Skip to main content
NCBI home page
Genetics Research logoLink to Genetics Research
. 2015 Dec 28;97:e23. doi: 10.1017/S0016672315000233

A refined high carbohydrate diet is associated with changes in the serotonin pathway and visceral obesity

PAOLA A SPADARO 1, HELEN L NAUG 1,2, EUGENE F DU TOIT 1,2, DANIEL DONNER 1, NATALIE J COLSON 1,2,*
PMCID: PMC6863639  PMID: 26707058

Summary

Consumption of palatable foods high in refined carbohydrate has been implicated as a contributing factor to the epidemic levels of obesity. Such foods may disrupt appetite regulation in the hypothalamus through alterations in hunger and satiety signalling. This investigation examined whether a palatable high refined carbohydrate (HRC) diet with the potential to induce obesity was linked to modulation of serotonin and dopamine signalling within the hypothalamus of rats. Male Wistar rats were allowed ad libitum access to either a palatable refined carbohydrate enriched (HRC) diet or standard chow (SC). Visceral fat percentage was used as a measure of the animals' weight gain during the trial. Real-time PCR was applied to determine any variation in levels of expression of the serotonin (Slc6A4 or Sert) and dopamine transporter (Slc6A3 or Dat) genes. After 29 weeks, the HRC group showed a significant increase in visceral fat percentage accompanied by increased expression of Sert. Higher levels of circulating triglycerides were also seen. This investigation determined that a refined high carbohydrate diet is associated with visceral obesity, increased circulating lipids in the blood and distorted serotonergic signalling, which possibly alters satiety and hunger signals.

1. Introduction

Current lifestyle and consumption of highly refined carbohydrate dense foods have changed the evolutionary programing of food intake in humans, possibly through disruption of appetite regulation and satiety (King, 2013). Early investigations have indicated the serotonergic and dopaminergic systems within the hypothalamus as key regions for energy control in mammals (Erlanson-Albertsson, 2005). The hypothalamus connects higher cortical centres, such as the reward and motivation related limbic system with peripheral signals, influencing food intake and energy expenditure (Suzuki et al., 2012; Stice et al., 2013). There is evidence that the hypothalamic energy control response and reward pathways in the brain appear to be functionally linked (Kempadoo et al., 2013). Although neural signalling modifications in the hypothalamus in response to dietary changes have been explored (Erlanson-Albertsson, 2005; Berthoud et al., 2012; Murray et al., 2014), there are limited studies exploring the specific effects of a palatable refined carbohydrate diet on mRNA levels.

The dopaminergic circuit has long been associated with food intake (Quarta et al., 2014). Dopamine appears to function as an inhibitor of food consumption and hyperphagia by establishing control over the number and duration of meals (Meguid et al., 2000). High carbohydrate content diets with protein restriction have an effect on dopamine efflux in the striatum of rats associated with coping response (Yeghiayan et al., 2004). A major regulator of dopamine in the brain is the sodium dependent dopamine transporter (Dat or Slc6A3) and its modification due to high fat diet exposure has also been linked with obesity (Vucetic et al., 2012).

Serotonin is known as a major regulator of feeding (Lam et al., 2010). Although there is growing support for the function of serotonin in central and peripheral control of food intake and energy balance regulation, conserved from mammals to fish, the specific neuronal mechanisms underlying the serotonergic pathway are still emerging (Johnston & Glanville, 1994; Donovan & Tecott, 2013). Serotonergic signalling is further controlled by the serotonin transporter (Sert or Slc6A4), which traffics serotonin from the synaptic cleft to the pre-synaptic membrane (Zhou et al., 1996). Agents that block the re-uptake of serotonin, such as fenfluramine and selective serotonin reuptake inhibitors, elicit powerful anorectic effects (Garfield & Heisler, 2009), suggesting a role for Sert in feeding behaviour.

This investigation focused on the neural processes that govern the tendency to overeat palatable carbohydrates beyond homeostatic needs. Here we examine whether such diets are associated with changes in hypothalamic expression of Sert and Dat and lipid metabolisms in rats.

2. Methods

(i). Animal training and tissue collection

A total of 49 ten-week old male Wistar rats were housed in the Griffith University Animal Facility in a room maintained at 23 °C with a 12-hour day–night cycle. All studies were performed in accordance with the guidelines of the Animal Ethics Committee of Griffith University (Permit No: MSC/08/10/AEC), which is accredited by the Queensland Government, Department of Primary Industries and Fisheries under the guidelines of The Animal Care and Protection Act 2001, Section 757. The animals were randomly assigned to one of two diet groups for a 29-week feeding period. Following a model developed by du Toit et al. (2008), the two diet groups had ad libitum access to food and water. The high refined carbohydrate (HRC) diet was made by combining 3·2 kg of rat chow soaked in water with 3 kg of sweetened condensed milk and 0·56 kg of raw sugar. The resulting macronutrient composition was 82% carbohydrate, 11% protein and 7% fat; while the standard chow (SC) diet consisted of 73% carbohydrate, 18% protein and 9% fat. Energy intake was measured by daily food consumption documented by weighing the food left in the cage when doing the daily food replacement. Knowing the weight of food consumed and the macronutrient content of the diets, we were able to calculate the daily caloric intake of the SC and HRC rats. All rats were weighed before being euthanized by lethal injection of anaesthesia at the age of 39 weeks. Each rat brain was rapidly removed from the skull and placed on a flat surface on ice with the ventral surface uppermost. The hypothalamus was quickly dissected from the fresh brain with the aid of a standard rat brain atlas (Paxinos et al., 1980), stored in RNAlater (Qiagen, Hilden, Germany) and snap frozen at −80 °C until required. Total visceral fat tissue was collected to determine the percentage of visceral fat of each individual to be used as an indicator of obesity.

(ii). DNA–RNA extraction and real-time PCR

RNA extractions were performed using Qiagen AllPrep DNA/RNA kits (Qiagen, Hilden, Germany) as per the manufacturer's instructions. Final concentrations and purity were measured in ng/μl using Nanodrop (Thermo Scientific, Waltham, MA, USA) and Lonza Flashgel (Basel, Switzerland). The RNA (2 µg) was immediately reverse transcribed using the Advanced Avian RT First Strand Synthesis Kit (Sigma, St. Louis, MO, USA) as per the manufacturer's instructions. Real-time PCR (rtPCR) was used to determine any variation in levels of target gene expression applying the 2−ΔΔCt method (Livak & Schmittgen, 2001). The primers used in this investigation (Table 1) were selected from the scientific literature (Jijun et al., 2010).

Table 1.

Oligo sequences for measurement of gene expression.

Gene 5′–3′ Sequence – real-time PCR
Slc6a3 Forward GCGGAGATGAGGAATGAAGATGTG
Reverse AGGAAGAAGATGATGGCAAAGAAC
Slc6a4 Forward TTGGGTTTGGAGTGCTGATTGC
Reverse AGAAGACGACGAAGCCAGAGG
ActB Forward TGTCACCAACTGGGACGATA
Reverse GGGGTGTTGAAGGTCTCAAA
Open in a new tab

All rtPCR runs were performed on the Corbett RotorGene 3000. Six genes of known expression levels in the rat brain (Bonefeld et al., 2008), were examined using the geNorm program (available at: https://genorm.cmgg.be/) to determine the most stably expressed reference gene to be used for analysis. Consequently, Actin B was the reference gene selected to establish the delta cycle threshold values (∆Ct) following the method published by Vandesompele et al. (2002).

(iii). Biochemical analyses

We also examined any potential differences in levels of serum triglycerides, glucose and insulin, and determined the homeostatic model assessment of insulin resistance (HOMA-IR) prior to sacrifice. Animals examined were fasted for 5 hours before blood to be used in the biochemical analyses was collected. Serum triglycerides and glucose levels were determined in fresh whole blood using a Blood-Lipid and Glucose Analyser (L.D.X. Cholestech Analyser, Alere, Australia). For serum analysis, the remaining blood samples were placed in serum separation tubes (BD Vacutainer tubes), centrifuged and the serum stored at −80 °C for later analysis. Levels of insulin (ALPCO Immunoassays, Salem, NH, USA) were determined in 96-well enzyme-linked immunosorbant assays (ELISAs) according to the manufacturer's instructions. The HOMA index was used to assess insulin resistance in the HRC and SC animals using fasting blood glucose and insulin levels and applying the standard formula: [fasting insulin (μIU/ml) × fasting glucose (mmol/l)] / 22·5.

(iv). Animal training and tissue collection

Data for gene expression and biochemical parameters were analysed by independent t tests using SPSS Version 17. The differences were considered to be significant at p < 0·05.

3. Results

We initially examined whether ad libitum access to the palatable refined carbohydrate diet induced obesity in the rats according to a well-established model (du Toit et al., 2008). Differences in mean body weights were seen from week 6 of ad libitum access to the SC or HRC diet, and increased weekly (Fig. 1).

Fig. 1.

Fig. 1.

Open in a new tab

Differences in visceral fat percentage of rats on the high refined carbohydrate and standard chow (control) diets at sacrifice. HRC: high refined carbohydrate; SC: standard chow.

After 29 weeks the HRC group (n = 18) displayed a marked increase in energy intake at 570 ± 23 kJ/day compared to the SC (n = 19) diet group that consumed only 371 ± 18 kJ/day. At the time of sacrifice, there was a significant increase in visceral fat for the HRC group (mean visceral fat percentage, HRC = 8·0%, SC = 6·541%; p = 0·018, t = 2·479, df = 35; Fig. 2). These data indicated the development of visceral obesity within the HRC group of animals.

Fig. 2.

Fig. 2.

Open in a new tab

Differences in visceral fat development between rats on the high refined carbohydrate and standard chow diets at 39 weeks of age. *Statistically significant difference. HRC: high refined carbohydrate; SC: standard chow.

We then examined triglycerides, glucose and insulin levels and calculated HOMA-IR in a subset of the animals (SC = 10, HRC = 10 for triglycerides and glucose; SC = 5, HRC = 5 for insulin and HOMA-IR; Table 2).

Table 2.

Biometric comparisons of standard chow and high refined carbohydrate-fed rats.

Biochemical parameter SC HRC p-value
Triglycerides (mmol/l) 1·28 ± 0·13 1·69 ± 0·14 0·046
Glucose (mmol/l) 9·78 ± 0·29 9·23 ± 0·55 0·404
Insulin (ng/ml) 6·61 ± 0·18 6·79 ± 0·10 0·411
HOMA-IR 62·99 ± 1·94 61·11 ± 3·27 0·635
Open in a new tab

HRC: high refined carbohydrate; SC: standard chow.

Here we detected a significant difference between SC and HRC rats for triglycerides measurements, while there was no evidence of insulin resistance or development of diabetes. This is consistent with previous findings linking elevated circulating triglycerides levels with increase in body weight and obesity (Bocarsly et al., 2010).

Next, we investigated whether the visceral obesity present in the HRC group was associated with alterations in serotonin and dopamine signalling within the rat hypothalamus by measuring the mRNA levels of both neurotransmitter transporters. Our results showed that expression of Sert was significantly increased in the HRC diet group compared to the SC group (p = 0·032, t = 2·227, df = 35; Fig. 3). Conversely, there was no difference in expression levels of Dat (p = 0·720, t = 0·620, df = 34). These results implied the involvement of the serotonergic but not dopaminergic pathway in the development of visceral obesity.

Fig. 3.

Fig. 3.

Open in a new tab

Differences in Slc6A4 (Sert) gene expression between rats on the high refined carbohydrate and standard chow diets at 39 weeks of age. *Statistically significant difference. HRC: high refined carbohydrate; SC: standard chow.

4. Discussion

This study has examined the effect of a palatable HRC diet on food consumptive behaviour and the expression of two important genes involved in hypothalamic control of feeding in rodents. We verified that increased levels of Sert within the rat hypothalamus, as a consequence of carbohydrate overconsumption, leads to aberrant eating behaviour. Development of visceral obesity and higher levels of circulating triglycerides follow this response.

Here we found that the palatable refined carbohydrate diet altered consumptive behaviour that led to distorted lipid metabolism, with no evidence of insulin resistance or diabetes. The role of triglycerides and lipid metabolism is only now emerging and its influence in consumptive behaviour is yet to be clarified. Recent investigations nonetheless have indicated the presence of triglycerides in the mesolimbic brain region as a regulator of the reward pathway (Cansell et al., 2014). In high saturated fat diets, increased circulation of triglycerides has also been shown to alter the hypothalamus circuitries and induce overeating in rodents (Barson et al., 2012). Given that triglyceride excess has been associated with heart disease (Harchaoui et al., 2009), our results are consistent with a link between carbohydrate overconsumption and development of coronary disease risk factors.

Our results support the findings of Park et al. (1999) who detected increased Sert binding in the rats fed a palatable HRC diet within the hypothalamus and midbrain regions associated with obesity. Concordantly, high BMI in adult humans has also been associated with increased Sert binding in the anterior cingulated cortex and thalamus/hypothalamus (Koskela et al., 2008), regions that are already known to be linked to the perception of sweet and fat flavour in humans (Grabenhorst et al., 2010; Fernstrom et al., 2012).

While early investigations indicated that serotonin acts as a satiety signal (Lawton et al., 1995), new research shows that carbohydrate consumption increases serotonin levels in the hypothalamus (Ventura et al., 2014). This effect was not seen with the consumption of protein or fats (Rouch et al., 1999). Consistent with our findings, numerous animal studies have shown that palatable food promotes altered eating behaviour (Erlanson-Albertsson, 2005; Avena et al., 2008; Avena & Bocarsly, 2012; Alsio et al., 2012). Palatability stimulates excess consumption in rodents (Alsio et al., 2009), with sweetness being a clear driver for pleasure-linked eating responses (Lenoir et al., 2007). Added to this, the hypothalamus regulates energy homeostasis by sensing and integrating changes in glucose levels (Song et al., 2001), projecting directly to the nucleus accumbens, which influences the hedonic and motivational aspects of food (Stice et al., 2013).

Furthermore, chronic ingesting of sugar has been shown to blunt activity of the oxytocin system, a pathway that mediates satiety in the hypothalamus (Mitra et al., 2010). Previous investigations have identified links between oxytocin and serotonin pathways by which administration of serotonin or fenfluramine, a serotonin agonist, induces increased levels of oxytocin (Jorgensen et al., 2003; Lee et al., 2003). While the interaction between the two neuromodulators has additionally been confirmed in humans (Marazziti et al., 2012), experimental work on non-human primates suggested a role for Sert in mediating this association (Emiliano et al., 2007). Additionally, a recent publication has implied oxytocin as a regulator of serotonin signalling in the human brain associated with anxiety (Mottolese et al., 2014) and previous data show that oxytocin infusion regulates serotonin release via activation of oxytocin receptors found in serotonergic neurons (Yoshida et al., 2009). These precedents suggest that chronic consumption of a sugar-laden diet could potentially modulate the oxytocin system via Sert. Further investigations are merited as they may help to elucidate common pathways with consumptive behaviour and provide new perspectives to develop novel strategies to treat obesity.

The mechanisms resulting in the upregulation of Sert remain elusive. The complexity of Sert expression and function is not yet fully understood (Daws & Gould, 2011). Nonetheless, given that in vitro studies have shown that long-term exposure to high glucose concentrations further increases the activity of Sert (Goncalves et al., 2008), it is possible that the consumption of refined carbohydrate over an extended time determined the patterns of expression of Sert seen in our investigation. Recent findings showed a correlation between increased serotonin signalling and obesity (Crane et al., 2015), while earlier investigations suggested that decreased Sert protects against rising glucose levels in female rats (Homberg et al., 2010). Growing evidence in support of a link between serotonin trafficking, food intake and obesity warrants further research to identify the underlying molecular circuitry of these associations. A limitation of our study was that we were unable to confirm the specific influence of palatability on altered eating behaviour and serotonergic signalling as a group of rats fed with a non-palatable HRC diet was not included in the study.

5. Conclusion

We have demonstrated that a palatable HRC diet causes changes in the serotonergic pathway driving abnormal eating behaviour, visceral obesity and altered lipid metabolism in rats. To clarify the relationship between food quality, palatability, the level of consumption and Sert patterns of expression, future investigations could include a second treatment group fed with a non-palatable HRC diet, along with palatable HRC and SC diet groups.

Our results contribute to the growing body of knowledge implicating the serotonergic system in the hypothalamic control of energy intake and may assist in the understanding of neurophysiological mechanisms underlying the obesity epidemic.

Acknowledgments

The authors wish to acknowledge Griffith University School of Medical Science for its funding support. The funding source had no involvement in the experimental design, interpretation of the results or the manuscript.

Declaration of interest

None.

References

  1. Alsio J., Olszewski P. K., Levine A. S. & Schioth H. B. (2012). Feed-forward mechanisms: addiction-like behavioral and molecular adaptations in overeating. Frontiers in Neuroendocrinology 33, 127–139. [DOI] [PubMed] [Google Scholar]
  2. Alsio J., Pickering C., Roman E., Hulting A. L., Lindblom J. & Schioth H. B. (2009). Motivation for sucrose in sated rats is predicted by low anxiety-like behavior. Neuroscience Letters 454, 193–197. [DOI] [PubMed] [Google Scholar]
  3. Avena N. M. & Bocarsly M. E. (2012). Dysregulation of brain reward systems in eating disorders: neurochemical information from animal models of binge eating, bulimia nervosa, and anorexia nervosa. Neuropharmacology 63, 87–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Avena N. M., Rada P. & Hoebel B. G. (2008). Evidence for sugar addiction: behavioral and neurochemical effects of intermittent, excessive sugar intake. Neuroscience and Bio-behavioral Reviews 32, 20–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barson J. R., Karatayev O., Gaysinskaya V., Chang G. Q. & Leibowitz S. F. (2012). Effect of dietary fatty acid composition on food intake, triglycerides, and hypothalamic peptides. Regulatory Peptides 173, 13–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berthoud H. R., Munzberg H., Richards B. K. & Morrison C. D. (2012). Neural and metabolic regulation of macronutrient intake and selection. The Proceedings of the Nutrition Society 71, 390–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bocarsly M. E., Powell E. S., Avena N. M. & Hoebel B. G. (2010). High-fructose corn syrup causes characteristics of obesity in rats: increased body weight, body fat and triglyceride levels. Pharmacology, Biochemistry, and Behavior 97, 101–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bonefeld B. E., Elfving B. & Wegener G. (2008). Reference genes for normalization: a study of rat brain tissue. Synapse 62, 302–309. [DOI] [PubMed] [Google Scholar]
  9. Cansell C., Castel J., Denis R. G., Rouch C., Delbes A. S., Martinez S., Mestivier D., Finan B., Maldonado-Aviles J. G., Rijnsburger M., Tschöp M. H., DiLeone R. J., Eckel R. H., la Fleur S. E., Magnan C., Hnasko T. S. & Luquet S. (2014). Dietary triglycerides act on mesolimbic structures to regulate the rewarding and motivational aspects of feeding. Molecular Psychiatry 19, 1095–1105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Crane J. D., Palanivel R., Mottillo E. P., Bujak A. L., Wang H., Ford R. J., Collins A., Blumer R. M., Fullerton M. D., Yabut J. M., Kim J. J., Ghia J. E., Hamza S. M., Morrison K. M., Schertzer J. D., Dyck J. R., Khan W. I. & Steinberg G. R. (2015). Inhibiting peripheral serotonin synthesis reduces obesity and metabolic dysfunction by promoting brown adipose tissue thermogenesis. Nature Medicine 21, 166–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Daws L. C. & Gould G. G. (2011). Ontogeny and regulation of the serotonin transporter: providing insights into human disorders. Pharmacology Therapeutics 131, 61–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Donovan M. H. & Tecott L. H. (2013). Serotonin and the regulation of mammalian energy balance. Frontiers in Neuroscience 7, 36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. du Toit E. F., Smith W., Muller C., Strijdom H., Stouthammer B., Woodiwiss A. J., Norton G. R. & Lochner A. (2008). Myocardial susceptibility to ischemic-reperfusion injury in a prediabetic model of dietary-induced obesity. American Journal of Physiology Heart and Circulatory Physiology 294, H2336–H2343. [DOI] [PubMed] [Google Scholar]
  14. Emiliano A. B., Cruz T., Pannoni V. & Fudge J. L. (2007). The interface of oxytocin-labeled cells and serotonin transporter-containing fibers in the primate hypothalamus: a substrate for SSRIs therapeutic effects? Neuropsychopharmacology 32, 977–988. [DOI] [PubMed] [Google Scholar]
  15. Erlanson-Albertsson C. (2005). How palatable food disrupts appetite regulation. Basic & Clinical Pharmacology & Toxicology 97, 61–73. [DOI] [PubMed] [Google Scholar]
  16. Fernstrom J. D., Munger S. D., Sclafani A., de Araujo I. E., Roberts A. & Molinary S. (2012). Mechanisms for sweetness. The Journal of Nutrition 142, 1134S–1141S. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garfield A. S. & Heisler L. K. (2009). Pharmacological targeting of the serotonergic system for the treatment of obesity. The Journal of Physiology 587, 49–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Goncalves P., Araujo J. R. & Martel F. (2008). The effect of high glucose on SERT, the human plasmalemmal serotonin transporter. Nutritional Neuroscience 11, 244–250. [DOI] [PubMed] [Google Scholar]
  19. Grabenhorst F., Rolls E. T., Parris B. A. & d'Souza A. A. (2010). How the brain represents the reward value of fat in the mouth. Cerebral Cortex 20, 1082–1091. [DOI] [PubMed] [Google Scholar]
  20. Harchaoui K. E., Visser M. E., Kastelein J. J., Stroes E. S. & Dallinga-Thie G. M. (2009). Triglycerides and cardiovascular risk. Current Cardiology Reviews 5, 216–222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Homberg J. R., la Fleur S. E. & Cuppen E. (2010). Serotonin transporter deficiency increases abdominal fat in female, but not male rats. Obesity 18, 137–145. [DOI] [PubMed] [Google Scholar]
  22. Jijun L., Zaiwang L., Anyuan L., Shuzhen W., Fanghua Q., Lin Z. & Hong L. (2010). Abnormal expression of dopamine and serotonin transporters associated with the pathophysiologic mechanism of Tourette syndrome. Neurology India 58, 523–529. [DOI] [PubMed] [Google Scholar]
  23. Johnston W. L. & Glanville N. T. (1994). Acute dietary PCPA treatment decreases the KD of brain [3H]5-HT binding in rainbow trout, Oncorhynchus mykiss, fed a high carbohydrate diet. Comparative Biochemistry, Physiology, Pharmacology, Toxicology and Endocrinology. 107, 455–461. [DOI] [PubMed] [Google Scholar]
  24. Jorgensen H., Riis M., Knigge U., Kjaer A. & Warberg J. (2003). Serotonin receptors involved in vasopressin and oxytocin secretion. Journal of Neuroendocrinology 15, 242–249. [DOI] [PubMed] [Google Scholar]
  25. Kempadoo K. A., Tourino C., Cho S. L., Magnani F., Leinninger G. M., Stuber G. D., Zhang F., Myers M. G., Deisseroth K., de Lecea L. & Bonci A. (2013). Hypothalamic neurotensin projections promote reward by enhancing glutamate transmission in the VTA. The Journal of Neuroscience 33, 7618–7626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. King B. M. (2013). The modern obesity epidemic, ancestral hunter-gatherers, and the sensory/reward control of food intake. American Psychology 68, 88–96. [DOI] [PubMed] [Google Scholar]
  27. Koskela A. K., Kaurijoki S., Pietilainen K. H., Karhunen L., Pesonen U., Kuikka J. T., Kaprio J. & Rissanen A. (2008). Serotonin transporter binding and acquired obesity – an imaging study of monozygotic twin pairs. Physiology & Behavior 93, 724–732. [DOI] [PubMed] [Google Scholar]
  28. Lam D. D., Garfield A. S., Marston O. J., Shaw J. & Heisler L. K. (2010). Brain serotonin system in the coordination of food intake and body weight. Pharmacology, Biochemistry, and Behavior 97, 84–91. [DOI] [PubMed] [Google Scholar]
  29. Lawton C. L., Wales J. K., Hill A. J. & Blundell J. E. (1995). Serotoninergic manipulation, meal-induced satiety and eating pattern: effect of fluoxetine in obese female subjects. Obesity Research 3, 345–356. [DOI] [PubMed] [Google Scholar]
  30. Lee R., Garcia F., Van De Kar L. D., Hauger R. D. & Coccaro E. F. (2003). Plasma oxytocin in response to pharmaco-challenge to D-fenfluramine and placebo in healthy men. Psychiatry Research 118, 129–136. [DOI] [PubMed] [Google Scholar]
  31. Lenoir M., Serre F., Cantin L. & Ahmed S. H. (2007). Intense sweetness surpasses cocaine reward. PLoS One 2, e698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Livak K. J. & Schmittgen T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. [DOI] [PubMed] [Google Scholar]
  33. Marazziti D., Baroni S., Giannaccini G., Betti L., Massimetti G., Carmassi C. & Catena-Dell'Osso M. (2012). A link between oxytocin and serotonin in humans: supporting evidence from peripheral markers. European Neuropsychopharmacology 22, 578–583. [DOI] [PubMed] [Google Scholar]
  34. Meguid M. M., Fetissov S. O., Varma M., Sato T., Zhang L., Laviano A. & Rossi-Fanelli F. (2000). Hypothalamic dopamine and serotonin in the regulation of food intake. Nutrition 16, 843–857. [DOI] [PubMed] [Google Scholar]
  35. Mitra A., Gosnell B. A, Schioth H. B., Grace M. K., Klockars A., Olszewski P. K. & Levine A. S. (2010). Chronic sugar intake dampens feeding-related activity of neurons synthesizing a satiety mediator, oxytocin. Peptides 31, 1346–1352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mottolese R., Redoute J., Costes N., Le Bars D. & Sirigu A. (2014). Switching brain serotonin with oxytocin. Proceedings of the National Academy of Sciences of the United States of America 111, 8637–8642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Murray S., Tulloch A., Gold M. S. & Avena N. M. (2014). Hormonal and neural mechanisms of food reward, eating behaviour and obesity. Nature Reviews Endocrinology 10, 540–552. [DOI] [PubMed] [Google Scholar]
  38. Park S., Harrold J. A., Widdowson P. S. & Williams G. (1999). Increased binding at 5-HT(1A), 5-HT(1B), and 5-HT(2A) receptors and 5-HT transporters in diet-induced obese rats. Brain Research 847, 90–97. [DOI] [PubMed] [Google Scholar]
  39. Paxinos G., Watson C. R. & Emson P. C. (1980). AChE-stained horizontal sections of the rat brain in stereotaxic coordinates. Journal of Neuroscience Methods 3, 129–149. [DOI] [PubMed] [Google Scholar]
  40. Quarta D. & Smolders I. (2014). Rewarding, reinforcing and incentive salient events involve orexigenic hypothalamic neuropeptides regulating mesolimbic dopaminergic neurotransmission. European Journal of Pharmaceutical Sciences 57, 2–10. [DOI] [PubMed] [Google Scholar]
  41. Rouch C., Nicolaidis S. & Orosco M. (1999). Determination, using microdialysis, of hypothalamic serotonin variations in response to different macronutrients. Physiology & Behavior 65, 653–657. [DOI] [PubMed] [Google Scholar]
  42. Song Z., Levin B. E., McArdle J. J., Bakhos N. & Routh V. H. (2001). Convergence of pre- and postsynaptic influences on glucosensing neurons in the ventromedial hypothalamic nucleus. Diabetes 50, 2673–2681. [DOI] [PubMed] [Google Scholar]
  43. Stice E., Figlewicz D. P., Gosnell B. A., Levine A. S. & Pratt W. E. (2013). The contribution of brain reward circuits to the obesity epidemic. Neuroscience and Bio-behavioral Reviews 37, 2047–2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Suzuki K., Jayasena C. N. & Bloom S. R. (2012). Obesity and appetite control. Experimental Diabetes Research 2012, 824305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. & Speleman F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3, 34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ventura T., Santander J., Torres R. & Contreras A. M. (2014). Neurobiologic basis of craving for carbohydrates. Nutrition 30, 252–256. [DOI] [PubMed] [Google Scholar]
  47. Vucetic Z., Carlin J. L., Totoki K. & Reyes T. M. (2012). Epigenetic dysregulation of the dopamine system in diet-induced obesity. Journal of Neurochemistry 120, 891–898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yeghiayan S. K., Georgelis J. H., Maher T. J. & Lieberman H. R. (2004). Beneficial effects of a protein free, high carbohydrate meal on rat coping behavior and neurotransmitter levels during heat stress. Nutrition Neuroscience 7, 335–340. [DOI] [PubMed] [Google Scholar]
  49. Yoshida M., Takayanagi Y., Inoue K., Kimura T., Young L. J., Onaka T. & Nishimori K. (2009). Evidence that oxytocin exerts anxiolytic effects via oxytocin receptor expressed in serotonergic neurons in mice. Journal of Neuroscience 29, 2259–2271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhou F. C., Xu Y., Bledsoe S, Lin R. & Kelley M. R. (1996). Serotonin transporter antibodies: production, characterization, and localization in the brain. Brain Research. Molecular Brain Research 43, 267–278. [DOI] [PubMed] [Google Scholar]

Articles from Genetics Research are provided here courtesy of Wiley

RESOURCES