Severe Fever with Thrombocytopenia Syndrome Virus Infection or Mixed Infection with Scrub Typhus in South Korea in 2000–2003

Abstract.

Severe fever with thrombocytopenia syndrome is a tick-borne viral disease, with a high mortality rate that was first reported in China in 2009. Scrub typhus is an acute febrile illness caused by Orientia tsutsugamushi, a bacterium transmitted to humans through chigger mite bites. Severe fever with thrombocytopenia syndrome and scrub typhus are endemic to South Korea. To investigate evidence of severe fever with thrombocytopenia syndrome virus (SFTSV) infection or mixed infection with scrub typhus in South Korea, we examined 2,329 sera samples collected from patients presenting from November 1, 2000, to November 1, 2003, for the diagnosis of rickettisal diseases at Seoul National University, Seoul, South Korea. We found retrospective evidence of SFTSV infection or mixed infection with scrub typhus in South Korea in 2000–2003. Severe fever with thrombocytopenia syndrome virus infections in South Korea occurred before previously reported cases and were more concurrent with those in China. It is important to consider SFTSV infection in patients with scrub typhus.

INTRODUCTION

Severe fever with thrombocytopenia syndrome virus (SFTSV) is a tick-borne virus of the genus Banyangvirus, family Phenuiviridae, and order Bunyavirales that can cause hemorrhagic fever.¹ Severe fever with thrombocytopenia syndrome (SFTS) was first confirmed in China in 2009, and retrospective serological studies showed that SFTSV-specific IgM and IgG were detected in the sera of patients in China in 1996 and retrospectively reported in South Korea in 2010, in Japan in 2013, and in Vietnam in 2017.^2–6 Most SFTSV infections occur through bites from the tick Haemaphysalis longicornis, although SFTSV transmission can also occur through close contact with an infected patient.^2–11

Scrub typhus is a bacterial disease caused by Orientia tsutsugamushi that is transmitted primarily by the bite of the Leptotrombidium spp. (Acari: Trombiculidae) infected with Orientia species, which is endemic in the “tsutsugamushi triangle” within the Asia-Pacific region. Mixed infections with SFTSV and O. tsutsugamushi in a patient have been reported.^8,9

In South Korea, SFTS and scrub typhus are endemic and are major public health concerns between May and November and between October and November, respectively.^8,9

The clinical presentations of SFTS and scrub typhus are similar at the early stage of infection: signs and symptoms typically develop within 1 and 2 weeks of infection and include fever, headache, malaise, and gastrointestinal symptoms, but SFTS exhibits a higher mortality rate than scrub typhus.^2–11

In this study, we provide retrospective evidence of SFTSV infections or mixed infection with O. tsutsugamushi in patients’ sera collected in South Korea from 2000 to 2003. These findings confirmed that SFTSV infections in South Korea occurred earlier than reported in South Korea and Japan and were more concurrent with those in China. Considering SFTSV infection in patients with scrub typhus is also important for clinical diagnosis.^2–5,8,9

MATERIALS AND METHODS

To investigate evidence of SFTSV or mixed infection with scrub typhus in South Korea, we examined 2,329 sera samples of patients from 2000 to 2003 for the diagnosis of rickettisal diseases at Seoul National University, Seoul, South Korea. The patients suffered from acute febrile illness from November 1, 2000, to November 1, 2003. This study was approved by the Institutional Review Board of Seoul National University Hospital.

Molecular analysis.

Molecular diagnosis and phylogenetic analysis of SFTSV were conducted. RNA was extracted from stored patients’ sera using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany). Two rounds of reverse transcription–polymerase chain reaction (RT-PCR) were performed to amplify the partial small (S) segment of the viral RNA from the stored serum and to confirm SFTSV infection.^10,11 The partial RT-PCR products (114 and 346 bp, respectively) were sequenced using the BigDye Terminator Cycle Sequencing Kit (Perkin Elmer Applied Biosystems, Warrington, United Kingdom); phylogenetic analysis of partial S segment sequences (346 bp) was performed with MEGA6, and phylogenetic trees were constructed using the maximum likelihood method, which confirmed SFTSV infection (Figure 1).^10,11

Figure 1.

Phylogenetic tree constructed based on partial S segment sequences (346 bp) of severe fever with thrombocytopenia syndrome virus. The tree was constructed using the maximum likelihood method with MEGA6. The partial S sequences from the stored sera collected from November 1, 2000, to November 1, 2003, that were analyzed in this study are shown in bold. The partial S sequence data for the viruses identified in China, South Korea, and Japan were obtained from NCBI/BLAST.

Molecular diagnosis and phylogenetic analysis of the genotype of O. tsutsugamushi were conducted. DNA was extracted from stored patients’ sera samples using the QIAamp DNA Mini Kit (QIAGEN). Nested PCR (forward primer: GATCAAGCTTCCTCAGCCTACTATAATGCC, reverse primer: CGACAGATGCACTATTAGGC) was performed to amplify the 56-kDa antigen of O. tsutsugamushi from the stored serum, confirming O. tsutsugamushi infection.¹² Nested PCR products (483 bp) were sequenced using the BigDye Terminator Cycle Sequencing Kit (Perkin Elmer Applied Biosystems). Phylogenetic analysis of O. tsutsugamushi 56-kDa gene sequences (483 bp) was performed with MEGA6 to determine the genotype of O. tsutsugamushi by comparing with the sequences from proto-genotypes, and phylogenetic trees were constructed using the maximum likelihood method, which confirmed O. tsutsugamushi infection (Figure 2).^9,12,13

Figure 2.

Phylogenetic tree constructed based on the Orientia tsutsugamushi 56-kDa gene sequences. The tree was constructed using the maximum likelihood method with MEGA6. The O. tsutsugamushi 56-kDa gene sequences from stored patient serum are shown in bold. The O. tsutsugamushi 56-kDa gene sequence data identified from China, South Korea, Japan, and India were obtained from NCBI/BLAST.

Serologic testing for SFTSV and scrub typhus exposure.

Antibody detection in sera was carried out. An immunofluorescence assay (IFA) for SFTSV and scrub typhus was performed as previously described.⁷ L929 cells infected with three genotypes of O. tsutsugamushi (Boryong, Karp, and Gilliam strain) were mixed in equal amounts and used for IFA for scrub typhus.¹⁴ ELISA for SFTSV and scrub typhus was also performed as previously described.⁷ The cutoff value was set as the average absorbance value of the control sera (sera from healthy donors) plus three times the SD (mean absorbance + 3 × SD). A sample was considered positive if it yielded an absorbance value greater than the cutoff value.

RESULTS

Phylogenetic analysis of the partial S segment of SFTSV and serology study.

The partial S segment sequences of SFTSV were detected in nine patients by two rounds of RT-PCR, and the resulting phylogenetic tree of the partial S segment showed that the isolates were similar to those from China, South Korea, and Japan (Figure 1).¹⁰

Two thousand three hundred twenty-nine sera samples were tested for IgM and IgG antibodies against SFTSV using IFA and ELISA, and the results of the ELISA and IFA, which were used to detect IgM and IgG antibodies, showed that SFTSV-specific IgM or IgG antibodies were detected in the serum of the 12 patients (0.52%, 12/2,392) (Table 1). Ten of these 12 patients (83.33%) were potentially mixed-infected with scrub typhus as determined by serological diagnosis or bacterial DNA detection by nested PCR (Table 1). Nine of 2,329 sera (0.39%, 9/2,329) were clearly positive for SFTSV RNA.

Table 1.

Patients of SFTSV infection or mixed infection with scrub typus in this study

No	Patients	Year of sampling	Age (years)/Sex	SFTSV (RT-PCR)	IgM of SFTSV (ELISA)	IgG of SFTSV (ELISA)	IgG of SFTSV (IFA)	Scrub typhus (IFA)	Scrub typhus (nested PCR)
1	00–27,690	November 2000	NA	SFTSV	N	P	160	2,560	N
2	01–28,360	October 2001	65/F	N	N	P	N	2,560	Karp
3	02–290	November 2002	56/M	N	P	P	N	2,560	Karp
4	02–431	December 2002	81/M	SFTSV	N	P	160	N	N
5	02–167	November 2002	63/M	N	P	P	N	2,560	Boryong
6	03–1,183	November 2003	60/F	SFTSV	P	P	N	2,560	N
7	02–140	November 2002	70/F	SFTSV	P	P	2,560	2,560	Gilliam
8	03–119	March 2003	76/F	SFTSV	N	P	2,560	N	N
9	03–323	June 2003	70/M	SFTSV	N	P	2,560	N	Karp
10	03–965	November 2003	NA	SFTSV	N	P	2,560	40	Gilliam
11	03–194	May 2003	84/F	SFTSV	N	P	640	160	N
12	03–975	November 2003	69/F	SFTSV	P	P	N	640	N

IFA = immunofluorescence assay; NA = not available; N = negative; P = positive; RT-PCR = reverse transcription–polymerase chain reaction; SFTSV = severe fever with thrombocytopenia syndrome virus.

Phylogenetic analysis of the partial S segment of O. tsutsugamushi and serology study.

Twelve sera samples positive for anti-SFTSV NP IgG by ELISA were tested for IgG antibodies against O. tsutsugamushi using IFA. The IFA results used to detect IgG antibodies showed that O. tsutsugamushi–specific IgG antibodies were detected in the sera of the nine patients (Table 1). The 56-kDa gene sequence (483 bp) of O. tsutsugamushi was detected in six patients by nested PCR, and the resulting phylogenetic tree showed that the isolates were O. tsutsugamushi (Figure 2).^9,12 Based on the results of genetic detection of the two pathogens, three of the nine SFTSV RNA-positive (33.3%) patients were coinfected with both pathogens.

DISCUSSION

Severe fever with thrombocytopenia syndrome is a new emerging viral disease in Asia that infects humans primarily through tick bites, and transmission via person-to-person contact has also been reported.^2–11 Severe fever with thrombocytopenia syndrome virus was previously reported in South Korea in 2010, and in this study, we retrospectively confirmed 12 SFTSV infections or mixed infection with O. tsutsugamushi by amplification of the partial S segment of the viral RNA and the bacterial DNA, as well as detection of IgM and/or IgG antibodies against SFTSV and O. tsutsugamushi from the stored sera of patients who had acute febrile illness from November 1, 2000 to November 1, 2003, in South Korea.^4,8,9

Based on genetic detection of the pathogens in sera samples, at least nine patients among 12 patients were clearly positive for SFTSV infection and six were positive for scrub typhus. Among them, three were positive only for scrub typhus and three patients were positive for both pathogens. Positive rate for scrub typhus is 33.3% (3/9), among nine SFTSV RNA-positive patients. Therefore, we suggest that SFTSV infections in South Korea occurred before previously reported cases and were more concurrent with those in China. Further clinical, epidemiological, and laboratory research is also needed to better understand the ecological transmission dynamics and geographic distribution of SFTSV and O. tsutsugamushi.