Characterization of cucumber mosaic virus infecting coleus (Plectranthus barbatus) in Karnataka

Abstract

Plectranthus barbatus also known by the synonym Coleus forskohlii it is called as forskohlii and Indian coleus. It is a tropical perennial herb belongs to the family Lamiaceae widely cultivated in India used as traditional medicinal crop. Its tuberous roots produce forskolin, an extract useful for pharmaceutical preparations and research in cell biology. The incidence of mosaic with dark and light green patches, mottling, leaf distortion and reduction growth was noticed in commercial cultivation of coleus. For identification of the virus, the infected leaf sample extract was mechanically inoculated to different hosts such as chilli, tobacco, tomato, cucumber, cowpea and Chenopodium amaranticolor. Host range studies revealed that the virus showed severe mosaic symptoms on Nicotiana spp. and Cucumis spp. The virus produced systemic and local lesion symptoms in a different host. The Leaf dip preparation of virus infected leaf extract was observed under an electron microscope showed the presence of isometric particles of 28 nm in size. The healthy and infected samples were tested using DAC-ELISA against antibodies of CMV, GBNV and TSV the infected samples showed strong positive reaction with 1.85 optical density to CMV antibodies indicated the presence of CMV. For molecular identification, total RNA was isolated and used for RT-PCR amplification using CMV specific primers. RT-PCR resulted in the positive amplification in virus infected samples but not from a healthy control. The complete genome of CMV RNA-1 consists of 3360 nucleotides (nt) encoding replicase gene of 807 amino acids (aa). The CMV RNA-2 was 2983 nt in length containing 2a (859 aa) encoding RNA dependent RNA polymerase protein and 2b encoding viral silencing suppressor (112 aa), while RNA-3 encoding 3a movement protein (280 aa) and coat protein (219 aa) was 2223 nt in length. Phylogenetic analyses of nucleotide sequences of coleus CMV isolate is closely related to subgroup IB than to subgroup IA or II with other CMV isolates. In recombination analysis, the recombination event occurs between the subgroups of I, II as well as IA and IB in RNA 1, RNA2 and RNA3 of coleus isolate with other CMV isolates. To best of our knowledge, this is the first report of CMV infection in coleus.

Electronic supplementary material

The online version of this article (10.1007/s13337-019-00536-3) contains supplementary material, which is available to authorized users.

Introduction

Plectranthus barbatus is a perennial herb belongs to the family Lamiaceae widely cultivated in India and plant of Indian origin. It is used as traditional medicine to treat heart diseases, spasmodic pain, painful urination and convulsions [49]. In India, the crop is cultivated in the parts of Karnataka, Tamil Nadu, Gujarat, Maharashtra and Rajasthan. Coleus plants are generally not affected by pests and diseases, but like any other plants, occasionally these are also infected by fungus, virus and viroid. Coleus known to infect by cucumber mosaic virus (CMV), Impatiens necrotic spot virus (INSV) and viroid with no visible symptoms reported from several parts of world [31, 44].

CMV is a type member of the genus Cucumovirus of the family Bromoviridae, it includes Tomato aspermy virus, Peanut stunt virus and Gay feather mild mottle virus [22]. CMV has a wide host range and it is spread to various crop and weeds causing disease in India and worldwide. The virus is transmitted mechanically via plant sap and in nature it is spread by more than 80 species of aphids in a non-persistent manner and also known to transmit through seeds of various plant species [35]. It is an icosahedral/isometric particle of 28–30 nm in diameter approximately and has a tripartite genome of single stranded positive-sense RNAs (RNA 1, 2, 3), encoding five ORFs [35]. ORF 1a and 2a are the replication components, ORF 2b, is overlaps with ORF 2a, which encode a viral RNA silencing suppressor, which is also involved in virus movement and virulence. ORF 3a and 3b encodes the movement protein (MP) and the capsid protein (CP), respectively [5].

Based on the sequence similarity and serological relationships CMV is divided into two major subgroups, I and II, subgroup I is further divided into subgroups IA and IB [36, 41]. CMV strains fall into three main subgroups, IA, IB and II, with nucleotide identities of 72–92% (subgroup II vs. subgroups IA/IB, subgroup IA vs. IB, respectively). Subgroups IA and II are distributed worldwide, whereas subgroup IB is found mainly in Asia [35]. Based on RNase protection assays (RPAs) the genetic structure of CMV populations in Spain, California, and Italy was studied and analyzed the partial genomic sequences [6, 10, 23, 29, 30]. Numerous CMV strains are known to induce a variety of symptoms that ranges from mild mosaic to severe stunting and necrosis [27]. On tomato and tobacco, the necrotic pathotypes of CMV have been reported previously [7, 16]. Although many CMV isolates were reported from different crops, there was no report of coleus CMV in India. In this paper, we reported the infection of CMV in Coleus plants first time in India and studied the biological and molecular characterization of CMV infecting coleus.

Materials and method

Source and maintenance of the virus

The plant showing mosaic with dark and light green patches, mottling, leaf distortion and reduction growth was collected from Indian Institute of Horticultural Research (IIHR), Bengaluru, Karnataka. The virus was mechanically inoculated and maintained in Nicotiana tabacum cv. Samsun which served as virus source for further experiments.

Mechanical transmission (sap transmission) and host range

In chilled mortar and pestle, the infected coleus leaves were ground using potassium phosphate buffer (pH 7.0, 0.05 M) at the rate of 2 ml/gm of leaf tissue. The resultant extract was considered as standard inoculum, to that inoculum Celite (600 mesh) at the rate of 0.025 g/ml of the extract and 0.02% mercaptoethanol was added, carborundum powder was dusted on the leaves of Nicotiana tabacum cv. Samsun to cause the injury. On the upper surface of the leaves, the virus was inoculated and washed 1–2 min after inoculation to remove the excess of inoculum. The plants were kept in the insect proof glass house at 30 ± 2 °C for symptom expression.

For host-range studies, coleus infected leaf extract was inoculated mechanically to different species of tobacco (Nicotiana tabacum cv. Samsun and N. glutinosa), chilli, tomato, cucumber, cowpea, and Chenopodium amaranticolor. Five plants from each plant species were inoculated and kept in an insect proof greenhouse for symptom development.

Electron microscopy and DAC-ELISA

The suspension obtained by partial purification of samples from both healthy and infected plants was taken for transmission electron microscopic studies. The formavar coated grids were immersed on purified suspension for 10 min. Then, the grids were stained with 2% phosphotungstic acid (PTA) for 5 min and allowed to dry. Later, it was observed under Hitachi transmission electron microscope.

The healthy and infected coleus plants were tested by the direct antigen coating enzyme linked immunosorbent assay (DAC-ELISA) against antibodies of CMV, GBNV and TSV for identification of the virus. Assays were considered positive if OD405 nm values were twice or more times that of the healthy control and greater than 0.1.

Molecular characterization

Total RNA isolation

The total RNA was isolated from infected coleus plants by using TRI reagent (Sigma catalogue no. T 9424) according to the manufacturer’s protocol. DNase treatment was given for the removal of trace amount of DNA during RNA purification. The purity and quantity were checked using NanoDrop 1000 Spectrophotometer (Thermo Scientific, USA). Total RNA was used to prepare double stranded cDNA.

RT-PCR amplification, sequencing and phylogenetic analysis

The RNA was subjected to reverse transcription-polymerase chain reaction (RT-PCR) using eight pairs of CMV specific primers (Table 1). The RT-PCR was carried out using RevertAid Reverse Transcriptase (Thermo Scientific, USA) enzyme for the synthesis of c-DNA. The c-DNA was subjected to Polymerase Chain Reaction (PCR) using all three CMV RNA’s (RNA1, RNA2 and RNA3) specific primers. The PCR amplification was carried out in a thermal cycler (Eppendorf) with the following conditions; initial denaturation at 94 °C for 3 min followed by 35 cycles with the following parameters 45 s of denaturation at 94 °C, 1 min of annealing at 58 °C and extension for 1.30 min at 72 °C followed by a final extension for 20 min at 72 °C. Amplified DNA fragments were electrophoresed in 1% agarose gel staining with ethidium bromide at 80 V for 45 min.

Table 1.

List of primers used for the amplification of whole genome of CMV

Primer set	Sequence (5′-3′)	Annealing temperature (°C)	Expected size (kB)	Designed genome
CMRN1 2F/1355 R	F: GTTTATTTAGAAGAGGGTACGGTTC R: CAGGATTGCATGGACATAGA	58	1.3	RNA1
CMRN1 1294F/2515R	F: CATTGTYATYAATGGTATGTCCATG R: CATATAGCTGGGAGAGCCTT	55	1.2
CMRN12485/CM3R1	F: GAAGGCYGTGCGAGGTATAT R: GGTCTCCTTTTGGAGACCCCCAC	58	0.8
CMRN12F/CMRN21142R	F:GTTTATTTAGAAGAGGGTAC R:CTCCTTGGTHGTACCTACCTACTCT	58	1.1	RNA 2
CMRN21116F/CMRN2 2340R	F:CATCGTYATAAATGGTATGTGCATA R:CATATACCTGGGAGAGCCTGATC	50	1.2
CMRN22178F/CMRN2 2979	F:CCGAATGWCTCAGTCTTGATC R:CTAGAAGTACACGGACCGAA	55	0.8
CM1159F/CM3R1	F:CATGGATGCTTCTCCGGGAGATTG R:GGTCTCCTTTTGGAGACCCCCAC	67	1.1	RNA 3
CM3F1/CM12552R1	F:GTAATCTTACCACTGTGTGTGTG R:CAGATTTGTCCATGACTCGACTC	56	1.2

The PCR product was cloned in pTZ57R/T cloning vector by following standard molecular biology procedures [42]. After confirmation of the presence of insert in the clone, the plasmid DNA was isolated using alkaline lysis method and sequenced using the automated sequencing facility at Medauxin Sequencing Pvt. Ltd., Bengaluru. At least two clones were sequenced for each amplicon and each amplicon was sequenced from both strands to get the consensus sequence and was assembled using the software BIOEDIT version 7.0 programs. Database searches with CMV sequences were carried out by NCBI BLAST program (http://blast.ncbi.nlm.nih.gov). Nucleotide (nt) and amino acid (aa) sequence alig nments were performed using CLUSTALW program. These data were used for phylogenetic analysis using MEGA version 7.0 [48]. A phylogenetic tree was constructed using the neighbour-joining method with 500 bootstrap replications using available CMV sequences from the GenBank.

Recombination analysis

The possible recombination was detected between different CMV isolates, using the RDP4 program. To identify the recombination breakpoints seven detection methods were used viz. RDP, GENECONV, BOOTSCAN, MAXCHI, CHIMAERA, SISCAN programs and 3SEQ. The analyses were done using different detection programs with default settings and a Bonferroni-corrected P value cut-off of 0.01. The obtained results were re-checked using the original SISCAN [13]. These analyses identified the non-recombinant sequences which were closest to the recombinant sequences and also identified the evolutionary links in the recombinant genomes.

Results

Mechanical inoculation and virus confirmation

The virus from infected coleus leaves was easily sap transmitted to healthy plants of Nicotiana tabacum cv. Samsun used as diagnostic hosts for CMV. On inoculated tobacco leaves, mosaic symptoms appear 6–7 days after inoculation. The virus was maintained Nicotiana tabacum cv. Samsun. In host range studies, the virus transmitted readily by mechanical inoculation to healthy plants and induces systemic severe mosaic symptoms on cucumber, N. tabacum, N. glutinosa and on chilli (Fig. 1).

Fig. 1.

The plants showing systemic symptoms like mosaic, mottling and reduction in leaf size after mechanically sap inoculated from infected coleus plants. 1 Coleus, 2N. glutinosa, 3 Cucumber, 4 Chilli, 5N. tabaccum and chlorotic local lesion in Chenopodium amaranticolor (6)

Numerous isometric particles measuring of about 28–30 nm size virus-like particles were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts prepared from leaf tissue of infected samples, but there were no particles was observed in healthy leaves. The DAC-ELISA results indicated that, the virus was strongly reacted to CMV specific antibodies with the absorbance values of 1.85 O.D value it indicates the presence of CMV in coleus plants.

Molecular characterization

The virus infected coleus samples which are confirmed through Electron microscopy and ELISA testing using CMV antibodies were further tested by RT-PCR using CP gene specific primers, CMCPF and CMCPR resulted in the amplification of 800 bp DNA fragments in virus infected sample but not from a healthy control. Sequence analysis of complete CP of the infected sample showed that 93–98% nucleotide sequence identity with known CMV isolates. Eight pairs of overlapping CMV specific primers designed were used for complete genome sequencing and to know the genome organization. The RT-PCR amplified DNA fragments were cloned into pTZ57R/T vector, sequenced and complete genome sequence was determined. The whole genome sequence of three genome components of coleus CMV isolates viz., RNA1 (MK482376), RNA 2 (MK482377) and RNA 3 (MK482378) were deposited in the NCBI gene bank. The sequence analysis revealed that the complete genome of CMV RNA-1, 2, 3 consists of 3360, 2983 and 2223 nucleotide (nt) respectively. Complete genome sequences of 43 different isolates were selected from NCBI database and compared with coleus CMV isolates (Supplementary Tables 2 and 3).

The sequence analysis revealed that the complete genome of CMV RNA-1consists of 3360 nt, with a single ORF, encoding the 1a protein which is required for viral replication, it also contains methyltransferase and helicase motifs, which starts at 96 nucleotide position and ends at 3077 position. RNA1 having one ORF encoding replicase/helicase gene of 807 amino acids (aa) involved in the replication. The 5′ and 3′ untranslated region (UTR) consists of 95 and 281 nt. Comparative sequence analysis with other CMV isolates showed highest nucleotide homology of 88.3–89.9% with subgroup 1A, 89.1–96.2% with subgroup 1B, 86.9–87.5% with subgroup 1C and 75.5–77.6% with subgroup II isolates of CMV. Comparison of deduced amino acid sequence indicated that amino acid homology of 91.9–93.7% with subgroup 1A, 91.6–97.4% subgroup 1B, 91.3% with subgroup 1C and 81.9–84.4% with subgroup II isolates (Supplementary Tables 2 and 3).

The nucleotide sequence analysis revealed that the complete genome of CMV RNA-2 consists of 2983 nt, with two open reading frames (ORFs), 2a (859 aa) encoding RNA dependent RNA polymerase protein contains 2577 nt, and 2b encoding viral silencing suppressor (112 aa) contains 335 nt. The 5′ and 3′ untranslated region (UTR) of RNA2 is 78 nt and 233 nt in length. Comparative sequence analysis revealed that RNA2 of coleus isolate showed highest nucleotide homology of 87.1–89.7% with subgroup IA isolates, 83–94.1% with subgroup IB isolates 83.5–88.1% with subgroup IC and 75.5–77.6% with subgroup II isolates of CMV. Similarly, amino acid homology showed 84.8–94.1% identity with IA, 87.5–98.3% IB, 91.1% with IC and 79.9–82.4% with subgroup II.

The sequence analysis revealed that the complete genome of CMV RNA-3 consists of 2223 nt, with two open reading frames (ORFs), i.e. 3a and 3b, 3a starts at the 5′ end encodes movement protein (3a) and the nucleotide sequence of the 3a gene starts at position 124 and ends at 963 and the 3b at the 3′ end encodes the coat protein (CP) and the CP gene starts at 1263 and ends at 1919. RNA3 contains a 5′ noncoding region of 123 nucleotides, a 3′ noncoding region of 301 nt, and an intergenic region of 299 nt. Comparative sequence analysis revealed that RNA3 of coleus isolate showed highest nucleotide homology of 86–92.20% with subgroup 1A, 82.7–95.7% with 1B, 80.1–85.3% with 1C and 70.1–77% with subgroup II isolates of other CMV isolates. The amino acid homology is 88.3–96.8% with 1A, 82.1–96.8% with 1B 88.5% with 1C and 79.4–85 6% with subgroup II of other CMV isolates. Both the ORFs were separated by an intergenic region (IR) of 300 nucleotides.

Phylogenetic and recombination analysis

To determine the phylogenetic relationships, a total of 49 complete genome sequences of CMV isolates were selected from the NCBI Genbank database and maximum-likelihood method with 500 bootstrap replicates was followed to construct phylogenetic trees for RNA 1, RNA 2 and RNA 3 (Figs. 2, 3, 4). The phylogenetic tree constructed based on nucleotide sequences revealed that the four clusters were formed which clearly separated the RNA1, RNA2 and RNA3 of coleus CMV into subgroups IA, IB, IC and II. The RNA 1 was closely related to snake gourd, black pepper and chilli isolates reported from India (Fig. 2). Whereas RNA2 clustered with black pepper and chilli isolate reported from India and tomato isolate reported from Egypt (Fig. 3) and RNA3 clustered with tomato isolates reported from India, Taiwan and Italy (Fig. 4). This phylogenetic tree indicated that the CMV isolate from coleus belongs to subgroup IB and distinct from subgroup II.

Fig. 2.

Phylogenetic analyses for the complete genome sequences of RNA1 of the CMV population and Peanut stunt virus (PSV) was included as an out-group. Phylogenetic trees were reconstructed by the maximum-likelihood method applying the Tamura-Nei model method for nucleotide sequence analyses. Numbers on the branches indicate bootstrap percentages based on 100 replications (values > 50% are shown)

Fig. 3.

Phylogenetic analyses for the complete genome sequences of RNA2 of the CMV population and Peanut stunt virus (PSV) was included as an out-group. Phylogenetic trees were reconstructed by the maximum-likelihood method applying the Tamura-Nei model method for nucleotide sequence analyses. Numbers on the branches indicate bootstrap percentages based on 100 replications (values > 50% are shown)

Fig. 4.

Phylogenetic analyses for the complete genome sequences of RNA3 of the CMV population and Peanut stunt virus (PSV) was included as an out-group. Phylogenetic trees were reconstructed by the maximum-likelihood method applying the Tamura-Nei model method for nucleotide sequence analyses. Numbers on the branches indicate bootstrap percentages based on 100 replications (values > 50% are shown)

Recombination analysis using RDP4 tool showed that RNA1 of CMV-coleus was predicted to have recombination event between the position 2528 and 2570 nucleotide position with CMV-SG isolate from India (KF891356) and Uganda isolate (MG021457) as their major parent. In this study, we sought to characterize recombination in CMV-coleus and 49 other full genome sequences of CMV strains, from different parts of the world, using RDP4. CMV-coleus RNA1 shows very close evolutionary ties to the snake gourd isolate of India and Ug99 isolate of Uganda as a major parent. The IA isolates of Lilium (AJ879490) from India and 117F-tomato isolate from France have contributed as minor parents. Similar evolutionary links were observed in CMV-coleus RNA3, with the ND-tomato isolate and SG isolate of subgroup IB from India appearing as major parents and the Lilium isolate of India (subgroup IA) as a minor parent. The CMV-ND RNA2 analysis indicated capsicum isolates of subgroup IB from India as a major parent and with unknown minor parent (Supplementary Table 4).

Discussion

CMV is known to be infecting several crops, weeds and medicinal plants worldwide. In India natural occurrence of CMV has been reported on a range of crops such as Lily [43], Datura [45], Banana [18, 53], Tulasi [17] Black pepper, Betel vine [14], Brinjal [24], Bottle gourd, Snake gourd [32], Carrot [2], Castor [39], Chilli, Chrysanthemum [46], Cucumber [26], Gerbera [11, 50], Geranium [52], Gladiolus [8], Jatropha [38], Ornithogalum [51], Petunia [10] and Tomato [12, 23, 37, 47] are characterized. The present investigation reports the natural occurrence of CMV on coleus and its identification based on Electron microscopy, ELISA testing and complete genome sequencing.

Mechanical sap transmission of coleus isolate for host range determination resulted in chlorotic local lesions on Chenopodium amaranticolor 3–4 days after mechanical sap inoculation. The virus isolate induced systemic symptoms such as mosaic, mottling and leaf deformation on chilli, cucumber, Nicotiana tabacum, N. glutinosa, Cucurbita pepo, Cucumis sativus, Physalis floridana, Solanum lycopersicum and Vigna angularis similar results were reported earlier [26]. The partially purified preparation showed isometric particles of about 28–30 nm size observed under a transmission electron microscope it is similar to previously described results [39]. The positive reaction of coleus isolates to CMV antibodies in ELISA testing has confirmed the presence of CMV [19].

For sequence comparison, complete sequences of 49 different isolates were selected and compared with coleus CMV isolate. RNA1 showed the highest nucleotide homology of 93.4% with chilli isolate (KM272277) from India, 92.6% with capsicum (HE962478) from Italy and 91.1% with elephants ears (MG021457) from Uganda. The RNA2 also shared maximum nucleotide identity of 94.8% with chilli isolate (KM272277), 93.2% with black pepper isolate (KU947030) from India. Similarly, RNA3 shared 95.7% sequence identity with tomato isolate (Y16926) from Italy, 95.5% (D28780) from Taiwan and 95.5% with Canna sp. (FJ268746) reported from China. Coleus isolate shared maximum nucleotide identity with subgroup IB isolates from India and Asia and clustered along with other known subgroup IB isolates in Phylogenetic analysis similar to earlier reports [3, 9, 26]. The coding regions, Replicase gene showed 88.3–93.6%, RdRp showed 86.2–95.8%, viral suppressor gene showed 65.7–75.8%, coat protein showed 76.9–98.7% and movement protein showed 78.8–95.6% sequence similarities with 1B similar result reported in cucumber [26], tomato [12] Cowpea [20] and in long pepper [14] pepper [21]. The comparison of various genes viz., replicase gene, RdRP, viral suppressor gene, CP, MP, intergenic region and UTRs of all the three segments were very similar to the other Indian isolates of CMV [25]. The coleus CMV isolate is having closest relationship with CMV of chilli, tomato, black pepper and snake gourd reported from India and it belongs to subgroup IB. Based on serological relationships, sequence data and nucleic acid hybridization assays CMV isolates are classified into two main subgroups (I and II) worldwide [34]. The percentage of RNA sequence identity between isolates belonging to the different subgroups ranges from 69 to 77%, depending on the genomic region. For isolates within the same subgroup, the sequence identity is above 88% for subgroup I and above 96% for subgroup II [40]. Subgroup I is further divided into two subgroups i.e. IA and IB, based on nucleotide variation in the 5′ non-coding region of RNA3 [41]. The present study showed that the all the CMV isolates reported from India belongs to subgroup IB and few in subgroup II and is highly conserved in India because subgroups IA and II have a worldwide distribution, while subgroup IB is reported to be principally restricted to Asia [30]. The phylogenetic analysis revealed an additional subclade IC within the subgroup-I was found to contain four isolates (pH2-C, pNb-C, pt-C and BX-C) reported in Pinellia ternata from China [54]. In addition to tomato, subgroup-II isolates were also reported in India infecting carrot (EU642567), lily [43] and geranium [52].

In this study, we sought to characterize recombination in CMV-coleus and 45 other full genome sequences of CMV strains, from different parts of the world, using RDP3. CMV-coleus RNA1 shows very close evolutionary ties to the snake gourd isolate of India and Ug99 isolate of Uganda as a major parent. The IA isolates of lilium (AJ879490) from India and 117F-tomato isolate from France have contributed as minor parents. Similar evolutionary links were observed in CMV-coleus RNA3, with the ND-tomato isolate and SG isolate of subgroup IB from India appearing as major parents, and the lilium isolate of India (subgroup IA) as a minor parent. The CMV-ND RNA2 analysis indicated capsicum isolate of subgroup IB from India as a major parent and with unknown minor parent.

Understanding genetic structures of virus populations and their evolutionary mechanisms is an important aspect of managing viral diseases and the risk of emerging new viruses or strains. Several studies were attempted to examine population genetics of CMV based on serological analyses, RPA and analyses of partial genomic sequences [7, 9, 23, 28, 29]. Changes in the genetic composition of a virus population in addition to new phenotypes which can arise as a result of genetic exchanges (e.g. reassortment and recombination), can compromise the effectiveness of disease control strategies [1]. Therefore, to design the improved disease management strategies, understanding of the genetic structure and associated factors or selective forces driving CMV evolution is important. However, accumulating evidence suggests that genetic exchanges by recombination and reassortment might have played an important role in CMV evolution [3, 4, 15, 33, 40]. CMV populations can undergo rapid genetic change by the reassortment of genomic segments or by genetic recombination [33]. Reassortment is an evolutionary mechanism characteristic of segmented RNA viruses that plays an important role in virus emergence and interspecies transmission. This implies that more complete analyses with full genome sequences of CMV populations are required for understanding the genetic structure of CMV populations and their evolutionary histories. In the present study, we investigated the molecular genetic structure of CMV coleus isolate with other CMV subgroup isolates and considerable variation is noticed in Indian CMV isolates.

Based on the mechanical transmission on various host species, presence of isometric particles of 28 nm in EM, positive reaction with antiserum to CMV and complete genome sequencing the virus isolate under study associated with mosaic disease of coleus has been identified as a strain of CMV of subgroup IB which has close relationships with Indian CMV strains belonging to subgroup 1B.

Electronic supplementary material

Below is the link to the electronic supplementary material.