotyping assay. One of the limitation of the present assay was that the assay may not be useful in finding out inter genotypic recombinants for which usually nucleotide sequences are required to find out recombination.
The DENV-1 genotypic assay was further utilized to investigate the spatio-temporal distribution of circulating DENV-1 genotypes in India. Earlier studies based on limited sequences revealed that the Asian genotype displaced the AM/AF during the 2012 epidemic of dengue in Tamil Nadu [Cecilia et al., 2017]. Higher percentage Asian genotype strains were observed during the 2014-2015 season of dengue in Karnataka [Ahamed et al., 2019]. However, in the present study, among the DENV-1 positive samples from Tamil Nadu in 2012 tested, one was positive for AM/AF genotype suggesting that AM/AF genotype was not completely displaced by Asian genotype in 2012 and both the genotypes were circulating in Tamil Nadu since 2012 with the dominance of the Asian genotype even during 2017. Based on a single sequence, studies have reported the presence of the Asian genotype in Kerala between 2013 and 2015 [Cecilia et al., 2017; Pooja et al., 2017]. In the present study, among the ten samples from 2017-2018 studied, 90% belonged to the Asian genotype suggesting its dominance in Kerala. Among the samples from Karnataka and Andhra Pradesh states, a dominance of AM/AF strains was observed, however, the sample size was limited to derive any conclusion.
During 2017, the study revealed that the both the Asian and AM/AF genotype were observed in the Nashik region while in the Pune district, only AM/AF was circulating. However, during 2018, the Asian genotype strains were observed in Pune also. Two year data from Nashik and Pune districts revealed that AM/AF is the dominant genotype suggesting that AM/AF circulating in western region of India might have more transmission potential than the circulating Asian genotype strains.
The study has revealed two contrasting observations. DENV-1 Asian genotype is dominant in the southern region of India, while DENV-1 AM/AF genotype is dominant in the western region of India. Data from different studies indicate that Asian genotype might have introduced from Singapore to Sri Lanka and South India followed by introduction in Western India. Introduction of DENV-1 Asian genotype might be one of the reasons for the larger number of DENV-1 cases in Pune and Nashik districts of Maharashtra during 2017 and 2018. The dominance of AM/AF genotype despite the introduction of the Asian genotype suggests that the Asian genotype virus might have acquired a phenotype with a lower transmissibility in mosquitoes compared to AM/AF genotype and this needs confirmation. Complete genome analyses coupled with transmission and replication studies of the circulating genotypes under in-vitro and in-vivo conditions might reveal the possible reasons for contrasting observations in Southern and Western regions of India.
The main limitation of the study is the sample size, which is not uniform across the years for different states. The assay cannot substitute sequencing since sequencing allows for phylogenetic analysis, which is powerful tool to investigate the transmission dynamics among sampled locations, the time of introduction of new lineages and the selection pressures impacting viral evolution. However, the assay can complement sequencing to understand the molecular epidemiology and spatio-temporal distribution of different genotypes in a particular region. Further follow up studies in the coming years investigating a larger number of samples across different regions are needed.
To conclude, a one step real-time RT-PCR has been developed for discriminating Asian and AM/AF DENV-1 genotypes and can be used as a complement to sequencing, but not a substitute in molecular surveillance of DENV-1 in public health laboratories and as an alternative to sequencing, in regions where the sequencing facilities are not available. Further, the study revealed the co-circulation of both the Asian and AM/AF genotypes of DENV-1 with a dominance of the Asian genotype in South India and AM/AF genotype in Western India.
Supplementary Material
A one step real-time RT-PCR was developed for discriminating Asian and American/African (AM/AF) genotypes of dengue virus type I(DENV-1).
The assay has a sensitivity of 100% and specificity of 98.2% compared to sequencing method.
The Asian genotype was the predominant genotype in Tamil Nadu and Kerala, South India.
The AM/AF genotype was the predominant genotype in Maharashtra, Western India.
One step real-time RT-PCR forgenotyping ofDENV-1 can be complement sequencing in the molecular surveillance ofDENV-1.
Acknowledgements
The samples from Christian Medical College (CMC), Vellore, Tamil Nadu were part of a collaborative project with Emory University and the study was funded by National Institutes of Health Grants (NIH/NIAID Award No. 5 U01AI115651-04) and National Vector Borne Disease Control Programme, Government of India.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflicts of interest
None declared
Ethical Approval
The study was approved by the institutional ethics committee of ICMR-National Institute of Virology, Pune (NIV/IHEC/2015/D-7274, NIV/IEC/2018/D-8 and NIV/IEC/2018/D-34).
References
- Aaskov J, Buzacott K, Field E, Lowry K, Berlioz-Arthaud A, Holmes EC, 2007. Multiple recombinant dengue type 1 viruses in an isolate from a dengue patient. J. Gen. Virol 88, 3334–3340. 10.1099/vir.0.83122-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ahamed SF, Vivek R, Britto C, Dias M, Nayak K, Chandele A, Kaja M-K, Shet A, 2019. Emergence of new genotypes and lineages of dengue viruses during the 2012–15 epidemics in southern India. Int. J. Infect. Dis 10.1016/j.ijid.2019.01.014 [DOI] [PubMed] [Google Scholar]
- Alfonso HL, Amarilla AA, Gonçalves PF.,Barros MT., de Almeida FT, Silva TR, da Silva EV, Nunes MT, Vasconcelos PFC, Vieira DS, Batista WC, Bobadilla ML., Vazquez C., Moran M, Figueiredo LTM., Aquino VH, 2012. Phylogenetic relationship of dengue vims type 3 isolated in Brazil and Paraguay and global evolutionary divergence dynamics. Virol. J 9, 124 10.1186/1743-422X-9-124 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cecilia D, Patil JA, Kakade MB, Walimbe A, Aagarasu K, Anukumar B, Abraham A, 2017. Emergence of the Asian genotype of DENV-1 in South India. Virology 510, 40–45. 10.1016/j.virol.2017.07.004 [DOI] [PubMed] [Google Scholar]
- Dupont-Rouzeyrol M, Aubry M, O’Connor O, Roche C, Gourinat A-C, Guigon A, Pyke A, Grangeon J-P, Nilles E, Chanteau S, Aaskov J, Cao-Lormeau V-M, 2014. Epidemiological and molecular features of dengue virus type-1 in New Caledonia, South Pacific, 2001-2013. Virol. J 11, 61 https://doi.org/10.l186/1743-422X-11-61 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goncalvez AP, Escalante AA, Pujol FH, Ludert JE, Tovar D, Salas RA, Liprandi F, 2002. Diversity and evolution of the envelope gene of dengue vims type 1. Virology 303, 110–119. [DOI] [PubMed] [Google Scholar]
- Katoh K, Rozewicki J, Yamada KD, n.d. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 10.1093/bib/bbxl08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar SRP, Patil JA, Cecilia D, Cherian SS, Barde PV, Walimbe AM, Yadav PD, Yergolkar PN, Shah PS, Padbidri VS, Mishra AC, Mourya DT, 2010. Evolution, dispersal and replacement of American genotype dengue type 2 viruses in India (1956-2005): selection pressure and molecular clock analyses. J. Gen. Virol 91, 707–720. 10.1099/vir.0.017954-0 [DOI] [PubMed] [Google Scholar]
- Patil JA, Alagarasu K, Kakade MB, More AM, Gadekar KA, Jadhav SM, Parashar D, Shah PS, 2018. Emergence of dengue virus type 1 and type 3 as dominant serotypes during 2017 in Pune and Nashik regions of Maharashtra, Western India. Infect. Genet. Evol 66, 272–283. 10.1016/j.meegid.2018.10.016 [DOI] [PubMed] [Google Scholar]
- Patil JA, Cherian S, Walimbe AM, Bhagat A, Vallentyne J, Kakade M, Shah PS, Cecilia D, 2012. Influence of evolutionary events on the Indian subcontinent on the phylogeography of dengue type 3 and 4 viruses. Infect. Genet. Evol 12, 1759–1769. 10.1016/j.meegid.2012.07.009 [DOI] [PubMed] [Google Scholar]
- Patil JA, Cherian S, Walimbe AM, Patil BR, Sathe PS, Shah PS, Cecilia D, 2011. Evolutionary dynamics of the American African genotype of dengue type 1 virus in India (1962-2005). Infect. Genet. Evol 11, 1443–1448. 10.1016/j.meegid.2011.05.011 [DOI] [PubMed] [Google Scholar]
- Pickett BE, Sadat EL, Zhang Y, Noronha JM, Squires RB, Hunt V, Liu M, Kumar S, Zaremba S, Gu Z, Zhou L, Larson CN, Dietrich J, Klem EB, Scheuermann RH, 2012. ViPR: an open bioinformatics database and analysis resource for virology research. Nucleic Acids Res 40, D593–D598. 10.1093/nar/gkr859 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pooja S, Sabeena S, Revti B, Sanjay R, Anjali A, Rajendra K, Aswathyraj S, Giselle D, Hindol M, Arunkumar G, 2017. Circulating Genotypes of Dengue-1 Virus in South West India, 2014-2015. Jpn. J. Infect. Dis 70, 663–665. 10.7883/yoken.JJID.2017.087 [DOI] [PubMed] [Google Scholar]
- Rico-Hesse R, 1990. Molecular evolution and distribution of dengue viruses type 1 and 2 in nature. Virology 174, 479–493. [DOI] [PubMed] [Google Scholar]
- Rose W, Sindhu KN, Abraham AM, Kang G, John J, 2019. Incidence of dengue illness among children in an urban setting in South India: A population based study. Int. J. Infect. Dis. 10.1016/j.ijid.2019.01.033 [DOI] [PubMed] [Google Scholar]
- Saha K, Ghosh M, Firdaus R, Biswas A, Seth B, Bhattacharya D, Mukheijee K, Sadhukhan PC, 2016. Changing pattern of dengue virus serotypes circulating during 2008-2012 and reappearance of dengue serotype 3 may cause outbreak in Kolkata, India. J. Med. Virol. 88, 1697–1702. 10.1002/jmv.24529 [DOI] [PubMed] [Google Scholar]
- Santiago GA, Gonzalez GL, Cruz-Lopez F, Munoz-Jordan JL, 2019. Development of a standardized Sanger-based method for partial sequencing and genotyping dengue viruses. J. Clin. Microbiol 57 (4). 10.1128/JCM.01957-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santiago GA, McElroy-Home K, Lennon NJ, Santiago LM, Birren BW, Henn MR, Munoz-Jordan JL, 2012. Reemergence and decline of dengue vims serotype 3 in Puerto Rico. J. Infect. Dis 206, 893–901. https://doi.org/l0.1093/infdis/jis426 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santiago GA, Vergne E, Quiles Y, Cosme J, Vazquez J, Medina JF, Medina F, Colon C, Margolis H, Munoz-Jordan JL, 2013. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue vims. PLoS Negl Trop Dis 7, e2311 10.1371/journal.pntd.0002311 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan K-K, Zulkifle N-I, Abd-Jamil J, Sulaiman S, Yaacob CN, Azizan NS, Che Mat Seri NAA, Samsudin NI, Mahfodz NH, AbuBakar S, 2017. Dismption of predicted dengue vims type 3 major outbreak cycle coincided with switching of the dominant circulating virus genotype. Infect. Genet. Evol 54, 271–275. 10.1016/j.meegid.2017.07.008 [DOI] [PubMed] [Google Scholar]
- Teoh B-T, Sam S-S, Tan K-K, Johari J, Shu M-FL, Danlami MB, Abd-Jamil J, MatRahim N, Mahadi NM, AbuBakar S, 2013. Dengue vims type 1 clade replacement in recurring homotypic outbreaks. BMC Evol. Biol 13, 213 10.1186/1471-2148-13-213 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Villabona-Arenas CJ, Zanotto PM de A, 2013. Worldwide spread of Dengue virus type 1. PLoS ONE 8, e62649 10.1371/journal.pone.0062649 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Villar LA, Rojas DP, Besada-Lombana S, Sarti E, 2015. Epidemiological trends of dengue disease in Colombia (2000–2011): a systematic review. PLoS Negl Trop Dis 9, e0003499 10.1371/journal.pntd.0003499 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vu TTH, Holmes EC, Duong V, Nguyen TQ, Tran TH, Quail M, Churcher C, Parkhill J, Cardosa J, Farrar J, Wills B, Lennon NJ, Birren BW, Buchy P, Henn MR, Simmons CP, 2010. Emergence of the Asian 1 genotype of dengue virus serotype 2 in viet nam: in vivo fitness advantage and lineage replacement in South-East Asia. PLoS Negl Trop Dis 4, e757 10.1371/journal.pntd.0000757 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.