Abstract
Salmonella spp. is one of the most common foodborne infectious pathogen. This study aimed to develop a real-time nucleic acid sequence–based amplification (NASBA) assay for detecting Salmonella in foods. Primers and a molecular beacon targeting the Salmonella-specific xcd gene were designed for mRNA transcription, and 48 Salmonella and 18 non-Salmonella strains were examined. The assay showed a high specificity and low detection limit for Salmonella (7 × 10−1 CFU/mL) after 12 h of pre-enrichment. Importantly, it could detect viable cells. Additionally, the efficacy of the NASBA assay was examined in the presence of pork background microbiota; it could detect Salmonella cells at 9.5 × 103 CFU/mL. Lastly, it was successfully used to detect Salmonella in pork, beef, and milk, and its detection limit was as low as 10 CFU/25 g (mL). The real-time NASBA assay developed in this study may be useful for rapid, specific, and sensitive detection of Salmonella in food of animal origin.
Keywords: Salmonella spp., Real-time NASBA, Food, Detection
Introduction
Salmonella spp. is the leading cause of foodborne illnesses worldwide. Infection with these bacteria causes typhoid fever, gastroenteritis, and septicemia and may even be fatal [1]. To date, more than 93 million humans have been infected by Salmonella spp., and 155,000 deaths have been reported [2, 3]. A study found that 11% of all foodborne illnesses in the USA were caused by Salmonella, making it the most prevalent foodborne pathogen [4]. It has long been recognized that food animals in particular play an important role in the dissemination of Salmonella. Therefore, there is a zero tolerance for Salmonella in processing quality assurance for food animals [5, 6].
The genus Salmonella currently includes two broad species: Salmonella bongori and Salmonella enterica. S. enterica is further subdivided into six subspecies, namely, enterica, salamae, arizonae, diarizonae, indica, and houtenae. Further, over 2600 serovars have been characterized for Salmonella, with almost 60% classified as S. enterica, which is also more commonly associated with disease than S. bongori [7, 8]. Salmonella strains are usually characterized by analyzing surface antigens: O antigens are part of the variable long–chain lipopolysaccharide on the outer membrane, and the organism also has two flagellar antigens [8].
Classically, Salmonella isolates are identified and detected using conventional culture methods and phenotyping, including pre-enrichment, selective enrichment, isolation, biochemical testing, and serotyping. These methods are often used as standard techniques to demonstrate the efficacy of Salmonella detection [9]; further, microbiological techniques require 4 days even to show negative results and 6–7 days to confirm the identity of positive isolates. Therefore, improved techniques have been developed for rapid isolation and detection of Salmonella in food. Molecular methods can circumvent the above problems and have shown high sensitivity and specificity for detecting Salmonella in different types of foods [10]. Many polymerase chain reaction (PCR) and real-time PCR techniques have been developed and applied for detection of foodborne pathogens [11]. One disadvantage of PCR, however, is that since it is based on target DNA detection, it could amplify DNA from viable and dead cells [12].
Nucleic acid-based sequence amplification (NASBA), which was introduced by Compton (1991), is commonly used for selective amplification of RNA fragments [13, 14]. This assay relies on the activity of three enzymes, namely, T7 RNA polymerase, RNase H, and AMV reverse transcriptase, and requires the presence of a T7 promoter sequence at the 5′ end of the forward primer [15]. The technique is isothermal (41 °C), and the RNA is amplified to a billionfold in around 2 h [16]. In contrast to other detection techniques, such as PCR or real-time PCR, NASBA amplification obviates the need for a thermal cycler and might facilitate potential clinical in resource-poor settings. Although NASBA is more commonly used for detection of RNA viruses, it can also detect pathogenic bacteria in food and environmental samples, for example, Campylobacter spp., Listeria monocytogenes, Vibrio cholerae, and Escherichia coli [15]. As messenger (m)RNA molecules generally possess shorter half-lives, they have been considered more suitable than DNA for viability assays. The NASBA is able to amplify a RNA fragment, so NASBA would be a valuable method for detection of viable cell. The difference between real-time NASBA and traditional endpoint NASBA is that the former incorporates target-specific molecular beacon probes in the reaction mix, enabling simultaneous amplification and detection of the target [17].
To our knowledge, NASBA has not been used for the detection of Salmonella in food. Thus, the present study aimed to develop a sensitive and rapid real–time NASBA assay to detect viable Salmonella in food samples. Primers and a molecular beacon were targeted to mRNA sequences of the Salmonella xcd gene, putative protein (location of the gene is 3251654...3252577 in NC_006905.1) [18]. The specificity and sensitivity of this novel method were examined, and it was used for food analysis. The results showed that this protocol has considerable potential for detecting viable Salmonella cells.
Materials and methods
Bacterial strains and cultures
A total of 48 Salmonella strains representing 34 different serovars and an additional 18 non-Salmonella foodborne pathogens (Table 1) were acquired from the China Center of Industrial Culture Collection (CICC), the National Center for Medical Culture Collections (CMCC), Guangdong Culture Collections, and the American Type Culture Collection. Both Salmonella and non-Salmonella strains were used for specificity testing. Salmonella strains were grown on Luria-Bertani (LB) medium at 37 °C, and a final concentration of 107 CFU/mL was used for nucleic acid extraction.
Table 1.
Salmonella and non-Salmonella strains used for the real-time nucleic acid sequence–based amplification
| Salmonella | Source | Number | xcd | Salmonella | Source | Number | xcd | Non-Salmonella | Source | xcd |
|---|---|---|---|---|---|---|---|---|---|---|
| S. Paratyphi A | CMCC50001 | 1 | + | S. Kentucky | CICC21488 | 1 | + | Escherichia coli | ATCC35150 | − |
| S. Paratyphi A | CICC21501 | 1 | + | S. Bazenheid | CICC21587 | 1 | + | Escherichia coli | ATCC43889 | − |
| S. Saint Paul | CICC21486 | 1 | + | S. Typhi | CMCC50071 | 1 | + | Enterococcus faecalis | ATCC12953 | − |
| S. Paratyphi B | CICC21495 | 1 | + | S. Enteritidis | CICC21527 | 1 | + | Enterococcus faecalis | ATCC29212 | − |
| S. Agona | CICC21586 | 1 | + | S. Enteritidis | CICC21482 | 1 | + | Enterococcus avium | ATCC14025 | − |
| S. Heidelberg | CICC21487 | 1 | + | S. Enteritidis | CVCC3374 | 1 | + | Klebsiella pneumoniae | ATCC13884 | − |
| S. Typhimurium | CMCC51005 | 1 | + | S. Enteritidis | CMCC50041 | 1 | + | Staphylococcus aureus | ATCC29213 | − |
| S. Typhimurium | CICC21483 | 1 | + | S. Enteritidis | CMCC50071 | 1 | + | Staphylococcus aureus | ATCC25923 | − |
| S. Typhimurium | CVCC3384 | 1 | + | S. Enteritidis* | Pork | 2 | + | Serratia marcescens | CICC10187 | − |
| S. Typhimurium* | Pork | 3 | + | S. Dublin | CICC21497 | 1 | + | Bacillus pumilus | CMCC63202 | − |
| S. Bredeney* | Pork | 1 | + | S. Dublin | CMCC50761 | 1 | + | Bacillus cereus* | − | |
| S. Derby* | Beef | 1 | + | S. Miami | CICC21509 | 1 | + | Pseudomonas fluorescens* | − | |
| S. Paratyphi C | CICC21512 | 1 | + | S. Eastbourne | CICC21508 | 1 | + | Listeria grayi | CICC21670 | − |
| S. Montevideo | CICC21588 | 1 | + | S. Anatum | CICC21498 | 1 | + | Listeria seeligeri | CICC21671 | − |
| S. Jerusalem | CICC21651 | 1 | + | S. Meleagridis | CICC21511 | 1 | + | Listeria welshimeri | CICC21672 | − |
| S. Bonn | CICC21677 | 1 | + | S. London* | Pork | 1 | + | Listeria monocytogenes | CICC21662 | − |
| S. Choleraesuis | CICC21493 | 1 | + | S. Senftenberg | CICC21502 | 1 | + | Listeria ivanovii | CICC21663 | − |
| S. Choleraesuis | ATCC13312 | 1 | + | S. Aberdeen | CICC21492 | 1 | + | Listeria innocua | CICC10417 | − |
| S. Thompson | CICC21480 | 1 | + | S. Blockley | CICC21489 | 1 | + | |||
| S. Potsdam | CICC21500 | 1 | + | S. Adelaide | CICC21505 | 1 | + | |||
| S. Braenderup | ATCC19812 | 1 | + | S. Wandsworth | CICC21504 | 1 | + | |||
| S. Bonariensis | CICC21496 | 1 | + | S. Dakar | CICC21507 | 1 | + | |||
| S. Bovismorbificans | CICC21499 | 1 | + | S. Arizonae | CICC21506 | 1 | + |
+, positive result; −, negative result; *laboratory-isolation strain
Nucleic acid extraction
Bacterial RNA was isolated from enrichment cultures using a Total RNA Extractor kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. The extracted RNA was stored at − 80 °C before use in NASBA reactions. The concentration of RNA was measured using a NanoDrop 2000 UV spectrophotometer (Thermo Scientific, US). The negative control was 1 mL of sterilized LB medium in every experiment.
Primer and molecular beacon design
The primers and molecular beacon used in this study were targeted to the xcd gene specific to Salmonella spp. (Table 2) [18], which encodes the important protein xylanase deacetylase. The set of primers and molecular beacon was created using Beacon Designer 7.0 (Premier Biosoft, Palo Alto, CA). The downstream primers included the bacteriophage T7 RNA polymerase promoter sequence at the 5′ end. The secondary structures of the molecular beacon and target sequence were analyzed using Mfold (http://mfold.rna.albany.edu/?q=mfold/). The beacon was labeled with FAM at its 5′ end and quencher DABCYL at its 3′ end. The specificity of the primers and molecular beacon was verified using online BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The primers and molecular beacon were obtained from Sangon Biotech and purified using high-performance liquid chromatography.
Table 2.
Primers and molecular beacon for the Salmonella spp. real-time nucleic acid sequence–based amplification assay
| Target organism | Gene | Primer beacon | Sequence(5′-3′) | Reference |
|---|---|---|---|---|
| Salmonella spp. | xcd | Pxcd-f | 5′-GTTAGCTGGTATCTGGATGA-3′ | This study |
| Pxcd-f | 5′-AATTCTAATACGACTCACTATAGGG1 AAACTGATGGTTATAAGCATAGGT-3′ | This study | ||
| Bxcd | FAM-CGATCG2CGTATACCGGT AACCAGGAGGGGACGATCG2-DABCYL | This study | ||
| invA | 139 | GTGAAATTATCGCCACGTTCGGGCAA | [16] | |
| 141 | TCATCGCACCGTCAAAGGAACC | [16] |
1: Recognition sequence of T7 RNA polymerase
2: Reverse repetitive sequence
Real-time NASBA
The real-time NASBA reaction was carried out using the NucliSens basic NASBA kit (bioMerieux Ltd., Boxtel, the Netherlands) according to the manufacturer’s instructions. The optimal final concentrations of the primers and molecular beacon used were 600 nM and 400 nM, respectively. Briefly, NASBA assays were carried out in a final volume of 10 μL, with a reaction mixture containing reagent mix (5.5 μL), KCl (80 nM), primers (0.2 μL), molecular beacon (0.1 μL), and target RNA (2.5 μL). The mixture was annealed at 65 °C for 5 min and then cooled at 41 °C for 2 min. The samples were incubated at 41 °C for 90 min in a PCR StepOnePlus™ system (Applied Biosystems, Foster City, USA) before the enzymes (1.5 μL) were added. A deionized H2O blank was included as an amplification negative control with every assay. When the target amplification curves reached the threshold level, the result of detection was considered positive.
Specificity and sensitivity of real-time NASBA
The specificity of real-time NASBA was verified using 48 strains of Salmonella spp. belonging to different serogroups and 18 strains of non-Salmonella foodborne pathogens (Table 1). Nucleic acid extraction and real-time NASBA were conducted for each strain.
Salmonella ser. Choleraesuis (CICC21493) was used to evaluate the detection limit of the assay. This strain was cultured overnight after tenfold serial dilution with buffered peptone water. Each dilution, which corresponded to a cell concentration determined using the plate-count method, was subjected to nucleic acid extraction in triplicate. Each dilution and space was detected by this real-time NASBA assay.
Viability testing
Samples of Salmonella ser. Enteritidis (approximately 106 CFU/mL) were autoclaved (121 °C) for 20 min and then incubated at room temperature for 0, 12, 24, or 48 h, after which DNA and RNA were extracted from the samples and analyzed by real-time NASBA, PCR (139–141 primers) [19] and culturing (Table 2). Samples of non-autoclaved cells were used as a control to examine the effects of this treatment.
Detection of Salmonella spp. in the presence of background microbiota
This detection was not subjected to selective enrichment; we decided to test our detection method in the presence of non-Salmonella microorganisms. For this, the detection limits of real-time NASBA were investigated in the presence of pork background microbiota. Salmonella ser. Typhimurium (CMCC51005) was cultured overnight after tenfold serial dilution using buffered peptone water. The pork sample was confirmed to be Salmonella free by standard microbiological methods, and 10 g of this sample was inoculated in 90 mL of LB at 37 °C for 12 h for enrichment culture. A 500-μL sample of each dilution of Salmonella ser. Typhimurium was added to 500 μL of the pork background microbiota suspension. This mixture was subjected to nucleic acid extraction and tested using real-time NASBA.
Artificial contamination of food samples
In order to validate the method for detection of Salmonella spp., it was conducted using artificially contaminated food samples. Portions of beef, pork, and milk were purchased from local supermarkets. They were confirmed to be free of Salmonella spp. by standard methods (GB4789.4-2010). In replicates, 25-g food samples were artificially contaminated with dilutions of Salmonella ser. Enteritidis at the following approximate concentrations: 10 [2], 10 [1], 100, 10−1, and 0 CFU/25 g. These dilutions were inoculated in LB culture medium at 37 °C for 12 h. Then, 1 mL of each pre-enriched sample was processed for nucleic acid extraction and real-time NASBA.
Results
Specificity and sensitivity of real-time NASBA
The specificity of real-time NASBA was detected using RNA isolated from 48 Salmonella spp. strains and 18 non-Salmonella strains. The xcd gene was successfully amplified from all the Salmonella spp. strains using the primers and molecular beacon designed in this study, but not from all the non-Salmonella strains. As show in Table 1, the results showed that our protocol was specific to the target strains, and non-specific reactions did not occur with non-Salmonella strains.
The real-time NASBA assay enabled successful amplification of different bacterial concentrations (700, 70, 7, and 7 × 10−1 CFU/mL) after 10 h of enrichment (Table 3). When concentration was less than 7 × 10−1 CFU/mL, the results of detection were negative, as they were for the negative control. The detection limit of the real-time NASBA assay for Salmonella spp. was found to be 7 × 10−1 CFU/mL.
Table 3.
Sensitivity of the real-time nucleic acid sequence–based amplification assays
| Salmonella spp. (CFU/mL) | xcd (Ct ± SD) n = 3 | Result |
|---|---|---|
| 7 × 102 | 8.7 ± 1.69 | + |
| 7 × 101 | 9.26 ± 1.14 | + |
| 7 × 100 | 10.6 ± 3.6 | + |
| 7 × 10−1 | 11 ± 0.66 | + |
| 7 × 10−2 | ND | − |
| 0 | ND | − |
ND, not determined; +, positive result; −, negative result
Viability detection
In order to confirm that NASBA is able to detect viable cells because it uses mRNA as the amplification target, Salmonella ser. Enteritidis was heat treated at 121 °C and incubated at 0, 12, 24, and 48 h at room temperature. The samples were examined using standard culture, PCR (invA), and real-time NASBA (xcd). PCR (invA) showed positive results for detection of Salmonella ser. Enteritidis after treatment at 121 °C and further incubation for 0, 12, 24, and 48 h. In contrast, the results of the standard culture method were negative (Table 4). The xcd gene was detected by real-time NASBA in Salmonella ser. Enteritidis subjected to heat treatment at 121 °C and further incubated for 0 and 12 h. However, real-time NASBA was not able to detect organism after heat treatment and 24 h of incubation. These results indicated that dead cells did not interfere with the detection of viable Salmonella spp. using the real-time NASBA method.
Table 4.
Real-time nucleic acid sequence–based amplification, PCR, and standard culture with heat-treated non-viable Salmonella samples
| Detection of methods | Duration of incubation of non-viable cells at room temperature (h) | |||
|---|---|---|---|---|
| 0 | 12 | 24 | 48 | |
| Real-time NASBA (xcd) | 5.75 ± 0.87 | 11.03 ± 2.61 | ND | ND |
| PCR(invA) | + | + | + | + |
| GB/T4789.4-2008 | − | − | − | − |
ND, not determined; +, positive result; −, negative result
Detection of Salmonella spp. in the presence of background microbiota
The total aerobic plate count of the pork sample enriched for 12 h was 1.9 × 107 CFU/mL. The detection limit of the real-time NASBA assay was evaluated in the presence of background microbiota. Additionally, the sensitivity of the assay for detection of Salmonella spp. was tested by combining various dilutions of Salmonella spp. with pork background microbiota. The detection limit of the assay for Salmonella spp. was approximately 9.5 × 103 CFU/mL (Table 5). Real-time NASBA did not show an amplification curve in the presence of pork background microbiota at 9.5 × 102 CFU/mL (Table 5).
Table 5.
Detection of Salmonella cells in the presence of pork background microbiota
| Salmonella (CFU/mL) | xcd (Ct ± SD) n = 3 | Result |
|---|---|---|
| 9.5 × 106 | 4.807 ± 0.453 | + |
| 9.5 × 105 | 7.908 ± 3.89 | + |
| 9.5 × 104 | 4.491 ± 0.556 | + |
| 9.5 × 103 | 4.399 ± 0.722 | + |
| 9.5 × 102 | ND | − |
| 0 | ND | − |
ND, not determined; +, positive result; −, negative result
Artificial contamination of food sample
Food samples of pork, beef, and milk spiked with four concentrations of Salmonella from n × 10−1 to n × 102 CFU/25 g (mL) (1 < n < 10) were subjected to the real-time NASBA assay after 10 h of enrichment. Positive signals were obtained from all food samples artificially contaminated with n CFU/25 g (mL) of Salmonella spp. (Table 6). Control samples containing with 0 CFU/25 g (mL) of Salmonella spp. showed no amplification curve for any sample. These results indicated that the detection limit of the assay for Salmonella-contaminated food samples was n CFU/25 g (mL).
Table 6.
Detection of Salmonella cells in spiked food samples
| Strain | Number of cell | Food sample | ||
|---|---|---|---|---|
| (CFU/25 g (mL)) | Pork | Beef | Milk | |
| S. Enteritidis | N × 102 | 24.186 ± 1.887 | 12.65 ± 4.826 | 13.89 ± 1.892 |
| CICC21527 | N × 101 | 15.85 ± 7.426 | 10.596 ± 0.262 | 15.618 ± 4.577 |
| N × 100 | 14.211 ± 6.82 | 27.498 ± 4.569 | 23.07 ± 2.77 | |
| N × 10−1 | ND | ND | ND | |
| 0 | ND | ND | ND | |
ND, not determined
Discussion
Nowadays, the demand for highly reliable and specific methods for detection of foodborne pathogens has peaked mainly because of these infections are common and cause substantial economic loss worldwide. The present study aimed to develop a real-time NASBA assay for the detection of Salmonella [20]. The xcd gene specific to Salmonella was selected as target sequence and used for primer and molecular beacon development [18]. Use of the molecular beacon to monitor amplicon generation during NASBA ensures result reliability in a one-tube system and minimizes the risk of contamination. Real-time NASBA approaches certainly cannot completely replace the traditional culture method, but they do yield results within a short time and have minimum processing errors. The real-time NASBA assay can differentiate between viable and non-viable cells and also avoids other disadvantages of real-time PCR, such as interference of dead cells.
In the present study, the real-time NASBA assay had 100% specificity because of the use of the xcd gene. The specificity of the xcd gene was evaluated from its complete sequence in the NCBI database; in PCR-based verification, the primer sets showed good specificity and did not yield false negative or false positive results for Salmonella and non-Salmonella organisms, respectively [18]. This molecular beacon–based real-time NASBA also showed high specificity by combined use of specific primers [21]. The method for Salmonella detection included a short enrichment step, RNA extraction, and real-time NASBA. The purpose of the short enrichment step was to increase the possibility of detecting even low amounts of the pathogen and to overcome the effects of any NASBA inhibitors [22]. The detection limit was found to be 7 × 10−1 CFU/mL within 1 working day. In a previous study, a novel PCR instrument for detection of Salmonella yielded positive results when the concentration of the target strains was 2.5 CFU/mL. [11] The presence-absence assay with real-time NASBA described here could detect 5 CFU/mL of Salmonella [23]. The detection limit in our study was better than those in previous studies. The NASBA reaction involves three enzymes, because of which it may be more sensitive to inhibitors than PCR, which only involves a single enzyme [13]. However, culture enrichment could effectively reduce the influence of inhibitors.
In principle, the presence of RNA should indicate cell viability [24]. mRNA has an average half-life of only a few minutes in metabolizing strains [25]. However, previous studies have shown that mRNA may persist for several days after cell death [26]. The ability of NASBA to detect viable cells was evaluated in the present study, and positive results were obtained in the assay for heat-treated samples incubated at room temperature for less than 24 h. However, for heat-treated samples incubated for more than 24 h, real-time NASBA was not able to discriminate between dead and viable cells: it yielded the same results as PCR. A reason for this may be that viable cells contained sufficient xcd-mRNA (in the 24 h after heat treatment) to produce a positive real–time NASBA reaction. However, the xcd-mRNA of non-viable cells was degraded by RNase in the environment 24 h after heat treatment and thereafter. Another reason could be changes in specific features related to mRNA stability and secondary structures due to prolonged incubation after heat treatment.
The detection limits for Salmonella strains in different foods may depend on the complexity of food components and background microbiota [27]. The introduction of an enrichment step before NASBA could reduce this influence of food material on the sensitivity of detection. In the present study, we investigated the detection limits of real-time NASBA for Salmonella in the presence of natural background microbiota. The minimum concentration of Salmonella for detection was 9.5 × 103 CFU/mL in the presence of pork background microbiota. This result is similar to that of Chen et al. (2010), who found that the sensitivity of Salmonella detection by real-time PCR was 1.3 × 103 CFU/mL in the presence of nature background microbiota. Our protocol applied to three different artificially contaminated in food products of animal origin yielded positive results in less than 1 working day with initial inoculum levels as low as 10 CFU/25 g (mL). Our method was more sensitive than a previously conducted NASBA assay followed by electrochemiluminescence detection (102 CFU per 25 g) [28]. Thus, we showed that this real-time NASBA assay is applicable to the detection of Salmonella in pork, beef, and dairy products. Food samples of animal origin spiked with Salmonella cells were used to verify that the combination of a rapid procedure for the extraction of RNA and the cell density was very necessary.
In conclusion, the present study described a novel, rapid, and sensitive real–time NASBA assay for the detection of Salmonella in food products. This method targeted the xcd gene and could discriminate viable and non-viable cells. The protocol included a pre-enrichment step, nucleic acid extraction, and real-time NASBA and could be completed in less than 1 working day. The real-time NASBA assay was specific and sensitive for Salmonella detection from food samples of animal origin. Because of its efficiency, we believe this assay can be used in efforts to prevent outbreaks of foodborne illnesses.
Funding information
This work was supported by grants from the National Science and Technology Support Program, the Social Development Program of Jiangsu Province, the Independent Innovation Program of Jiangsu Province, and the University Natura Science Key Project of Anhui Province (Grant Nos. 2012BAK08807, BE2012746, CX (12)3087, and KJ2016A182).
Compliance with ethical standards
Conflict of interest
The authors declare that they have no conflict interest.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Tennant SM, Diallo S, Levy H, Livio S, Sow SO, Tapia M, Fields PI, Mikoleit M, Tamboura B, Kotloff KL, Nataro JP, Galen JE, Levine MM (2010) Identification by PCR of non-typhoidal Salmonella enterica serovars associated with invasive infections among febrile patients in Mali. PLoS Negl Trop Dis 4(3) [DOI] [PMC free article] [PubMed]
- 2.Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O'Brien SJ, et al. The global burden of nontyphoidal salmonella gastroenteritis. Clin Infect Dis. 2010;50(6):882–889. doi: 10.1086/650733. [DOI] [PubMed] [Google Scholar]
- 3.Bale J, Meunier D, Weill FX, Depinna E, Peters T, Nair S. Characterisation of new Salmonella serovars by whole genome sequencing and traditional typing techniques. J Med Microbiol. 2016;65(10):1074–1078. doi: 10.1099/jmm.0.000325. [DOI] [PubMed] [Google Scholar]
- 4.Li H, Xin H, Li SFY. Multiplex PMA–qPCR assay with internal amplification control for simultaneous detection of viable legionella pneumophila, Salmonella typhimurium, and Staphylococcus aureus in environmental waters. Environ Sci Technol. 2015;49(24):14249–14256. doi: 10.1021/acs.est.5b03583. [DOI] [PubMed] [Google Scholar]
- 5.Gharieb RM, Tartor YH, Khedr MHE. Non-Typhoidal Salmonella in poultry meat and diarrhoeic patients: prevalence, antibiogram, virulotyping, molecular detection and sequencing of class I integrons in multidrug resistant strains. Gut Pathog. 2015;7(1):1–11. doi: 10.1186/s13099-015-0081-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, Jones JL, Griffin PM. Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis. 2011;17(1):7–15. doi: 10.3201/eid1701.P11101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chattopadhyay S, Kaur A, Jain S, Singh H. Sensitive detection of food-borne pathogen Salmonella by modified PAN fibers-immunoassay. Biosens Bioelectron. 2013;45:274–280. doi: 10.1016/j.bios.2013.01.032. [DOI] [PubMed] [Google Scholar]
- 8.Guibourdenche M, Roggentin P, Mikoleit M, Fields PI, Bockemuehl J, Grimont PAD, et al. Supplement 2003-2007 (No. 47) to the White-Kauffmann-Le Minor scheme. Res Microbiol. 2010;161(1):26–29. doi: 10.1016/j.resmic.2009.10.002. [DOI] [PubMed] [Google Scholar]
- 9.Nielsen LR, Dohoo I. Time-to-event analysis of predictors for recovery from Salmonella Dublin infection in Danish dairy herds between 2002 and 2012. Prev Vet Med. 2013;110(3–4):370–378. doi: 10.1016/j.prevetmed.2013.02.014. [DOI] [PubMed] [Google Scholar]
- 10.Ferretti R, Mannazzu I, Cocolin L, Comi G, Clementi F. Twelve-hour PCR-based method for detection of Salmonella spp. in food. Appl Environ Microbiol. 2001;67(2):977–978. doi: 10.1128/AEM.67.2.977-978.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hagren V, Lode PV, Syrjälä A, Korpimäki T, Tuomola M, Kauko O, et al. An 8-hour system for Salmonella detection with immunomagnetic separation and homogeneous time-resolved fluorescence PCR. Int J Food Microbiol. 2008;125(2):158–161. doi: 10.1016/j.ijfoodmicro.2008.03.037. [DOI] [PubMed] [Google Scholar]
- 12.Deere D, Porter J, Pickup RW, Edwards C. Survival of cells and DNA of Aeromonas salmonicida released into aquatic microcosms. J Appl Bacteriol. 1996;81(3):309–318. doi: 10.1111/j.1365-2672.1996.tb04333.x. [DOI] [PubMed] [Google Scholar]
- 13.Compton J. Nucleic-acid sequence-based amplification. Nature. 1991;350(6313):91–92. doi: 10.1038/350091a0. [DOI] [PubMed] [Google Scholar]
- 14.Keer JT, Birch L. Molecular methods for the assessment of bacterial viability. J Microbiol Methods. 2003;53(2):175–183. doi: 10.1016/S0167-7012(03)00025-3. [DOI] [PubMed] [Google Scholar]
- 15.Fykse EM, Skogan G, Davies W, Olsen JS, Blatny JM. Detection of Vibrio cholerae by real-time nucleic acid sequence-based amplification. Appl Environ Microbiol. 2007;73(5):1457–1466. doi: 10.1128/AEM.01635-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Polstra AM, Goudsmit J, Cornelissen M (2002) Development of real-time NASBA assays with molecular beacon detection to quantify mRNA coding for HHV-8 lytic and latent genes. BMC Infect Dis 2 [DOI] [PMC free article] [PubMed]
- 17.Moore C, Hibbitts S, Owen N, Corden SA, Harrison G, Fox J, Gelder C, Westmoreland D. Development and evaluation of a real-time nucleic acid sequence based amplification assay for rapid detection of influenza A. J Med Virol. 2004;74(4):619–628. doi: 10.1002/jmv.20221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kong X, Lu Z, Zhai L, Yao S, Zhang C, Lv F, Bie X. Mining and evaluation of new specific molecular targets for the PCR detection of Salmonella spp. genome. World J Microbiol Biotechnol. 2013;29(12):2219–2226. doi: 10.1007/s11274-013-1387-0. [DOI] [PubMed] [Google Scholar]
- 19.Rahn K, Degrandis SA, Clarke RC, McEwen SA, Galan JE, Ginocchio C, et al. Amplicification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6(4):271–279. doi: 10.1016/0890-8508(92)90002-F. [DOI] [PubMed] [Google Scholar]
- 20.Sundsfjord A, Olsvik O (1997) Nucleic acid amplification techniques in detection and diagnosis of medicallyimportant viral infections[J]. Nucleic acid amplification technologies: application to disease diagnosis. Birkhauser Boston, Cambridge, p 183–199
- 21.Churruca E, Girbau C, Martinez I, Mateo E, Alonso R, Fernandez-Astorga A. Detection of Campylobacter jejuni and Campylobacter coli in chicken meat samples by real-time nucleic acid sequence-based amplification with molecular beacons. Int J Food Microbiol. 2007;117(1):85–90. doi: 10.1016/j.ijfoodmicro.2007.02.007. [DOI] [PubMed] [Google Scholar]
- 22.Fykse EM, Nilsen T, Nielsen AD, Tryland I, Delacroix S, Blatny JM, Real-time PCR. NASBA for rapid and sensitive detection of Vibrio cholerae in ballast water. Mar Pollut Bull. 2012;64(2):200–206. doi: 10.1016/j.marpolbul.2011.12.007. [DOI] [PubMed] [Google Scholar]
- 23.Mollasalehi H, Yazdanparast R. An improved non-crosslinking gold nanoprobe-NASBA based on 16S rRNA for rapid discriminative bio-sensing of major salmonellosis pathogens. Biosens Bioelectron. 2013;47:231–236. doi: 10.1016/j.bios.2013.03.012. [DOI] [PubMed] [Google Scholar]
- 24.Lee SH, Hava DL, Waldor MK, Camilli A. Regulation and temporal expression patterns of Vibrio cholerae virulence genes during infection. Cell. 1999;99(6):625–634. doi: 10.1016/S0092-8674(00)81551-2. [DOI] [PubMed] [Google Scholar]
- 25.Arraiano CM, Yancey SD, Kushner SR. Stabilization of discrete messenger-RNA breakdown products in ams pnp rnb multiple mutants of Escherichia-coli K-12. J Bacteriol. 1988;170(10):4625–4633. doi: 10.1128/jb.170.10.4625-4633.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Scuderi G, Golmohammadi M, Cubero J, Lopez MM, Cirvilleri G, Llop P. Development of a simplified NASBA protocol for detecting viable cells of the citrus pathogen Xanthomonas citri subsp citri under different treatments. Plant Pathol. 2010;59(4):764–772. doi: 10.1111/j.1365-3059.2010.02305.x. [DOI] [Google Scholar]
- 27.Chen J, Zhang L, Paoli GC, Shi C, Tu S-I, Shi X. A real-time PCR method for the detection of Salmonella enterica from food using a target sequence identified by comparative genomic analysis. Int J Food Microbiol. 2010;137(2):168–174. doi: 10.1016/j.ijfoodmicro.2009.12.004. [DOI] [PubMed] [Google Scholar]
- 28.D'Souza DH, Jaykus LA. Nucleic acid sequence based amplification for the rapid and sensitive detection of Salmonella enterica from foods. J Appl Microbiol. 2003;95(6):1343–1350. doi: 10.1046/j.1365-2672.2003.02106.x. [DOI] [PubMed] [Google Scholar]