Abstract
The increased recurrence of Candida albicans infections is associated with greater resistance to antifungal drugs. This involves the establishment of alternative therapeutic protocols, such as probiotic microorganisms whose antifungal potential has already been demonstrated using preclinical models (cell cultures, laboratory animals). Understanding the mechanisms of action of probiotic microorganisms has become a strategic need for the development of new therapeutics for humans. In this study, we investigated the prophylactic anti-C. albicans properties of Lactobacillus rhamnosus Lcr35® using the in vitro Caco-2 cell model and the in vivo Caenorhabditis elegans model. In Caco-2 cells, we showed that the strain Lcr35® significantly inhibited the growth (~2 log CFU.mL-1) and adhesion (150 to 6,300 times less) of the pathogen. Moreover, in addition to having a pro-longevity activity in the nematode (+42.9%, p = 3.56.10−6), Lcr35® protects the animal from the fungal infection (+267% of survival, p < 2.10−16) even if the yeast is still detectable in its intestine. At the mechanistic level, we noticed the repression of genes of the p38 MAPK signalling pathway and genes involved in the antifungal response induced by Lcr35®, suggesting that the pathogen no longer appears to be detected by the worm immune system. However, the DAF-16/FOXO transcription factor, implicated in the longevity and antipathogenic response of C. elegans, is activated by Lcr35®. These results suggest that the probiotic strain acts by stimulating its host via DAF-16 but also by suppressing the virulence of the pathogen.
1 Introduction
Candida albicans is a commensal yeast found in the gastrointestinal and urogenital tracts [1,2] and is responsible for various diseases ranging from superficial infections affecting the skin to life-threatening systemic pathologic states i.e., candidemia [3]. Its pathogenicity is based on several factors, such as the formation of biofilms, thigmotropism, adhesion and invasion of host cells, secretion of hydrolytic enzymes [3] and the transition from yeast to hyphal filaments, which facilitates its spread [4,5].
There is an increase in the number of fungal infections, mainly due to the increaseraise in resistance to drugs [6,7] and to the limited number of available antifungals, some of which are toxic [8]. In addition, it is very common that antifungal treatments destabilize, more or less severely, the host commensal microbiota, leading to dysbiosis [9] which is favourable to the establishment of another pathogen or recurrence. In addition, because of the presence of similarities between yeasts and human cells (i.e., eukaryotic cells), the development of novel molecules combining antifungal activity and host safety is particularly complicated [8]. These different elements demonstrate the need to develop new therapeutic strategies. These aimed at effectively treating a fungal infection while limiting the health risks for the host; in particular, by preserving the integrity of its microbiota. The use of probiotics to cure candidiasis or fungal-infection-related dysbiosis is part of these novel strategies [10–12]. The World Health Organization (WHO) and the Food and Agriculture Organization of the United Nations (FAO) define probiotics as “live microorganisms, which, when administered in adequate amounts, confer a health benefit on the host” [13]. Under this appellation of probiotics, a wide variety of microbial species, are found within both prokaryotes and eukaryotes (yeasts, such as Saccharomyces), although these are mainly lactic bacteria, such as the genera Lactobacillus and Bifidobacterium [14]. Currently, a new name is increasingly used to replace the term probiotic: live biotherapeutic products (LBP). These LBP are biological products containing live biotherapeutic microorganisms (LBM) used to prevent, treat or cure a disease or condition of human beings, excluding vaccines [15].
In this issue, we focused on L. rhamnosus Lcr35®, which is a well-known probiotic strain whose in vitro and in vivo characteristics are widely documented [16–23]. It is a gram-positive bacterium commercialized by biose® as a pharmaceutical product for more than 60 years for preventive and curative gastrointestinal and gynaecological indications. Nivoliez et al. demonstrated the probiotic properties of the native strain such as resistance to gastric acidity and bile stress and lactic acid production. Under its commercial formulations, the Lcr35® strain has the ability to adhere to intestinal (Caco-2, HT29-MTX) and vaginal (CRL -2616) epithelial cells, but the inhibition of pathogen adhesion to intestinal cells by Lcr35® has not been investigated by the authors. This study has also shown that Lcr35® leads to a strong inhibition of vaginal (C. albicans, Gardnerella vaginalis) and intestinal (enterotoxigenic and enteropathogenic Escherichia coli (ETEC, EPEC), Shigella flexneri) pathogens [24]. These probiotic and antimicrobial effects have been observed during clinical trials, but we know little about the molecular mechanisms underlying these properties. Randomized trials conducted in infants and children have shown that preventive intake of probiotics has a positive impact on the development of infectious or inflammatory bowel diseases by reducing their symptoms and maintaining the balance of the microbiota [25]. In vitro and in vivo studies using preventive approaches have revealed certain mechanisms of action of probiotics [26].
Up to now, most probiotics used in both food and health applications are selected and characterized on the basis of their properties obtained with in vitro models [27] before being tested on complex in vivo models (murine models) and in human clinical trials. The in vitro studies are used mainly for ethical and cost issues [28] but also allow experimentations under defined and controlled conditions. As a result, some strains meeting the criteria for in vitro selection no longer respond in vivo and vice versa [29]. This fact reinforces the idea that in vitro and in vivo tests are complementary and necessary for the most reliable characterization of probiotic properties.
Here, we propose to use both in vitro Caco-2 cell culture and the invertebrate host C. elegans as an in vivo model to investigate microorganism-microorganism-host interactions. Caco-2 cells are a well-characterized enterocyte-like cell line. They are a reliable in vitro system to study the adhesion capacity of lactobacilli as well as their probiotic effects, such as protection against intestinal injury induced by pathogens [30,31]. Nevertheless, the use of in vivo models, which are closer to the complex environment of the human body, is inevitable in the case of a mechanistic study. Indeed, while rudimentary models such as C. elegans or Drosophila exhibit obvious benefits for (large) screening purposes, they are also not devoid of relevance in deciphering more universal signalling pathways, even related to mammalian innate immunity [32]. With its many genetic and protein homologies with human beings [33], C. elegans has become the ideal laboratory tool for physiological as well as mechanistic studies. This roundworm has already been used to study the pathogenicity mechanisms of C. albicans. The work of Pukkila-Worley has demonstrated a rapid antifungal response in C. elegans with the overexpression of antimicrobials encoding genes such as abf-2, fipr-22, fipr-23, cnc-7, thn-1 and chitinases (cht-1 and T19H5.1) or detoxification enzymes (oac-31, trx-3). It has also been shown that C. albicans hyphal formation is a key virulence factor that modifies gene expression in the C. elegans killing assay [34]. Some of these genes are notably dependent on the highly conserved p38 MAPK signalling pathway [35]. Several recent studies have established that the transition from yeast morphology to hyphal form is largely dependent on environmental parameters. It is also controlled by C. albicans genetic factors, such as eIF2 kinase Gcn2 [36] or SPT20 [37], whose mutations induce a decrease in virulence of the pathogen and an enhanced survival of the host. However, few studies have been conducted with the nematode on the use of probiotic microorganisms for the treatment of C. albicans fungal infection [38].
In this context, the aim of this study was to evaluate the effect of the Lactobacillus rhamnosus Lcr35® strain on the prevention of fungal infection due to C. albicans using the in vitro cellular model Caco-2 and the in vivo model C. elegans. To overcome the experimental limits of the in vitro model, we conducted a mechanistic study solely on the C. elegans model. The worm survival and gene expression in response to the pathogen and/or the probiotic were evaluated.
2 Material and methods
2.1 Microbial strains and growth conditions
The E. coli OP50 strain was provided by the Caenorhabditis Genetics Center (Minneapolis, MN, USA) and was grown on Luria Broth (LB, Miller’s Modification) (Conda, Madrid, Spain) at 37 °C overnight. The L. rhamnosus Lcr35® strain was provided by biose® (Aurillac, France) and was grown in de Man, Rogosa, Sharpe (MRS) broth (bioMérieux, Marcy l’Etoile, France) at 37 °C overnight. C. albicans ATCC 10231 was grown in yeast peptone glucose (YPG) broth pH 6.5 (per L: 10 g yeast extract, 10 g peptone, 20 g glucose) at 37 °C for 48 h. Microbial suspensions were spun down for 2 min at 1,500 rpm (Rotofix 32A, Hettich Zentrifugen, Tuttlingen, Germany) and washed with M9 buffer (per L: 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 mL 1 M MgSO4) to obtain a final concentration of 100 mg.mL-1.
2.2 Influence of Lcr35® on C. albicans growth and on C. albicans biofilm formation on Caco-2 cell monolayers
Growth inhibition of C. albicans by the probiotic strain Lcr35® was examined using the human colorectal adenocarcinoma cell line Caco-2 [39]. Caco-2 cells were grown in Dulbecco’s modified Eagle’s minimal essential medium (DMEM, Life Technologie, Villebon-sur-Yvette, France) supplemented with 20% inactivated foetal calf serum (Life Technologie) at 37 °C with 5% CO2 in air atmosphere. For the assays, the cells were seeded at a concentration of 3.5x105 cells.well-1 in 24-well plates (Dutscher, Brumath, France) and placed in growth conditions for 24 h. Microbial strains were grown according to Nivoliez et al. [24]. After growth, cell culture medium was removed and replaced by 1 mL of DMEM and 250 μL of Lcr35® culture (108 CFU.mL-1) in each well and incubated for 24 h. Two hundred and fifty microliters of C. albicans culture at different concentrations (102, 103, 104, 105, 106 and 107 CFU.mL-1) were added to each well. After incubation for 24 and 48 h, the inhibition of C. albicans by Lcr35® was evaluated. One hundred microliters of suspension were taken from each of the wells, and the number of viable bacteria and/or yeasts was determined by plating serial dilutions of the suspensions onto MRS or Sabouraud agar plates. For the measurement of C. albicans biofilm formation, after incubation for 48 h, the wells were washed twice with 0.5 mL of PBS and cells were harvested with 1 mL of trypsin at 37 °C. For the inhibition assay, the number of viable bacteria and/or yeasts was determined by plating serial dilutions of the suspensions onto MRS or Sabouraud agar plates. The plates were incubated at 37 °C for 72 h (MRS) or 48 h (Sabouraud). Each assay was performed three times independently and contained two technical replicates.
2.3 C. elegans maintenance
C. elegans N2 (wild-type) and TJ356 (daf-16p::daf-16a/b::GFP + rol-6(su1006)) strains were acquired from the Caenorhabditis Genetics Center. The nematodes were grown and maintained at 20 °C on nematode growth medium (NGM) (per L: 3 g NaCl; 2.5 g peptone; 17 g agar; 5 mg cholesterol; 1 mM CaCl2; 1 mM MgSO4, 25 mL 1 M potassium phosphate buffer at pH 6) plates supplemented with yeast extract (4 g.L-1) (NGMY) and seeded with E. coli OP50 [40]. For all experiments, wild-type C. elegans N2 were used except for the study of the localization of DAF-16 (TJ356 strain).
2.4 C. elegans synchronization
To avoid variations in results due to age differences, a worm synchronous population was required. Gravid worms were washed off using M9 buffer and spun down for 2 min at 1,500 rpm. Five millilitres of worm bleach (2.5 mL of M9 buffer, 1.5 mL of bleach, 1 mL of 5 M sodium hydroxide) was added to the pellet and vigorously shaken until adult worm body disruption. The action of worm bleach was stopped by adding 20 mL of M9 buffer. The egg suspension was then spun down for 2 min at 1,500 rpm and washed twice with 20 mL of M9 buffer. Eggs were allowed to hatch under slow agitation at 25 °C for 24 h in approximately 20 mL of M9 buffer. L1 larvae were then transferred onto NGMY plates seeded with E. coli OP50 until they reached the L4/young adult stage.
2.5 C. elegans bodyb size measurement
Individual adult worms were imaged using an Evos FL microscope (Invitrogen, Eugene, USA, 10X magnification). After reaching the L4 stage, they were transferred onto NGMY plates previously seeded with the probiotic strain Lcr35®, and their sizes were measured daily for three days. The length of the worm body was determined using ImageJ software as described by Mörck and Pilon (41) and compared to E. coli OP50-fed worms. At least 10 nematodes per experiment were imaged in at least three independent experiments.
2.6 C. elegans lifespan assay
Synchronous L4 worms were transferred to NGMY with 0.12 mM 5-fluorodeoxyuridine FUdR (Sigma, Saint-Louis, USA) to avoid egg hatching and seeded with 100 μL of microbes at 100 mg.mL-1 microbial strain (~50 worms per plate) as previously stated. The plates were kept at 20 °C, and live worms were scored each day until the death of all animals. An animal was scored as dead when it did not respond to a gentle mechanical stimulation. This assay was performed as three independent experiments with three plates per condition.
2.7 Effects of L. rhamnosus Lcr35® on candidiasis in C. elegans
Sequential feeding with Lcr35® and C. albicans were induced in C. elegans in all experiments (preventive assays). As control groups, monotypic contamination was induced in C. elegans by inoculation with only C. albicans, Lcr35® or E. coli OP50.
2.7.1 Preparation of plates containing probiotic bacteria or pathogenic yeasts
One hundred microliters of Lcr35® or E. coli OP50 suspension (100 mg.mL-1) was spread on NGMY + 0.12 mM FUdR plates and incubated at 37 °C overnight. Concerning C. albicans strains, 100 μL of suspension was spread on Brain Heart Infusion BHI (Biokar Diagnostics, Beauvais, France) + 0.12 mM FUdR plates and incubated at 37 °C overnight.
2.7.2 Survival assay: Preventive treatment
The survival assay was performed according to the work of de Barros [38], with some modifications. During a preventive treatment, young adult worms were placed on plates containing Lcr35® at 20 °C for different times (2, 4, 6 and 24 h). Next, the worms were washed with M9 buffer to remove bacteria prior to being placed on C. albicans plates for 2 h at 20 °C. Infected nematodes were washed off plates using M9 buffer prior to being transferred to a 6-well microtiter plate (approximately 50 worms per well) containing 2 mL of BHI/M9 (20%/80%) + 0.12 mM FUdR liquid assay medium per well and incubated at 20 °C. For the control groups (i.e., E. coli OP50 + C. albicans, E. coli OP50 only, Lcr35® only and C. albicans only), worms were treated in the same way. Nematodes were observed daily and were considered dead when they did not respond to a gentle mechanical stimulation. This assay was performed as three independent experiments containing three wells per condition.
2.8 Colonization of C. elegans intestine by C. albicans
To study the colonization of the worm gut by the pathogen C. albicans, fluorescent staining of the yeast was performed. The yeast was stained with rhodamine 123 (Yeast Mitochondrial Stain Sampler Kit, Invitrogen) according to the manufacturer’s instructions. A fresh culture of C. albicans was performed in YPG broth as described before, 1.6 μL of rhodamine 123 at 25 mM was added to 1 mL of C. albicans suspension and incubated at room temperature in the dark for 15 min. The unbound dye was removed by centrifugation (14,000 rpm for 5min at 4 °C) (Beckman J2-MC Centrifuge, Beckman Coulter, Brea, USA) and washed with 1 mL of M9 buffer. Subsequently, the nematodes were fed with E. coli OP50 or Lcr35® on NGMY plates for 4 h and then with labelled C. albicans on BHI plates for 72 h. The nematodes were then visualized using a fluorescence microscope at 100X magnification (Evos FL, Invitrogen).
2.9 RNA isolation and RT- quantitative PCR
Approximately 10,000 worms were harvested from NGMY plates with M9 buffer. Total RNA was extracted by adding 500 μL of TRIzol reagent (Ambion by Life Technologies, Carlsbad, USA). Worms were disrupted using a Precellys (Bertin Instruments, Montigny-le-Bretonneux, France) and glass beads (PowerBead Tubes Glass 0.1 mm, Mo Bio Laboratories, USA). Beads were removed by centrifugation at 14,000 rpm for 1 min (Eppendorf® 5415D, Hamburg, Germany), and 100 μL of chloroform was added to the supernatant. Tubes were vortexed for 30 seconds and incubated at room temperature for 3 minmin. The phenolic phase was removed by centrifugation at 12,000 rpm for 15 min at 4 °C. The aqueous phase was treated with chloroform as previously described. RNA was precipitated by adding 250 μL of isopropanol for 4 min at room temperature and spun down at 12,000 rpm for 10 min (4 °C). The supernatant was discarded, and the pellet was washed with 1,000 μL of 70% ethanol. The supernatant was discarded after centrifugation at 14,000 rpm for 5 min (4 °C), and the pellet was dissolved in 20 μL of RNase-free water. RNA was reverse-transcribed using a High-Capacity cDNA Archive kit (Applied Biosystems, Foster City, USA) according to the manufacturer’s instructions. For real-time qPCR assay, each tube contained 2.5 μL of cDNA, 6.25 μL of Rotor-Gene SYBR Green Mix (Qiagen GmbH, Hilden, Germany), 1.25 μL of 10 μM primers (reported in Table 1) (Eurogentec, Seraing, Belgium) and 1.25 μL of water. All samples were run in triplicate. Rotor-Gene Q Series Software (Qiagen GmbH) was used for the analysis. In our study, two reference genes, cdc-42 and Y45F10D.4, were used in all the experimental groups. The quantification of gene-of-interest expression (EGOI) was performed according to the following formula [41] taking into account the efficiency of the PCR for each primer pair and normalizing the expression of the gene of interest by two reference genes (cdc-42 and Y45F10D.4):
Table 1. C. elegans gene primers for qPCR analysis.
GOI: Gene of interest.
Gene name | Gene type | Forward Primer (5’– 3’) | Reverse Primer (5’– 3’) | Reference |
---|---|---|---|---|
cdc-42 | housekeeping | ATCCACAGACCGACGTGTTT | GTCTTTGAGCAATGATGCGA | [42] |
Y45F10D.4 | housekeeping | CGAGAACCCGCGAAATGTCGGA | CGGTTGCCAGGGAAGATGAGGC | [43] |
daf-2 | GOI | AAAAGATTTGGCTGGTCAGAGA | TTTCAGTACAAATGAGATTGTCAGC | [44] |
daf-16 | GOI | TTCAATGCAAGGAGCATTTG | AGCTGGAGAAACACGAGACG | [44] |
sek-1 | GOI | GCCGATGGAAAGTGGTTTTA | TAAACGGCATCGCCAATAAT | [44] |
pmk-1 | GOI | CCGACTCCACGAGAAGGATA | AGCGAGTACATTCAGCAGCA | [44] |
abf-2 | GOI | TCGTCCGTTCCCTTTTCCTT | CCTCTCTTAATAAGAGCACC | This study |
fipr-22/fipr-23 | GOI | CCCAATCCAGTATGAAGTTG | ATTTCAGTCTTCACACCGGA | This study |
cnc-4 | GOI | ATGCTTCGCTACATTCTCGT | TTACTTTCCAATGAGCATTC | This study |
The worms fed with E. coli OP50 were used as control conditions for the gene expression calculation.
2.10 Statistical analysis
Data are expressed as the mean ± standard deviation.
The C. elegans survival assay was examined using the Kaplan-Meier method, and differences were determined using the log-rank test with R software version 3.5.0 [45], and the survival [46] and survminer [47] packages. For C. albicans growth inhibition and biofilm formation and C. elegans growth and gene expression of the genes analysed, differences between conditions were determined by a two-way ANOVA followed by a Fisher’s Least Significant Difference (LSD) post hoc test using GraphPad Prism version 7.0a for Mac OS X (GraphPad Software, La Jolla, California, USA). A p-value ≤ 0.05 was considered significant.
2.11 DAF-16 nuclear localization
DAF-16 nuclear localization was followed as described elsewhere [48] using a transgenic TJ-356 worm strain constitutively expressing the DAF-16 transcription factor combined with GFP (DAF-16::GFP). Once adults, worms were exposed to a single strain: E. coli OP50, Lcr35® or C. albicans for 2, 4, 6, 24 and 76 h at 20 °C. A preventive approach was also conducted: worms were placed in the presence of E. coli OP50 or Lcr35® for 4 h and then C. albicans for 2 hh. The nematodes were subsequently imaged 2, 4, 6 and 24 h after infection. The translocation of DAF-16::GFP was scored by assaying the presence of GFP accumulation in the C. elegans cell nuclei using a fluorescence microscope at 40X magnification (Evos FL, Invitrogen).
3 Results
3.1 Anti-C. albicans effects of Lcr35® on Caco-2 cell monolayer
3.1.1 Growth inhibition of CC. albicans
In the presence of Caco-2 cells, regardless of the concentration of the C. albicans inoculum, the yeast grew to similar concentrations that ranged from 7.48 ± 0.39 to 7.83 ± 0.34 log CFU.mL-1 after 48 h of incubation. When prophylactic treatment was used, i.e., when the Caco-2 cells were pre-incubated with the probiotic Lcr35®, we observed an inhibition of C. albicans growth. Indeed, the bacterium induced a significant inhibition of the yeast growth of 2 log CFU.mL-1, which then reached a concentration ranging from 5.40 ± 0.07 to 6.05 ± 0.25 log CFU.mL-1. Two different inhibition profiles were observed after 48 h. On the one hand, when the inoculum was highly concentrated (7 log CFU.mL-1), we observed a decrease in the yeast population, which is a sign of cell death. On the other hand, when the inoculum was less concentrated (2 to 4 log CFU.mL-1), we noticed that the yeast was able to grow, although its growth seemed to stop between 5.32 ± 0.36 and 5.51 ± 0.14 log CFU.mL-1 (Table 2).
Table 2. Evolution of the concentration of C. albicans in the presence or absence of Lcr35® on Caco-2 cell monolayers.
Length of incubation (hh) | ||||
---|---|---|---|---|
Concentration of C. albicans inocula (CFU.mL-1) | With or without Lcr35® | 0 | 24 | 48 |
107 | with | 7.25 ± 0.51 | 6.39 ± 0.73 | 6.05 ± 0.25 **** |
without | 6.77 ± 0.10 | 7.29 ± 0.23 | 7.78 ± 0.41 | |
106 | with | 5.85 ± 0.25 | 5.47 ± 0.12 * | 5.73 ± 0.09 *** |
without | 5.76 ± 0.18 | 7.42 ± 0.27 | 7.69 ± 0.20 | |
105 | with | 4.77 ± 0.41 | 5.01 ± 0.12 ** | 5.49 ± 0.04 **** |
without | 4.60 ± 0.28 | 7.60 ± 0.69 | 7.83 ± 0.34 | |
104 | with | 3.69 ± 0.21 | 4.92 ± 0.54 | 5.51 ± 0.14 * |
without | 3.72 ± 0.13 | 7.09 ± 0.59 | 7.48 ± 0.39 | |
103 | with | 2.56 ± 0.34 | 3.59 ± 0.25 | 5.51 ± 0.16 **** |
without | 2.30 ± 0.17 | 6.60 ± 0.28 | 7.93 ± 0.45 | |
102 | with | 1.34 ± 0.31 | 3.18 ± 0.76 | 5.32 ± 0.36 *** |
without | 1.34 ± 0.38 | 6.18 ± 1.01 | 7.80 ± 0.27 |
The results are expressed as log10 CFU.mL-1 of yeast alone (controls) or co-incubated with Lcr35® (mean ± standard deviation). A comparison between the conditions with and without Lcr35® was performed using a two-way ANOVA followed by a Fisher’s LSD post hoc test
(p < 0.05: *; p < 0.01: **; p < 0.001: ***; p < 0.0001: ****)
3.1.2 Inhibition of C. albicans biofilm formation
After 48h of incubation, the C. albicans biofilm contained between 5.78 log CFU.mL-1 (inoculum at 102 CFU.mL-1) and 8.69 log CFU.mL-1 of yeast (inoculum at 107 CFU.mL-1). However, since the cells were pre-exposed to Lcr35® and for the same C. albicans inocula, we observed a significant decrease in the amount of yeast in the biofilm: 4.32 to 5.16 log CFU.mL-1, which corresponded to an inhibition ranging from 1.46 to 3.53 log. The strongest inhibition was observed in the case where the inoculum of C. albicans was the most concentrated (Fig 1).
Fig 1. Determination of the C. albicans concentration in the biofilm in the presence or absence of Lcr35® (108 CFU.mL-1) on the Caco-2 cell monolayer (mean ± standard deviation).
Different concentrations of yeast were tested, and the amount present in the biofilm was evaluated after 48 h of incubation. Comparison between conditions with and without Lcr35® was performed using a two-way ANOVA followed by a Fisher’s LSD post hoc test (p < 0.05: *; p < 0.01: **; p < 0.001: ***; p < 0.0001: ****).
3.2 Effects of Lcr35® on C. elegans physiology
3.2.1 Lcr35® extends the C. elegans lifespan
We investigated the effects on C. elegans lifespan induced by either the pathogenic yeast C. albicans or the probiotic Lcr35®. Feeding adult nematodes with the probiotic strain resulted in a significant increase in the mean lifespan compared to E. coli OP50-fed worms (p = 3.56.10−6) evolving from 7 to 10 days (+ 42.9%), whereas C. albicans had no impact on the mean lifespan of C. elegans. On the other hand, when C. albicans was used as a feeding source, worms displayed a significantly reduced longevity (p = 1.27.10−5), which dropped from 16 to 14 days (-12.5%). Lcr35® did not increase the worm longevity compared to E. coli OP50 (Fig 2). These results showed that the probiotic strain ameliorated the mean lifespan without increasing the life expectancy of the worm.
Fig 2. Influence of Lactobacillus rhamnosus Lcr35® and C. albicans on the lifespan of the C. elegans wild-type N2 strain.
Worms were fed E. coli OP50 (n = 285), C. albicans ATCC 10231 (n = 242), and Lcr35® (n = 278). The mean lifespan, where half of the population was dead, is represented on the abscissa. The asterisks indicate the p-values (log-rank test) with E. coli OP50 as a control (p < 0.05: *; p < 0.01: **; p < 0.001: ***).
3.2.2 Lcr35® does not modify C. elegans growth
The body size of Lcr35® fed nematodes was compared to that of E. coli OP50-fed worms. Feeding worms with the probiotic strain did not significantly change the growth rate or body size, as they all reached their maximal length after three days (Fig 3).
Fig 3. Growth of C. elegans (adult) on E. coli OP50 and on Lcr35®.
All results are represented as means +/- standard deviations (ns: statistically not significant).
3.3 Effect of Lcr35® preventive treatment on candidiasis
3.3.1 Effect of Lcr35® on C. elegans survival after C. albicans exposure
When C. elegans was sequentially exposed to Lcr35® for 2 h prior to being infected by C. albicans, the survival of the nematodes increased significantly as the mean lifespan increased from 3 to 11 days (267% increase in survival) compared with that observed with C. albicans infection alone (p < 2.10−16). There was no significant difference in worm survival between those sequentially exposed to Lcr35® and C. albicans and those exposed to Lcr35® only (Fig 4) (p = 1). Similar results were obtained with the 4-hours treatment time. In that case, we observed that Lcr35® completely protected C. elegans from infection since there was no significant difference with the Lcr35® control condition without infection (p = 0.4).
Fig 4. Preventive effects of Lcr35® against C. albicans ATCC 10231.
Mean survival, where half of the population was dead, is represented on the abscissa. The asterisks indicate the p-values (log-rank test) against E. coli OP50 (p < 0.05: *; p < 0.01: **; p < 0.001: ***). Infection duration: 2 hour;2-hour preventive treatment (E. coli OP50 (OP50, n = 126); C. albicans ATCC 10231 (CA, n = 424); Lcr35® (Lcr35, n = 93); E. coli OP50 + C. albicans (OP50 + CA, n = 287); Lcr35® + C. albicans (Lcr35 + CA, n = 224));4-hour preventive treatment (E. coli OP50 (OP50, n = 313); C. albicans ATCC 10231 (CA, n = 424); Lcr35® (Lcr35, n = 259); E. coli OP50 + C. albicans (OP50 + CA, n = 120); Lcr35® + C. albicans (Lcr35 + CA, n = 164)); 6-hour preventive treatment (E. coli OP50 (OP50, n = 222); C. albicans ATCC 10231 (CA, n = 424); Lcr35® (Lcr35, n = 165); E. coli OP50 + C. albicans (OP50 + CA, n = 339); Lcr35® + C. albicans (Lcr35 + CA, n = 300)); 24-hour preventive treatment (E.treatment coli OP50 (OP50, n = 248); C. albicans ATCC 10231 (CA, n = 424); Lcr35® (n = 170); E. coli OP50 + C. albicans (OP50 + CA, n = 220); Lcr35® + C. albicans (Lcr35 + CA, n = 183)).
For longer treatment times (6 and 24 h), we observed a significant decrease in the mean survival in the presence of Lcr35® (condition 6 h: p = 0.04, condition 24 h: p <2.10−16) or Lcr35® and C. albicans (condition 6 h: p = 9.10−13, condition 24 h: p < 2.10−16) compared to the treatment of 4 h. Taken together, the results showed that the 4 probiotic treatment was the most protective against infection.
3.3.2 Influence of Lcr35® on C. albicans colonization of the worm gut
To determine whether the anti-C. albicans effects observed were due to the removal of the pathogen, colonization of the nematode intestine by C. albicans was observed by light microscopy. After three days of incubation in the presence of the pathogen, wild-type worms exhibited notable colonization of the entire digestive tract (Fig 5A). However, this strain of C. albicans was not able to form hyphae within the worm. We subsequently applied prophylactic treatment to the worms for 4 h before infecting them with yeast. We observed that after treatment with E. coli OP50 (Fig 5B) or the probiotic Lcr35® (Fig 5C) followed by infection, the yeast C. albicans was still detected in the digestive tract of the host.
Fig 5. C. albicans colonization of the C. elegans gut after 72 h (A) and after a 4-hour prophylactic treatment with E. coli OP50 (B) or Lcr35® (C).
The green colour represents yeast labelled with rhodamine 123. Scale bar, 10 μm.
3.4 Mechanistic study
3.4.1 Modulation of C. elegans gene expression induced by Lcr35® and C. albicans
To elucidate the mechanisms involved in the action of Lcr35® against C. albicans, we studied the expression of seven C. elegans genes (Table 3). We targeted three groups of genes: daf-2 and daf-16 (insulin signalling pathway), which are involved in host longevity and anti-pathogenicity; sek-1 and pmk-1 (p38 MAPK signalling pathway), which concern the immune response; and abf-2, cnc-4 and fipr-22/fipr-23, which encode antimicrobial proteins. We noted that Lcr35® tended to induce an overexpression of daf-16 (p = 0.1635) and had no effect on daf-2 (p = 0.2536), while C. albicans tended to induce an upregulation of both genes (p = 0.1155 and p = 0.2396, respectively). We did not observe any expression modulation of daf-2 or daf-16 using a preventive treatment with E. coli OP50 (p = 0.1258 and p = 0.1215, respectively) or with Lcr35® (p = 0.1354 and p = 0.3021, respectively).
Table 3. Relative expression of the C. elegans genes of interest in the presence of Lcr35® and C. albicans in pure or sequential cultures in comparison with the control condition E. coli OP50 (alone).
Genes of interest | |||||||
---|---|---|---|---|---|---|---|
Insulin signalling pathway | p38 MAPK signalling pathway | Antimicrobials | |||||
Conditions | daf-2 | daf-16 | sek-1 | pmk-1 | abf-2 | cnc-4 |
fipr-22 / fipr-23 |
Lcr35® | 1.35 | 2.18 | 0.38 ** | 0.36 * | 1.70 | 3.39 | 0.61 |
C. albicans | 2.48 | 3.31 | 3.21 * | 4.33 | 11.33 | 22.32 | 1.08 |
E. coli OP50 + C. albicans | 1.82 | 0.53 | 0.37 * | 3.40 | 4.69 | 0.16 ** | 0.78 |
Lcr35® + C. albicans | 0.69 | 1.74 | 0.31 ** | 1.15 | 1.61 | 0.41 * | 0.42 * |
Genes were considered differentially expressed when the p-value was lower than 0.05 (*) or 0.01 (**) according to Fisher’s LSD test and simultaneously when the expression change was at least 2 times or 0.5 times.
The expression of the sek-1 and pmk-1 immunity genes was significantly downregulated in the presence of Lcr35® by 2.63-fold (p = 0.015) and 2.78-fold (p = 0.0149), respectively, while they were upregulated by C. albicans 3.21-fold (p = 0.0247) and 4.33-fold (0.1618), respectively. In the control condition, in the presence of E. coli OP50 and C. albicans, sek-1 was repressed 2.70 times (0.37-fold with p = 0.0204), but pmk-1 tended to be overexpressed. Preventive treatment with Lcr35® had the same effect on sek-1 (p = 0.0016) but induced no change in pmk-1 expression (p = 0.8205). Finally, among the 3 antimicrobials encoding the genes tested, only the expression of cnc-4 seemed to be modulated in the presence of Lcr35®, and cnc-4 was overexpressed (p = 0.1753). C albicans also seemed to induce the overexpression of abf-2 (p = 0.2213) and cnc-4 (p = 0.3228), but interestingly, fipr-22/fipr-23 (p = 0.8225) expression remained unchanged. Overexpression of abf-2 (6.25-fold, p = 0.3158) and significant repression of cnc-4 (p = 0.0088) were observed when E. coli OP50 was added before infection with C. albicans. Using a Lcr35® preventive treatment, cnc-4 and fipr-22/fipr-23 were significantly repressed (p = 0.0396 and p = 0.0385, respectively).
3.4.2 Influence of Lcr35® and C. albicans on DAF-16 nuclear translocation
To further investigate the mechanisms involved in the anti-C. albicans effects of Lcr35®, we followed the nuclear translocation of the DAF-16/FOXO transcription factor using the DAF-16::GFP strain. Whatever the incubation time, the worms did not show any translocation of DAF-16 when fed with E. coli OP50 (Fig 6A). When Lcr35® was used as food, we observed a nuclear translocation of the transcription factor, taking place gradually from 4 h of incubation with a maximum intensity in the nuclei after 6 hh. The distribution of DAF-16 was both cytoplasmic and nuclear (Fig 6B). When the nematode was fed exclusively with C. albicans, we observed a rapid nuclear translocation of the transcription factor after two hours of incubation in the presence of the pathogen (Fig 6C). This translocation was maintained throughout the experiment, i.e., 76 h.
Fig 6. DAF-16 cellular localization in C. elegans transgenic strain TJ-356 (daf-16p::daf-16a/b::GFP + rol-6(su1006)) expressing DAF-16::GFP.
Worms fed on E. coli OP50 (A), on Lcr35® (B) and on C. albicans ATCC 10231 (C). Scale bar, 100 μm.
3.4.3 Effect of Lcr35® preventive treatment on DAF-16 nuclear translocation
We investigated the effect of preventive treatment on the cellular localization of DAF-16 over time after infection by C. albicans using the C. elegans DAF-16∷GFP mutant. When nematodes were first fed with E. coli OP50 before being infected, DAF-16 was fully observed in the nuclei up to 4 h after infection and then gradually translocated to the cytoplasm after 24 h (Fig 7A). Conversely, the worms that were first exposed to Lcr35® and then to the pathogen showed a different response, and the transcription factor was found only in the nuclei (Fig 7B).
Fig 7. Impact of preventive Lcr35® treatment on DAF-16 cellular localization in the C. elegans transgenic strain TJ-356 expressing DAF-16::GFP.
Worms fed with E. coli OP50 + C. albicans (A) and on Lcr35® + C. albicans (B). Scale bar, 100 μm.
4 Discussion
The selection of microbial strains as probiotics is based on a combination of functional probiotic properties revealed first by classical basic in vitro testing. Beyond resistance to gastric pH or bile salts, the ability of a strain to adhere to epithelial cells is frequently studied since this represents a prerequisite for mucosal colonization as part of the anti-pathogen activity. Adhesion is also a key parameter for pathogens since it allows them to release toxins and enzymes directly into the target cell, facilitating their dissemination [49]. Nivoliez et al. showed that the native probiotic strain Lcr35® adhered rather weakly to Caco-2 intestinal cells, while the industrial formulation increased this capacity [24]. We have demonstrated here the ability of Lcr35® to inhibit the growth of the pathogen C. albicans and the formation of a C. albicans biofilm on an intestinal cell monolayer in vitro. As described by Jankowska et al., the low adherence of L. rhamnosus compared to C. albicans seems to reflect that competition for membrane receptors is not the only mechanism. It is probably related to the synthesis of antifungal effectors by the probiotic as well [49]. Exopolysaccharides (EPS) secreted by certain lactobacilli have been shown to modify the surface properties (hydrophobicity) of microorganisms with direct consequences on their adhesion capacities [50]. EPS have antifungal effects by inhibiting C. albicans growth and adhesion to epithelial cells. The surface polysaccharides of L. rhamnosus GG, a strain phylogenetically close to Lcr35, appear to interfere in the binding between the fungal lectin-like adhesins and host sugars or between the fungal cell wall carbohydrates and their epithelial adhesion receptor [51]. A recent study has shown that purified fractions of exopolysaccharides also interfered with adhesion capacities of microorganisms [52]. It would be interesting to assay the inhibitory properties of Lcr35® EPS. However, to fully understand the probiotic mechanisms, in vitro approaches are too limited. Moving to an in vivo approach is mandatory to better understand the interactions between microorganisms (probiotics and pathogens) and the host response.
C. elegans is considered a powerful in vivo model for studying the pathogenicity of microorganisms [34,35,53–55] and the antimicrobial properties of lactic acid bacteria [56,57]. The nature of the nutrient source is an important parameter that has a great influence on nematode physiology. Regarding worm growth, it appears that there is some disparity depending on the type of lactic acid bacteria used to feed C. elegans. Bifidobacterium spp. had no influence on the size of adult worms, although their growth was slightly slowed down [58,59]. Lactobacillus spp. by contrast usually result in reduced growth rates and sizes and are sometimes even lethal to the larvae [60,61]. The mechanisms for explaining the longevity extension induced by lactic acid bacteria are not fully understood, but some authors have suggested the involvement of caloric restriction [62–64]. In our case, similar to the work of Komura et al., it seems that Lcr35® did not induce pro-longevity effects through caloric restriction insofar as the growth of Lcr35®-fed nematodes is identical compared to E. coli OP50-fed worms [65].
After demonstrating the preventive effect of Lcr35 against C. albicans in the nematode, we decided to better understand the protective effect at the mechanistic level. In C. elegans, the insulin/IGF-1 signalling pathway is strongly involved in regulating the longevity and immunity of the animal. Signal transduction is mediated through DAF-16, a highly conserved FOXO transcription factor [66]. Using the GFP fusion protein, we have shown that Lcr35® induces translocation of DAF-16 to the nucleus, suggesting that DAF-16 is involved in the probiotic mechanisms of action of Lcr35®. According to several studies, our data suggested that the pro-longevity effect of Lcr35® implements mechanisms involving different regulatory pathways linked to DAF-16, such as the DAF-2/DAF-16 insulin pathway [67] or the c-Jun N-terminal kinase JNK-1/DAF-16 pathway [59]. The absence of modulation of daf-2 expression in the presence of Lcr35® suggests that the DAF-2/DAF-16 pathway is not involved and that the anti-Candida capacity of Lcr35® is due to the JNK signalling pathway. The involvement of these pathways needs to be followed at proteomic and phosphoproteomic levels to validate this hypothesis.
The yeast C. albicans is capable of inducing a severe infection in C. elegans, causing a rapid death of the host and even after a very short contact time. This infection is first manifested by the colonization of the whole intestinal lumen by yeasts and then by the formation of hyphae piercing the cuticle of the nematode leading to its death [34,68]. In addition, it has been shown that strains of C. albicans incapable of forming hyphae, such as SPT20 mutants, have a significantly reduced pathogenicity in C. elegans as well as in Galleria mellonella or Mus musculus models while still being lethal [37]. In the nematode, it seems that the distention of the intestine caused by the accumulation of yeast is one of the causes of the death of the animal [35]. Recently, de Barros et al. [38] showed that L. paracasei 28.4 had anti-C. albicans activity both in vitro and in vivo by inhibiting filamentation of yeast protecting the nematode. Although C. albicans ATCC 10231 is able to form hyphae during in vitro assays, it failed to kill C. elegans by filamentation. Therefore, it is likely that Lcr35® represses virulence factors in yeast other than filamentation.
From a mechanistic point of view, several hypotheses can explain the anti-C. albicans properties of Lcr35® in the nematode: a direct interaction between the two microorganisms as well as an immunomodulation of the host by the probiotic. According to Nivoliez et al. demonstrating the inhibitory capacity of Lcr35® with respect to the pathogen during a co-culture experiment [24], our data showed Candida albicans inhibition on mammalian cell monolayers. This inhibition may be due to nutrient competition (i.e., glycogen consumption) or to the production of toxic metabolites against the yeast [24]. We have shown that even after preventive treatment with the probiotic, the digestive tract of the nematode is colonized by the pathogen without showing a pathological state. This suggests that Lcr35® induced repression of virulence factors in C. albicans, as shown by De Barros et al. [38]. Moreover, an in vitro study on human dendritic cells revealed that Lcr35® induced a large dose-dependent modulation not only in the expression of genes mainly involved in the immune response but also in the expression of CD, HLA and TLR membrane proteins. Highly conserved and found in C. elegans, TLR also plays a role in the antipathogenic response of the nematode by activating the p38 MAPK pathway [59]. A pro-inflammatory effect has also been shown through cytokine secretion, such as IL-1β, IL-12, TNFα. However, this immunomodulation takes place only in the presence of a high concentration of Lcr35® [69]. In C. elegans, DAF-16 is closely related to mammalian FOXO3a, a transcription factor involved the inflammatory process [70]. Therefore, nuclear translocation of DAF-16 by Lcr35® can be interpreted as the establishment of an inflammatory response in the host allowing it to survive an infection. In our study, we observed that the duration of the Lcr35® treatment influences the preventive anti-C. albicans effect on nematode lifespan, suggesting that the quantity of Lcr35® ingested and/or the treatment period of time may have an impact on the efficiency of the treatment. A thorough transcriptional study will be interesting to characterize the dose-dependent effect probiotics administered. We demonstrated that Lcr35® induces a transcriptional response in the host by activating the transcription factor DAF-16 and repressing the p38 MAPK signalling pathway, including in the presence of C. albicans. We also observed the repression of the genes encoding antimicrobials when fungal infection was preceded by probiotic treatment. The work of Pukkila-Worley et al. [35] demonstrated that C. albicans induced a fast antifungal response in the host inducing the expression of antimicrobial genes such as abf-2, cnc-4, cnc-7, fipr-22 and fipr-23. With the exception of abf-2, all these genes are under the control of PMK-1, whose inactivation makes the nematode susceptible to infection. In our study, we showed that an Lcr35® preventive treatment induced a down-regulation in the cnc-4, fipr-22 and fipr-23 genes, while pmk-1 remained unchanged compared to the control condition. Based on the data of Pukkila-Worley et al., the absence of overexpression of these genes in the presence of C. albicans after pre-exposure with Lcr35® suggests again that the probiotic inhibits yeast virulence, obviating the establishment of a defence mechanism by the host. Similar results have also been observed with Salmonella Enteritidis, where the authors hypothesize that the probiotics used induce immunotolerance in the nematode rather than the synthesis of antimicrobials [58]. The use of C. elegans mutants or RNAi could be further considered to decipher the signalling and regulation mechanisms.
5 Conclusion
This study demonstrates the preventive anti-C. albicans properties of Lcr35® using both in vitro and in vivo models. The probiotic strain inhibits the growth of the pathogenic yeast and its ability to form biofilms on intestinal cells in vitro. Lcr35® allows protection of the host C. elegans against infection despite the presence of C. albicans in its gut. Lcr35® during C. albicans infection seems to induce a decrease in the immune response of the nematode (downregulation of sek-1, pmk-1, abf-2, cnc-4 and fipr-22/23). Extra studies on C. elegans whole transcriptome modulation by Lcr35® would be interesting to further reveal other mechanisms involved. The study of the yeast virulence gene modulation induced by Lcr35® could be very informative about the complex mechanisms of the probiotic mechanisms of action. Additionally, in a second phase, the realization of a comparative study between Lcr35® and other Lactobacillus strains (L. rhamnosus, L. casei, L. paracasei) as well as between different strains of CC. albicans, including clinical strains, could be of interest to determine the degree of strain dependence of our results.
Acknowledgments
Some strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).
We thank Jonathan Heuzé, Muriel Théret and Jeanne Riom, trainees at the UMRF 0545 (UCA/INRA/VAS) for their involvement in the implementation of several experiments. We thank greatly all those who participated in the writing of this article.
Data Availability
All relevant data are within the paper.
Funding Statement
This work was supported by the European funds FEDER and the Auvergne-Rhône-Alpes Region in the form of grants to CP, as well as biose, as part of the doctoral thesis of CP. The funder biose provided support in the form of salaries for authors CD and AN. The specific roles of these authors are articulated in the ‘author contributions’ section. The funders did not otherwise have any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Cauchie M, Desmet S, Lagrou K. Candida and its dual lifestyle as a commensal and a pathogen. Res Microbiol [Internet]. 2017. November [cited 2018 Sep 5];168(9–10):802–10. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0923250817300402 [DOI] [PubMed] [Google Scholar]
- 2.Neville BA, D’enfert C, Bougnoux M-E. Candida albicans commensalism in the gastrointestinal tract. FEMS Yeast Res [Internet]. 2015. [cited 2018 Sep 5];15:81 Available from: https://unite.ut.ee/ [DOI] [PubMed] [Google Scholar]
- 3.Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Vol. 4, Virulence. 2013. p. 119–28. [DOI] [PMC free article] [PubMed]
- 4.Kadosh D, Antonio S. Control of Candida albicans morphology and pathogenicity by post-transcriptional mechanisms. Cell Mol Life Sci. 2017;73(22):4265–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wächtler B, Wilson D, Haedicke K, Dalle F, Hube B. From attachment to damage: Defined genes of Candida albicans mediate adhesion, invasion and damage during interaction with oral epithelial cells. Munro C, editor. PLoS One [Internet]. 2011. February 23 [cited 2018 Sep 10];6(2):e17046 Available from: http://www.ncbi.nlm.nih.gov/pubmed/21407800 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Farmakiotis D, Kontoyiannis DP. Epidemiology of antifungal resistance in human pathogenic yeasts: current viewpoint and practical recommendations for management. Int J Antimicrob Agents [Internet]. 2017. September [cited 2018 Sep 5];50(3):318–24. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0924857917302364 [DOI] [PubMed] [Google Scholar]
- 7.Sanguinetti M, Posteraro B, Lass-Flörl C. Antifungal drug resistance among Candida species: Mechanisms and clinical impact. Mycoses [Internet]. 2015. June [cited 2018 Sep 5];58(S2):2–13. Available from: http://www.ncbi.nlm.nih.gov/pubmed/26033251 [DOI] [PubMed] [Google Scholar]
- 8.Scorzoni L, de Paula E Silva ACA, Marcos CM, Assato PA, de Melo WCMA, de Oliveira HC, et al. Antifungal Therapy: New Advances in the Understanding and Treatment of Mycosis. Front Microbiol [Internet]. 2017. [cited 2018 Sep 5];8:36 Available from: http://www.ncbi.nlm.nih.gov/pubmed/28167935 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wheeler ML, Limon JJ, Bar AS, Leal CA, Gargus M, Tang J, et al. Immunological Consequences of Intestinal Fungal Dysbiosis. Cell Host Microbe [Internet]. 2016;19(6):865–73. Available from: 10.1016/j.chom.2016.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hu H-J, Zhang G-Q, Zhang Q, Shakya S, Li Z-Y. Probiotics Prevent Candida Colonization and Invasive Fungal Sepsis in Preterm Neonates: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Pediatr Neonatol [Internet]. 2017. April [cited 2018 Sep 5];58(2):103–10. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1875957216301401 [DOI] [PubMed] [Google Scholar]
- 11.Matsubara VH, Bandara HMHN, Mayer MPA, Samaranayake LP. Probiotics as Antifungals in Mucosal Candidiasis. 2016 [cited 2018 Sep 5]; https://academic.oup.com/cid/article-abstract/62/9/1143/1745140 [DOI] [PubMed]
- 12.Agrawal S, Rao S, Patole S. Probiotic supplementation for preventing invasive fungal infections in preterm neonates—a systematic review and meta-analysis. Mycoses [Internet]. 2015. November 1 [cited 2018 Sep 5];58(11):642–51. Available from: http://doi.wiley.com/10.1111/myc.12368 [DOI] [PubMed] [Google Scholar]
- 13.FAO, WHO. Health and Nutritional Properties of Probiotics in Food including Powder Milk with Live Lactic Acid Bacteria. Food Nutr Pap [Internet]. 2001 [cited 2016 Jun 14]; http://www.crcnetbase.com/doi/abs/10.1201/9781420009613.ch16
- 14.Fijan S. Microorganisms with Claimed Probiotic Properties: An Overview of Recent Literature. Int J Environ Res Public Heal Int J Environ Res Public Heal Int J Environ Res Public Heal [Internet]. 2014. [cited 2017 May 13];11:4745–67. Available from: www.mdpi.com/journal/ijerph [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Olle B. Medicines from microbiota. Nat Biotechnol [Internet]. 2013. April 5 [cited 2017 Mar 31];31(4):309–15. Available from: http://www.nature.com/doifinder/10.1038/nbt.2548 [DOI] [PubMed] [Google Scholar]
- 16.Coudeyras S, Jugie G, Vermerie M, Forestier C. Adhesion of human probiotic Lactobacillus rhamnosus to cervical and vaginal cells and interaction with vaginosis-associated pathogens. Infect Dis Obstet Gynecol [Internet]. 2008. January 27 [cited 2018 Sep 10];2008:549640 Available from: http://www.ncbi.nlm.nih.gov/pubmed/19190778 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Coudeyras S, Marchandin H, Fajon C, Forestier C. Taxonomic and strain-specific identification of the probiotic strain Lactobacillus rhamnosus 35 within the Lactobacillus casei group. Appl Environ Microbiol [Internet]. 2008. May [cited 2018 Sep 10];74(9):2679–89. Available from: http://www.ncbi.nlm.nih.gov/pubmed/18326671 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Forestier C, De Champs C, Vatoux C, Joly B. Probiotic activities of Lactobacillus casei rhamnosus: in vitro adherence to intestinal cells and antimicrobial properties. Res Microbiol [Internet]. 2001. March [cited 2018 Sep 10];152(2):167–73. Available from: http://www.ncbi.nlm.nih.gov/pubmed/11316370 [DOI] [PubMed] [Google Scholar]
- 19.de Champs C, Maroncle N, Balestrino D, Rich C, Forestier C. Persistence of colonization of intestinal mucosa by a probiotic strain, Lactobacillus casei subsp. rhamnosus Lcr35, after oral consumption. J Clin Microbiol [Internet]. 2003. March [cited 2018 Sep 10];41(3):1270–3. Available from: http://www.ncbi.nlm.nih.gov/pubmed/12624065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Petricevic L, Witt A. The role of Lactobacillus casei rhamnosus Lcr35 in restoring the normal vaginal flora after antibiotic treatment of bacterial vaginosis. BJOG An Int J Obstet Gynaecol [Internet]. 2008. October [cited 2016 Jun 14];115(11):1369–74. Available from: http://doi.wiley.com/10.1111/j.1471-0528.2008.01882.x [DOI] [PubMed] [Google Scholar]
- 21.Muller C, Mazel V, Dausset C, Busignies V, Bornes S, Nivoliez A, et al. Study of the Lactobacillus rhamnosus Lcr35® properties after compression and proposition of a model to predict tablet stability. Eur J Pharm Biopharm. 2014;88(3):787–94. 10.1016/j.ejpb.2014.07.014 [DOI] [PubMed] [Google Scholar]
- 22.Nivoliez A, Veisseire P, Alaterre E, Dausset C, Baptiste F, Camarès O, et al. Influence of manufacturing processes on cell surface properties of probiotic strain Lactobacillus rhamnosus Lcr35®. Appl Microbiol Biotechnol [Internet]. 2015. [cited 2017 Jan 1];99(1):399–411. Available from: http://link.springer.com/10.1007/s00253-014-6110-z [DOI] [PubMed] [Google Scholar]
- 23.Dausset C, Patrier S, Gajer P, Thoral C, Lenglet Y, Cardot JM, et al. Comparative phase I randomized open-label pilot clinical trial of Gynophilus® (Lcr regenerans®) immediate release capsules versus slow release muco-adhesive tablets. Eur J Clin Microbiol Infect Dis [Internet]. 2018. [cited 2019 Apr 2];37(10):1869–80. Available from: 10.1007/s10096-018-3321-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Nivoliez A, Camares O, Paquet-Gachinat M, Bornes S, Forestier C, Veisseire P. Influence of manufacturing processes on in vitro properties of the probiotic strain Lactobacillus rhamnosus Lcr35®. J Biotechnol. 2012;160(3–4):236–41. 10.1016/j.jbiotec.2012.04.005 [DOI] [PubMed] [Google Scholar]
- 25.Isolauri E, Kirjavainen P V, Salminen S. Probiotics: a role in the treatment of intestinal infection and inflammation? Gut [Internet]. 2002;50(Supplement 3):iii54–9. Available from: http://gut.bmj.com/cgi/doi/10.1136/gut.50.suppl_3.iii54 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.do Carmo MS, Santos C itapary dos, Araújo MC, Girón JA, Fernandes ES, Monteiro-Neto V. Probiotics, mechanisms of action, and clinical perspectives for diarrhea management in children. Food Funct [Internet]. 2018;9(10):5074–95. Available from: 10.1039/c8fo00376a [DOI] [PubMed] [Google Scholar]
- 27.Coudeyras S, Forestier C. Microbiote et probiotiques: impact en santé humaine. Can J Microbiol [Internet]. 2010. [cited 2018 Jan 30];56(8):611–50. Available from: http://www.nrcresearchpress.com/doi/pdfplus/10.1139/W10-052 [DOI] [PubMed] [Google Scholar]
- 28.Lacroix C, de Wouters T, Chassard C. Integrated multi-scale strategies to investigate nutritional compounds and their effect on the gut microbiota. Curr Opin Biotechnol [Internet]. 2015. [cited 2017 Apr 30];32:149–55. Available from: 10.1016/j.copbio.2014.12.009 [DOI] [PubMed] [Google Scholar]
- 29.Vinderola G, Gueimonde M, Gomez-Gallego C, Delfederico L, Salminen S. Correlation between in vitro and in vivo assays in selection of probiotics from traditional species of bacteria. Trends Food Sci Technol [Internet]. 2017;68:83–90. Available from: 10.1016/j.tifs.2017.08.005 [DOI] [Google Scholar]
- 30.Montoro BP, Benomar N, Lerma LL, Gutiérrez SC, Gálvez A, Abriouel H. Fermented aloreña table olives as a source of potential probiotic Lactobacillus pentosus strains. Front Microbiol. 2016;7(OCT). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Roselli M, Finamore A, Britti MS, Mengheri E. Probiotic bacteria Bifidobacterium animalis MB5 and Lactobacillus rhamnosus GG protect intestinal Caco-2 cells from the inflammation-associated response induced by enterotoxigenic Escherichia coli K88. Br J Nutr [Internet]. 2006;95(06):1177 Available from: http://www.journals.cambridge.org/abstract_S0007114506001589 [DOI] [PubMed] [Google Scholar]
- 32.Papadimitriou K, Zoumpopoulou G, Foligné B, Alexandraki V, Kazou M, Pot B, et al. Discovering probiotic microorganisms: In vitro, in vivo, genetic and omics approaches. Front Microbiol. 2015;6(FEB):1–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Lai CH, Chou CY, Ch’ang LY, Liu CS, Lin W. Identification of novel human genes evolutionarily conserved in Caenorhabditis elegans by comparative proteomics. Genome Res [Internet]. 2000. May [cited 2018 Sep 10];10(5):703–13. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10810093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pukkila-Worley R, Peleg AY, Tampakakis E, Mylonakis E. Candida albicans hyphal formation and virulence assessed using a Caenorhabditis elegans infection model. Eukaryot Cell [Internet]. 2009. [cited 2018 Feb 7];8(11):1750–8. Available from: http://ec.asm.org/content/8/11/1750.full.pdf [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Pukkila-Worley R, Ausubel FM, Mylonakis E. Candida albicans infection of Caenorhabditis elegans induces antifungal immune defenses. PLoS Pathog. 2011;7(6). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Alves V de S, Mylonakis E. The eIF2 kinase Gcn2 modulates Candida albicans virulence to Caenorhabditis elegans. Clin Microbiol Infect Dis [Internet]. 2018;3(2):1–4. Available from: https://www.oatext.com/the-eif2-kinase-gcn2-modulates-candida-albicans-virulence-to-caenorhabditis-elegans.php [Google Scholar]
- 37.Tan X, Fuchs BB, Wang Y, Chen W, Yuen GJ, Chen RB, et al. The role of Candida albicans SPT20 in filamentation, biofilm formation and pathogenesis. PLoS One. 2014;9(4):1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.de Barros PP, Scorzoni L, Ribeiro F de C, Fugisaki LR de O, Fuchs BB, Mylonakis E, et al. Lactobacillus paracasei 28.4 reduces in vitro hyphae formation of Candida albicans and prevents the filamentation in an experimental model of Caenorhabditis elegans. Microb Pathog [Internet]. 2018;117(November 2017):80–7. Available from: 10.1016/j.micpath.2018.02.019 [DOI] [PubMed] [Google Scholar]
- 39.Pinto M, Robineleon S, Appay MD, Kedinger M, Triadou N, Dussaulx E, et al. Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biol Cell [Internet]. 1983. January 1 [cited 2018 Oct 10];47:323–30. Available from: https://www.scienceopen.com/document?vid=07f3fdcd-c23c-47d4-ad63-105346ef5453 [Google Scholar]
- 40.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. 2007. [cited 2017 Jun 14];8(2). Available from: http://download.springer.com/static/pdf/804/art%253A10.1186%252Fgb-2007-8-2-r19.pdf?originUrl=http%3A%2F%2Fgenomebiology.biomedcentral.com%2Farticle%2F10.1186%2Fgb-2007-8-2-r19&token2=exp=1497424427~acl=%2Fstatic%2Fpdf%2F804%2Fart%25253A10.1186%25252Fgb-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Semple JI, Garcia-Verdugo R, Lehner B. Rapid selection of transgenic C. elegans using antibiotic resistance. Nat Methods [Internet]. 2010. September 22 [cited 2017 Apr 13];7(9):725–7. Available from: http://www.ncbi.nlm.nih.gov/pubmed/20729840 [DOI] [PubMed] [Google Scholar]
- 43.Hoogewijs D, Houthoofd K, Matthijssens F, Vandesompele J, Vanfleteren JR. Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans. BMC Mol Biol [Internet]. 2008. January 22 [cited 2017 Apr 13];9:9 Available from: http://www.ncbi.nlm.nih.gov/pubmed/18211699 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Nakagawa H, Shiozaki T, Kobatake E, Hosoya T, Moriya T, Sakai F, et al. Effects and mechanisms of prolongevity induced by Lactobacillus gasseri SBT2055 in Caenorhabditis elegans. Aging Cell. 2016;15(2):227–36. 10.1111/acel.12431 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.R Core Team. R: A language and Environment for Statistical Computing [Internet]. Vienna, Austria: R Foundation for Statistical Computing; 2018. https://www.r-project.org/ [Google Scholar]
- 46.Therneau TM. _A Package for Survival Analysis in S_. 2015.
- 47.Kassambara A, Kosinski M. survminer: Drawing Survival Curves using “ggplot2.” 2017.
- 48.Fatima S, Haque R, Jadiya P, Shamsuzzama, Kumar L, Nazir A. Ida-1, the Caenorhabditis elegans orthologue of mammalian diabetes autoantigen IA-2, potentially acts as a common modulator between Parkinson’s disease and diabetes: Role of Daf-2/Daf-16 insulin like signalling pathway. PLoS One. 2014;9(12). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Jankowska A, Laubitz D, Antushevich H, Zabielski R, Grzesiuk E. Competition of Lactobacillus paracasei with Salmonella enterica for adhesion to Caco-2 cells. J Biomed Biotechnol. 2008;2008(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Nowak A, Motyl I, Śliżewska K, Libudzisz Z, Klewicka E. Adherence of probiotic bacteria to human colon epithelial cells and inhibitory effect against enteric pathogens–In vitro study. Int J Dairy Technol. 2016;69(4):532–9. [Google Scholar]
- 51.Allonsius CN, van den Broek MFL, De Boeck I, Kiekens S, Oerlemans EFM, Kiekens F, et al. Interplay between Lactobacillus rhamnosus GG and Candida and the involvement of exopolysaccharides. Microb Biotechnol. 2017;10(6):1753–63. 10.1111/1751-7915.12799 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Ruas-Madiedo P, Gueimonde M, Margolles A, de los Reyes-Gavilan CG, Salminen S. Exopolysaccharides Produced by Probiotic Strains Modify the Adhesion of Probiotics and Enteropathogens to Human Intestinal Mucus. J Food Prot [Internet]. 2006;69(8):2011–5. Available from: http://jfoodprotection.org/doi/abs/10.4315/0362-028X-69.8.2011 [DOI] [PubMed] [Google Scholar]
- 53.Irazoqui JE, Troemel ER, Feinbaum RL, Luhachack LG, Cezairliyan BO, Ausubel FM. Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus. PLoS Pathog. 2010;6(7):1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Wu K, Conly J, McClure JA, Elsayed S, Louie T, Zhang K. Caenorhabditis elegans as a host model for community-associated methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect. 2010;16(3):245–54. 10.1111/j.1469-0691.2009.02765.x [DOI] [PubMed] [Google Scholar]
- 55.Souza ACR, Fuchs BB, Alves V de S, Jayamani E, Colombo AL, Mylonakis E. Pathogenesis of the Candida parapsilosis complex in the model host Caenorhabditis elegans. Genes (Basel). 2018;9(8). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Park MR, Ryu S, Maburutse BE, Oh NS, Kim SH, Oh S, et al. Probiotic Lactobacillus fermentum strain JDFM216 stimulates the longevity and immune response of Caenorhabditis elegans through a nuclear hormone receptor. Sci Rep [Internet]. 2018. [cited 2019 Jan 3];8(1):7441 Available from: www.nature.com/scientificreports/ [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Kim Y, Mylonakis E. Caenorhabditis elegans immune conditioning with the probiotic bacterium Lactobacillus acidophilus strain ncfm enhances gram-positive immune responses. Infect Immun. 2012;80(7):2500–8. 10.1128/IAI.06350-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Ikeda T, Yasui C, Hoshino K, Arikawa K, Nishikawa Y. Influence of lactic acid bacteria on longevity of Caenorhabditis elegans and host defense against Salmonella enterica serovar Enteritidis. Appl Environ Microbiol. 2007;73(20):6404–9. 10.1128/AEM.00704-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Zhao L, Zhao Y, Liu R, Zheng X, Zhang M, Guo H, et al. The transcription factor DAF-16 is essential for increased longevity in C. elegans Exposed to Bifidobacterium longum BB68. Sci Rep [Internet]. 2017;7(1):7408 Available from: http://www.nature.com/articles/s41598-017-07974-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Zanni E, Laudenzi C, Schifano E, Palleschi C, Perozzi G, Uccelletti D, et al. Impact of a complex food microbiota on energy metabolism in the model organism Caenorhabditis elegans. Biomed Res Int. 2015;2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Guantario B, Zinno P, Schifano E, Roselli M, Perozzi G, Palleschi C, et al. In Vitro and in Vivo selection of potentially probiotic lactobacilli from nocellara del belice table olives. Front Microbiol. 2018;9(MAR):595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Phelan JP, Rose MR. Why dietary restriction substantially increases longevity in animal models but won’t in humans. Ageing Res Rev. 2005;4(3):339–50. 10.1016/j.arr.2005.06.001 [DOI] [PubMed] [Google Scholar]
- 63.Smith ED, Kaeberlein TL, Lydum BT, Sager J, Welton KL, Kennedy BK, et al. Age- and calorie-independent life span extension from dietary restriction by bacterial deprivation in Caenorhabditis elegans. BMC Dev Biol. 2008;8:1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Heestand BN, Shen Y, Liu W, Magner DB, Storm N, Meharg C, et al. Dietary Restriction Induced Longevity Is Mediated by Nuclear Receptor NHR-62 in Caenorhabditis elegans. PLoS Genet. 2013;9(7). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Komura T, Ikeda T, Yasui C, Saeki S, Nishikawa Y. Mechanism underlying prolongevity induced by bifidobacteria in Caenorhabditis elegans. Biogerontology. 2013;14(1):73–87. 10.1007/s10522-012-9411-6 [DOI] [PubMed] [Google Scholar]
- 66.Tullet JMA. DAF-16 target identification in C. elegans: past, present and future. Biogerontology [Internet]. 2015;16(2):221–34. Available from: http://link.springer.com/10.1007/s10522-014-9527-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Grompone G, Martorell P, Llopis S, González N, Genovés S, Mulet AP, et al. Anti-Inflammatory Lactobacillus rhamnosus CNCM I-3690 Strain Protects against Oxidative Stress and Increases Lifespan in Caenorhabditis elegans. PLoS One. 2012;7(12). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Breger J, Fuchs BB, Aperis G, Moy TI, Ausubel FM, Mylonakis E. Antifungal chemical compounds identified using a C. elegans pathogenicity assay. PLoS Pathog. 2007;3(2):0168–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Evrard B, Coudeyras S, Dosgilbert A, Charbonnel N, Alamé J, Tridon A, et al. Dose-dependent immunomodulation of human dendritic cells by the probiotic Lactobacillus rhamnosus Lcr35. PLoS One. 2011;6(4):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Singh V, Aballay A. Regulation of DAF-16-mediated Innate Immunity in Caenorhabditis elegans. J Biol Chem [Internet]. 2009. December 18 [cited 2018 Dec 14];284(51):35580–7. Available from: http://www.ncbi.nlm.nih.gov/pubmed/19858203 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the paper.