Abstract
Premise
Microsatellite markers were developed in Echinomastus johnsonii (Cactaceae) for use in several morphologically similar, closely related taxa within the genus to study genetic structure and diversity within and among individuals and populations.
Methods and Results
Using reads from shallow, whole genome Illumina HiSeq high‐throughput sequencing, we developed and characterized 15 microsatellite primer pairs for E. johnsonii, E. erectocentrus var. erectocentrus, E. erectocentrus var. acunensis, and E. intertextus. Of the 15 microsatellite markers, 14 amplified successfully and were polymorphic in three of the four taxa tested, with the exception of three markers in E. intertextus. In E. johnsonii, the number of alleles ranged from one to 15 and levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and 0.000 to 0.917, respectively.
Conclusions
These markers will be useful for investigating population genetics and clarifying taxonomic relationships of E. johnsonii and congeneric species.
Keywords: Cactaceae, conservation genetics, Echinomastus, microsatellites, Sclerocactus, species boundaries
Echinomastus Britton & Rose (Cactaceae, Caryophyllales) is made up of seven taxa distributed in the arid regions of the southwestern United States and northwestern Mexico (Zimmerman and Parfitt, 2003). From the seven taxa described in Echinomastus, relationships among E. johnsonii (Parry ex Engelm.) E. M. Baxter, E. erectocentrus (J. M. Coult.) Britton & Rose var. erectocentrus, and E. erectocentrus var. acunensis (W. T. Marshall) Bravo have been difficult to resolve due to geographic proximity and morphological similarity (Baker, 2012). These taxa have recently been targeted for conservation concerns—particularly E. erectocentrus var. acunensis—a taxon with a very restricted range threatened by drought and climate change, predation by insects and small mammals, habitat degradation and loss, and non‐native and invasive plants. Microsatellite markers are needed to provide information about genetic similarities and differences among the closely related taxa E. johnsonii, E. erectocentrus var. erectocentrus, and E. erectocentrus var. acunensis within the context of morphological variation and geographic distribution, and will be useful for understanding overall differentiation and evolutionary relationships between these taxa.
Recent studies have revealed a close relationship between the genera Echinomastus and Sclerocactus Britton & Rose (Baker and Porter, 2016), suggesting microsatellite primers developed in Sclerocactus could be applied to taxa within Echinomastus. However, amplifications of 13 microsatellite regions developed for S. glaucus (K. Shum.) L. D. Benson (Schwabe et al., 2013) and seven microsatellite regions developed for S. brevihamatus (Engelm.) D. R. Hunt subsp. tobuschii (W. T. Marshall) N. P. Taylor (Rayamajhi and Sharma, 2017) were successful in Echinomastus for only two markers, thus creating the need to develop additional markers specifically for use in Echinomastus.
MATERIALS AND METHODS
Genomic DNA was extracted from silica‐dried tepal tissue using the procedure for the E.Z.N.A. SP Plant DNA Kit (Omega Bio‐tek, Norcross, Georgia, USA). Extracted DNA was sent to RAPiD Genomics (Gainesville, Florida, USA) for shotgun library preparation and 2 × 150 bp paired‐end Illumina HiSeq sequencing (Straub et al., 2012). Genome‐skimming sequence data were obtained from two individuals of E. johnsonii, one E. erectocentrus var. erectocentrus, one E. erectocentrus var. acunensis, and one E. intertextus (Engelm.) Britton & Rose, which was used as an outgroup taxon. Raw sequence reads from each taxon sample were placed into the bioinformatics pipeline Palfinder available through the open‐source bioinformatics gateway Galaxy (Griffiths et al., 2016). Paired‐end reads were run through FastQC and Trimmomatic with a minimum length of 50 bp and Phred scores of 20 using a sliding window of 4 bp, quality score of 20, leading and trailing of 4, and “minlen” of 50 (Andrews, 2010; Bolger et al., 2014). Microsatellite regions were selected using a default option of a minimum of 8 for 2‐mer, 3‐mer, 4‐mer, 5‐mer, and 6‐mer repeat units. Default settings for Primer3 were used to design primers (Rozen and Skaletsky, 1999). After processing of our genome‐skimming sequence data from each taxon sample through this pipeline, we examined the “optimal regions” output file and selected 33 microsatellite regions for initial testing on 7–32 individuals from all four taxa, relying primarily on primer sequences obtained from E. johnsonii. We selected these microsatellite regions for testing based on the type of repeat, favoring repeat units of 3–6 bp, or the occurrence of the microsatellite region in more than one taxon sample. Primers were acquired for each of the selected microsatellite regions (successful primer sequences are shown in Table 1; unsuccessful primer sequences are available upon request). Sequence library data were deposited into the National Center for Biotechnology Information Sequence Read Archive (BioProject ID PRJNA554465).
Table 1.
Characteristics of 15 microsatellite markers developed in Echinomastus johnsonii.
| Locus | Primer sequences (5′–3′)a | Repeat motif | Allele size range (bp) | T a (°C) | Identifierb |
|---|---|---|---|---|---|
| ECHMA1 | F: GGGGAGCTTGGTGTGTGC | (AAG)39 | 167–220 | 52.3 | MN187046 |
| R: CCTCTTGGGCTCAATGTTGC | |||||
| ECHMA3 | F: TTCCCCAAAACGGACATAGC | (TAA)54 | 301–369 | 50.0 | MN187047 |
| R: CGTTATTCACACAAAGCGAGC | |||||
| ECHMA4 | F: CAACTCAACTGCCCATGTCC | (TC)30 | 249–282 | 50.6 | MN187048 |
| R: TTTGAGGGGTTGTTTCGAGG | |||||
| ECHMA5 | F: GGGTGTGTGTTGTTGACACG | (TC)34 | 219–272 | 47.4 | SAMN12268377 |
| ST‐E00272:268:H5GKCALXX:2:2113:3610:61116 | |||||
| R: CAAAACCCTGAATTTCACACG | |||||
| ECHMA6 | F: CGCGGTTTAATCTCATGTGG | (TC)30 | 164–209 | 49.2 | MN187049 |
| R: GCGTAGGAATTAGAAGCATGGC | |||||
| ECHMA10 | F: TGACAATGGGTAAGGGATGC | (GATAT)35 | 278–308 | 50.1 | MN187050 |
| R: ACTCAGGTGATGAGAATGTTGC | |||||
| ECHMA13 | F: AATGAATGATGAGGGGAGGG | (ATAC)40 | 444–520 | 46.4 | MN187051 |
| R: TGTTTCGAAATAACCGAAATACG | |||||
| ECHMA16 | F: AGATGCTTGAAACCAAGGGG | (TTC)45 | 397–442 | 50.5 | SAMN12268378 |
| E00438:215:H3JHJCCXY:8:2116:21684:49144 | |||||
| R: TCTTAGCAAGGCCCAGATCC | |||||
| ECHMA17 | F: TTGTTTCACGTATCCCTGCC | (ATT)30 | 189–246 | 50.6 | MN187052 |
| R: CACTGGCCCAATGACATAGC | |||||
| ECHMA19 | F: GCTGGAAGGAACATTAAGGGC | (TC)18 | 308–330 | 52.1 | SAMN12268375 |
| E00224:287:HNMG5CCXX:5:1120:13860:31758 | |||||
| R: CCCCTTACAGTCAGCAACCC | |||||
| ECHMA21 | F: AAGGGGAGAGTCAAAAGCCC | (TC)28 | 339–370 | 50.6 | SAMN12268378 |
| E00224:287:HNMG5CCXX:5:2124:5181:28295 | |||||
| R: TCATCAGTTTCTGCTTAAAGGAACC | |||||
| ECHMA23 | F: CAGAACCAAAGGTTGCCAGC | (TC)40 | 229–268 | 50.5 | SAMN12268379 |
| E00438:215:H3JHJCCXY:8:2224:25976:38790 | |||||
| R: TGTTAAACAATCCCTCTCATGCC | |||||
| ECHMA24 | F: CTTTCTCCCTCCCAAAACCC | (GAT)24 | 321–375 | 49.7 | MN187053 |
| R: GGTAAATATATGGCAACAAACGACG | |||||
| ECHMA25 | F: GGAAGAATGTCATCATGTTTATTTGG | (GA)20 | 215–251 | 47.6 | MN187054 |
| R: TTGGAAAAGAAATTTGGGGC | |||||
| ECHMA26 | F: AAAACAGTTCAATCATTCAGACAGC | (TC)34 | 643 | 50.0 | SAMN12268377 |
| ST‐E00272:268:H5GKCALXX:2:1220:8907:34078 | |||||
| R: GTCATGAACTAGCCGTTGGG |
T a = annealing temperature.
Three primers were used in each reaction: a 5′‐CAGTCGGGCGTCATCA‐3′ tagged forward primer, a 5′‐GTTT‐3′ tagged reverse primer, and a 5′‐CAGTCGGGCGTCATCA‐3′ FAM‐labeled primer.
Numbers are either Illumina sequence identifiers associated with NCBI's Sequence Read Archive BioProject ID no. PRJNA554465 (BioSample numbers: SAMN12268377, SAMN12268378, SAMN12268375, SAMN12268379) or GenBank accession numbers.
After initial screenings, amplifications of some of the selected regions were further tested in 118 individual DNA samples from nine populations that included 47 E. johnsonii, 23 E. erectocentrus var. acunensis, 30 E. erectocentrus var. erectocentrus, and 18 for the outgroup, E. intertextus (Appendix 1). PCR was set up in 12.5‐μL volume reactions containing 5.92 μL of nuclease‐free water, 1.25 μL of Promega 5× PCR buffer (Promega, Madison, Wisconsin, USA), 1.0 μL of 25 mM MgCl2, 1.0 μL of 10 mM dNTPs, 1.25 μL of 10× bovine serum albumin, 0.225 μL of 10 μM 5′‐GTTT‐3′ tagged primer, 0.025 μL of 10 μM 5′‐CAGTCGGGCGTCATCA‐3′ tagged primer, 0.23 μL of 10 μM 5′‐CAGTCGGGCGTCATCA‐3′ FAM‐labeled primer, 0.10 μL of GoTaq DNA Polymerase (5 U/μL; Promega), and 1.5 μL of DNA template (5 ng/μL). Thermocycling conditions (Mastercycler Pro; Eppendorf, Westbury, New York, USA) consisted of a touchdown protocol with an initial denaturation step of 2 min at 94°C; followed by 20 cycles of 96°C for 30 s, 60°C for 30 s (decreased 0.5°C per cycle), and 72°C for 30 s; 20 cycles of 96°C for 30 s, 50°C for 30 s, and 72°C for 30 s; and a final elongation step of 10 min at 72°C.
Amplification products were screened on a 1.5% agarose gel and visualized using SYBR Safe (Invitrogen, Mulgrave, Australia) to determine if the reaction was successful. PCR products were purified and run on an ABI 3730 Capillary Electrophoresis Sequencer at the Arizona State University DNA sequencing facility (Phoenix, Arizona, USA) using a LIZ 600 internal size standard (Applied Biosystems, Waltham, Massachusetts, USA). Microsatellites were scored and binned using the program Geneious version 10.2.3 (Biomatters, Aukland, New Zealand) and its microsatellite plugin version 1.4.4 (Kearse et al., 2012). The number of observed alleles per locus and levels of expected heterozygosity and observed heterozygosity were calculated using the R package adegenet (Jombart, 2008). MICRO‐CHECKER version 2.2.3 was used to check for the presence of null alleles, scoring errors, and large allele dropouts (van Oosterhout et al., 2004).
Of the 33 primer pairs tested, 15 showed clear amplification and were analyzed in more detail (Table 1). Only one marker (ECHMA26) was monomorphic and inconsistently amplified across our samples. This primer was excluded from further analysis. In E. johnsonii, the average number of alleles across all loci was 6.64 (±3.40 SE; range 1–15) and levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and 0.000 to 0.917, respectively (Table 2). Two loci (ECHMA13 and ECHMA17) were detected to have a high frequency of null alleles. Ten of 42 comparisons deviated from Hardy–Weinberg equilibrium, but no loci deviated across all three populations (Table 2). These 14 markers also amplified in the closely related taxa E. erectocentrus var. erectocentrus and E. erectocentrus var. acunensis, and 12 markers amplified in the outgroup species E. intertextus (Table 3).
Table 2.
Genetic properties of 14 polymorphic microsatellite markers developed for Echinomastus johnsonii characterized in three populations from the United States.a
| Locus | Wickenburg (n = 18) | Searchlight (n = 16) | Moapa (n = 13) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e b | A | H o | H e b | A | H o | H e b | |
| ECHMA1 | 4 | 0.278 | 0.295 | 5 | 0.312 | 0.459 | 7 | 0.846 | 0.751 |
| ECHMA3 | 12 | 0.611 | 0.872 | 13 | 0.867 | 0.898 | 11 | 0.923 | 0.885 |
| ECHMA4 | 3 | 1.000 | 0.595** | 6 | 1.000 | 0.658*** | 9 | 0.923 | 0.861 |
| ECHMA5 | 13 | 0.938 | 0.887 | 10 | 0.533 | 0.840* | 15 | 0.923 | 0.917 |
| ECHMA6 | 10 | 0.722 | 0.710 | 6 | 0.600 | 0.676 | 7 | 1.000 | 0.843 |
| ECHMA10 | 2 | 0.056 | 0.054 | 1 | 0.000 | 0.000 | 2 | 0.273 | 0.483 |
| ECHMA13 | 5 | 0.267 | 0.678*** | 3 | 0.250 | 0.477*** | 6 | 0.769 | 0.683 |
| ECHMA16 | 9 | 0.778 | 0.826 | 7 | 0.688 | 0.711 | 3 | 0.167 | 0.288 |
| ECHMA17 | 11 | 0.600 | 0.840* | 7 | 0.286 | 0.635** | 10 | 1.000 | 0.851 |
| ECHMA19 | 5 | 0.278 | 0.698** | 5 | 0.562 | 0.609* | 5 | 0.923 | 0.651 |
| ECHMA21 | 6 | 0.333 | 0.525 | 3 | 0.312 | 0.275 | 4 | 0.385 | 0.435* |
| ECHMA23 | 9 | 0.722 | 0.767** | 9 | 0.875 | 0.850 | 10 | 0.833 | 0.799 |
| ECHMA24 | 2 | 0.118 | 0.111 | 4 | 0.375 | 0.600 | 6 | 0.846 | 0.751 |
| ECHMA25 | 8 | 0.824 | 0.813 | 8 | 0.750 | 0.711 | 9 | 1.000 | 0.860 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
Indicates significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.
Table 3.
Transferability of 14 polymorphic microsatellite markers developed for Echinomastus johnsonii in three morphologically similar taxa, E. erectocentrus var. erectocentrus, E. erectocentrus var. acunensis, and E. intertextus.a
| Locus | Echinomastus erectocentrus var. erectocentrus | Echinomastus erectocentrus var. acunensis | Echinomastus intertextus | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| San Manuel (n = 16) | Wilcox (n = 14) | Organ Pipe (n = 15) | Coffee Pot (n = 8) | Florida Gap (n = 11) | Anthony Gap (n = 7) | |||||||||||||
| A | H o | H e b | A | H o | H e b | A | H o | H e b | A | H o | H e b | A | H o | H e b | A | H o | H e b | |
| ECHMA1 | 8 | 0.938 | 0.850 | 11 | 0.857 | 0.867 | 11 | 0.800 | 0.742 | 4 | 0.857 | 0.704 | 2 | 0.333 | 0.278 | — | — | — |
| ECHMA3 | 10 | 0.667 | 0.876 | 10 | 0.692 | 0.873 | 9 | 0.769 | 0.837 | 9 | 0.500 | 0.836* | 3 | 0.500 | 0.406 | 5 | 0.200 | 0.780 |
| ECHMA4 | 3 | 0.562 | 0.639*** | 2 | 1.000 | 0.500*** | 6 | 0.733 | 0.764 | 6 | 0.857 | 0.735 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| ECHMA5 | 8 | 0.714 | 0.735 | 8 | 0.917 | 0.826 | 5 | 0.533 | 0.547*** | 3 | 0.250 | 0.227 | 2 | 0.364 | 0.298 | 3 | 0.286 | 0.449 |
| ECHMA6 | 9 | 0.688 | 0.803 | 12 | 1.000 | 0.827 | 4 | 0.533 | 0.578 | 6 | 0.875 | 0.805 | 1 | 0.000 | 0.000 | 4 | 0.571 | 0.663 |
| ECHMA10 | 4 | 0.600 | 0.576** | 6 | 0.214 | 0.783*** | 3 | 0.733 | 0.631 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.143 | 0.500 |
| ECHMA13 | 8 | 0.214 | 0.712*** | 12 | 0.615 | 0.873* | 7 | 0.733 | 0.760 | 4 | 0.167 | 0.514** | — | — | — | — | — | — |
| ECHMA16 | 9 | 0.438 | 0.695* | 6 | 0.429 | 0.758 | 7 | 0.867 | 0.729 | 4 | 0.857 | 0.684 | 2 | 0.000 | 0.198** | 2 | 0.667 | 0.444 |
| ECHMA17 | 9 | 0.438 | 0.859** | 10 | 0.571 | 0.867* | 6 | 0.533 | 0.840* | 2 | 0.000 | 0.469** | 1 | 0.000 | 0.000 | 5 | 0.333 | 0.694 |
| ECHMA19 | 4 | 0.688 | 0.719 | 5 | 0.643 | 0.724 | 1 | 0.000 | 0.000 | 5 | 0.875 | 0.688 | 3 | 1.000 | 0.607* | 4 | 0.333 | 0.708 |
| ECHMA21 | 6 | 0.786 | 0.763 | 7 | 0.786 | 0.740 | 8 | 0.600 | 0.707 | 4 | 0.625 | 0.680 | 4 | 0.455 | 0.649* | 5 | 0.714 | 0.714 |
| ECHMA23 | 11 | 0.875 | 0.879 | 11 | 0.857 | 0.839* | 8 | 0.867 | 0.820 | 8 | 0.857 | 0.827 | 11 | 0.818 | 0.860 | 9 | 0.833 | 0.833 |
| ECHMA24 | 2 | 0.111 | 0.278 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.333 | 0.500 | — | — | — | — | — | — |
| ECHMA25 | 4 | 0.438 | 0.449 | 4 | 0.429 | 0.526 | 3 | 0.133 | 0.127 | 4 | 0.625 | 0.578 | 2 | 0.091 | 0.087 | 1 | 0.000 | 0.000 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
Indicates significant deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.
CONCLUSIONS
This project resulted in the identification of 14 polymorphic microsatellite loci useful for quantifying genetic diversity within and among populations and taxa across their ranges of E. johnsonii, E. erectocentrus var. erectocentrus, E. erectocentrus var. acunensis, E. intertextus, and potentially other members in the genus Echinomastus. The application of these genetic markers to additional individuals and populations across all three ingroup taxa will provide a more complete picture of genetic diversity and structure of this morphologically similar group. Information obtained will be used to clarify taxonomic relationships and inform management decisions for E. erectocentrus var. acunensis, a taxon of conservation concern.
AUTHOR CONTRIBUTIONS
B.A.Z wrote the manuscript, assisted with field work, prepared samples for sequencing, and conducted microsatellite primer design, allele scoring, and analyses. S.D.F. conceived the project, supervised lab and fieldwork, assisted with microsatellite primer selection and analyses, and co‐authored the manuscript. J.K.D. and A.B.S. conducted lab work and reviewed the manuscript. A.W. conducted field and lab work and reviewed the manuscript.
ACKNOWLEDGMENTS
The authors would like to thank Kevin Fehlberg for his assistance in field collections. Research permits were provided by the U.S. Fish and Wildlife Service, USDA Forest Service, and U.S. Bureau of Land Management. This work was financially supported by the Cooperative Endangered Species Conservation Fund Traditional Section 6 Grant Segment 21 through the U.S. Fish and Wildlife Service and the Arizona Department of Agriculture.
APPENDIX 1. Locality and voucher information of sampled populations of Echinomastus johnsonii and three related taxa used in this study.
| Taxon | n | Voucher no. (Herbarium)a | Collection locality | Latitude | Longitude | Elevation (m) |
|---|---|---|---|---|---|---|
| E. johnsonii (Parry ex Engelm.) E. M. Baxter | 18 | Baker 16144 (ASU), Hodgson 29918 (DES) | Wickenburg | 34.22770 | −113.07170 | 892 |
| E. johnsonii | 16 | Baker 16543‐1, 2, 4 (ASU) | Searchlight | 35.48517 | −114.90201 | 1168 |
| E. johnsonii | 13 | Hodgson 25008A (DES) | Moapa | 36.76486 | −114.78257 | 672 |
| E. erectocentrus (J. M. Coult.) Britton & Rose var. erectocentrus | 16 | Baker 16117b | San Manuel | 32.50164 | −110.59955 | 1115 |
| E. erectocentrus var. erectocentrus | 14 | Baker 16119 (ASU) | Wilcox | 32.22778 | −110.08705 | 1474 |
| E. erectocentrus var. acunensis (W. T. Marshall) Bravo | 15 | Baker 7586 (ASU) | Organ Pipe | ** | ** | 512 |
| E. erectocentrus var. acunensis | 8 | Baker 15241 (ASU) | Coffee Pot | ** | ** | 721 |
| E. intertextus (Engelm.) Britton & Rose | 11 | Baker 16121 (ASU) | Florida Gap | 32.14774 | −107.60158 | 1461 |
| E. intertextus | 7 | Baker 16123 (ASU) | Anthony Gap | 32.00476 | −106.51643 | 1363 |
= GPS information excluded for rare populations; n = number of individuals.
Herbarium vouchers are located in Desert Botanical Garden Herbarium (DES) or Arizona State University Vascular Plant Herbarium (ASU), USA.
No physical voucher was available (observation record only).
Zumwalde, B. A. , Dahir J. K., Shaw A. B., Willis A., and Fehlberg S. D.. 2019. Characterization and development of microsatellite markers for Echinomastus johnsonii and congeneric taxa. Applications in Plant Sciences 7(11): e11302.
DATA AVAILABILITY
Sequence library data were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject ID PRJNA554465). Sequence information for the developed primers was deposited to NCBI; GenBank accession numbers are provided in Table 1.
LITERATURE CITED
- Andrews, S. 2010. FastQC: A quality control tool for high throughput sequence data. Website http://www.bioinformatics.babraham.ac.uk/projects/fastqc [accessed 6 January 2017].
- Baker, M. 2012. Echinomastus Britton & Rose Pineapple Cactus In Cronquist A., Holmgren A. H., Holmgren N. H., and Reveal J. L. [eds.], Vascular plants of the Intermountain West, U.S.A., Vol. 2, Part A, 445–446. New York Botanical Garden Press, Bronx, New York, USA. [Google Scholar]
- Baker, M. , and Porter J. M.. 2016. The use of multivariate analyses of morphological characters and DNA analyses for assessing the taxonomic ranking of rare plant taxa: An example comparing populations of Echinomastus erectocentrus var. acunensis with those of its relatives E. erectocentrus var. erectocentrus and E. johnsonii In Quinn M. [ed.], Endangered species: Threats, conservation and future research, 19–61. Nova Science Publishers, Hauppauge, New York, USA. [Google Scholar]
- Bolger, A. M. , Lohse M., and Usadel B.. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Griffiths, S. M. , Fox G., Briggs P. J., Donaldson I. J., Hood S., Richardson P., Leaver G. W., et al. 2016. A Galaxy‐based bioinformatics pipeline for optimised, streamlined microsatellite development from Illumina next‐generation sequencing data. Conservation Genetics Resources 8: 481–486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jombart, T. 2008. Adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 24: 1403–1405. [DOI] [PubMed] [Google Scholar]
- Kearse, M. , Moir R., Wilson A., Stones‐Havas S., Cheung M., Sturrock S., Buxton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rayamajhi, N. , and Sharma J.. 2017. Genetic diversity and structure of a rare endemic cactus and an assessment of its genetic relationship with a more common congener. Genetica 3: 329–340. [DOI] [PubMed] [Google Scholar]
- Rozen, S. , and Skaletsky H.. 1999. Primer3 on the WWW for general users and for biologist programmers In Misener S. and Krawetz S. A. [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Schwabe, A. L. , Hubbard A. R., Neale J. R., and McGlaughlin M. E.. 2013. Microsatellite loci development for rare Colorado Sclerocactus (Cactaceae). Conservation Genetics Resources 5: 69–72. [Google Scholar]
- Straub, S. C. K. , Parks M., Weitemier K., Fishbein M., Cronn R. C., and Liston A.. 2012. Navigating the tip of the genomic iceberg: Next‐generation sequencing for plant systematics. American Journal of Botany 99: 349–364. [DOI] [PubMed] [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Zimmerman, A. D. , and Parfitt B. D.. 2003. Echinomastus In Flora of North America Editorial Committee [eds.], Flora of North America North of Mexico, Vol. 4, 194–195. Oxford University Press, New York, New York, USA. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence library data were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject ID PRJNA554465). Sequence information for the developed primers was deposited to NCBI; GenBank accession numbers are provided in Table 1.