Skip to main content
Biology of Reproduction logoLink to Biology of Reproduction
. 2019 Jul 27;101(5):986–1000. doi: 10.1093/biolre/ioz137

Synergistic inhibition of csal1 and csal3 in granulosa cell proliferation and steroidogenesis of hen ovarian prehierarchical development†

Hongyan Zhu 1,2, Ning Qin 1,3, Xiaoxing Xu 4, Xue Sun 1,3, Xiaoxia Chen 1, Jinghua Zhao 1, Rifu Xu 1,3,✉, Birendra Mishra 4,✉
PMCID: PMC6877779  PMID: 31350846

Abstract

SALL1 and SALL3 are transcription factors that play an essential role in regulating developmental processes and organogenesis in many species. However, the functional role of SALL1 and SALL3 in chicken prehierarchical follicle development is unknown. This study aimed to explore the potential role and mechanism of csal1 and csal3 in granulosa cell proliferation, differentiation, and follicle selection within the prehierarchical follicles of hen ovary. Our data demonstrated that the csal1 and csal3 transcriptions were highly expressed in granulosa cells of prehierarchical follicles, and their proteins were mainly localized in the cytoplasm of granulosa cells and oocytes as well as in the ovarian stroma and epithelium. It initially revealed that both csal1 and csal3 may be involved in chicken prehierarchical follicle development via a translocation mechanism. Furthermore, our results showed an abundance of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA in granulosa cells, and the proliferation levels of granulosa cells from the prehierarchical follicles were significantly increased by siRNA-mediated knockdown of csal1 or/and csal3. Conversely, the overexpression of csal1 or/and csal3 in the granulosa cells led to a remarkably decreased of them. Moreover, csal1 and csal3 together exert a much stronger effect on the regulation than any of csal1 or csal3. These results indicated that csal1 and csal3 play synergistic inhibitory roles on granulosa cell proliferation, differentiation, and steroidogenesis during prehierarchical follicle development in vitro. The current data provide a basis of molecular mechanisms of csal1 and csal3 in controlling the prehierarchical follicle development and growth of hen ovary in vivo.

Keywords: csal1, csal3, synergistic inhibition, proliferation, differentiation, follicle selection


Summary Sentence The transcription factors csal1 and csal3 might play a synergistic inhibitory role on granulosa cell proliferation, differentiation, and steroidogenesis during PF development.

Introduction

Ovarian follicle development in the hen (Gallus gallus) is a highly complex process involving the actions of numerous endocrine, paracrine, and autocrine factors in a spatial and temporal manner and is characterized by dramatic changes during the follicle selection (cyclic recruitment) [1, 2]. A strictly controlled follicular hierarchy is maintained in the hen. Only a small percentage of follicles into the preovulatory hierarchy are selected from prehierarchical follicles (PFs) (6–8 mm in diameter), reach maturity, and undergo ovulation. During this process, proliferation and differentiation of granulosa cells (GCs) play crucial roles in PF development, selection, and growth [3, 4]. CyclinD1 (CCND1) plays a central role in the regulation of proliferation by regulating cell cycle progression in humans [5, 6]. CCND1 is the target gene of beta-catenin protein (β-catenin), and nuclear accumulation of mutated β-catenin in hepatocellular carcinoma is associated with increased cell proliferation [7]. As a key downstream effector of the canonical Wnt signaling pathway, β-catenin also contributes to cell proliferation and tumorigenesis [8]. It is suggested that CCND1 and β-catenin (Bcat) are the promising biomarkers for cell proliferation of GCs within ovarian PFs. Several other factors, such as steroidogenic acute regulatory protein (StAR) and cytochrome p450, family11, subfamily A, polypeptide 1(CYP11A1) have been proved to promote the growth and cell differentiation of GCs in chicken hierarchal follicles and steroidogenesis [4, 9, 10]. Prior to follicle selection (9–12 mm in diameter), the granulosa layer remains in an undifferentiated state as shown by the undetectable to very low mRNA levels of CYP11A1 and StAR; however, immediately after selection, the CYP11A1 and StAR mRNA levels dramatically increase in the granulosa cell layer during the developmental stages [4, 11, 12]. Follicle-stimulating hormone (FSH) induces GC proliferation, differentiation, and follicle selection by stimulating FSH receptors (FSHRs), StAR and CYP11A1 expression, and steroidogenesis [10, 13, 14]. The FSHR mRNA is highest in the granulosa layer from the 6–8 mm follicles for selection [4, 10, 15]. Therefore, the increased expression levels of FSHR transcription in the GCs of PFs (6–8 mm in diameter) have generally been accepted as an indicator to initiate follicle selection [3, 4, 10]. Furthermore, accumulating evidence indicates that the spalt gene family may be involved in ovarian follicle development and growth [16–20].

Previous studies have documented that four members of spalt, spalt1 (sal1), sal2, sal3, and sal4, are required for the specification of head and tail regions in Drosophila embryos [21]. The spalt members are characterized by multiple C2H2-type zinc-finger motifs (ZFs) serving as trans-regulators of gene expression during growth and development [22, 23]. In chicken, three homologues of the spalt family have been described so far, csal1 (also named SALL1), csal3 (SALL3), and csal4 (SALL4) [24, 25, 27]. Expression of csal1 is predominantly detected in the developing heart, mesoderm, ectoderm, and neural tube of the early embryo [24, 25], whereas csal3 is found in the neural tissue, limb buds, mesonephros, and cloaca [26, 27]. The SALL proteins have been described as transcriptional repressors because the N-terminal region of the protein contains a highly conserved 12-amino acid motif, which is sufficient for the recruitment of nucleosome remodeling and deacetylase corepressor complex (NuRD) [28], of which SALL1 is capable of binding to β-catenin and activates synergistically a reporter construct responding to the Wnt signaling pathway through recruitment of remodeling factors to heterochromatin [29]. Moreover, SALL2 binds and represses CCND1 promoters and is recognized as a novel mechanism by which SALL2 exerts a negative regulatory role in cell proliferation associated with the regulation of cell cycle progression [19]. SALL2 is deregulated and is proposed as a tumor suppressor in human ovarian cancer [17, 18, 30]. This information has revealed that the SALL family is related to ovarian development. However, there is no direct evidence to prove that the component of SALL family plays an essential role in ovarian follicle development in chickens.

To delineate the functions and regulatory mechanisms of csal1 and csal3 in regulating the ovarian follicular development in chicken, we examined the expression profile of csal1 and csal3 in PFs. Furthermore, the effects of csal1 and csal3 on GCs proliferation and expression of CCND1, Bcat, StAR, CYP11A1, and FSHR genes that contribute to cell proliferation, differentiation, and steroidogenesis were investigated.

Materials and methods

Chicken and sample collection

The Hy-Line Brown layers were utilized from the College of Animal Science and Technology of Jilin Agricultural University. All hens were reared in laying batteries under standard husbandry practices and were exposed to a 16L: 8D photoperiod as previously described [4]. Laying hens at 21 weeks of age (n = 20) were selected from the population and euthanized for ovarian follicle sampling. According to Gilbert et al. [31] and Knight et al. [33], follicles within the ovary were grouped into PF (from less than 1 to 8 mm in diameter) and were classified as small white follicles (less than 1 mm), large white follicles (2–5 mm) and small yellow follicles (6–8 mm), and preovulatory follicles that are arranged in a hierarchical order to clearly demarcate the stage of the development of each follicle from large yellow follicles (9–12 mm) to large yellow preovulatory follicles (13–40 mm, named F5, F4, F3, F2, and F1, respectively) [32]. After slaughter, the ovary from each hen was immediately removed and placed into ice-cold 0.9% NaCl solution. GCs from the PFs in various sizes (1–3.9, 4–4.9, 5–5.9, 6–6.9, and 7–8 mm in diameters) and preovulatory follicles were taken from the hen ovaries and then dispersed for culture as previously described [34, 35, 36]. A representative portion of each ovary was taken and snapped frozen immediately in liquid nitrogen and stored at −80 °C until analysis. All animal experimentations were carried out in accordance with the guidelines (Permission No. GR(J)18-010) approved by the Institutional Animal Care and Use Committee of Jilin Agricultural University (Changchun, China).

Immunofluorescence assay

Immunofluorescence staining was used to investigate the expression of csal1 and csal3 proteins in ovarian PFs. Briefly, follicles were collected and were fixed in 4% paraformaldehyde (pH 7.4), embedded in paraffin after dehydration and then cut into 4 mm tissue sections. The sections were mounted on silanized glass slides, deparaffinated and rehydrated as described [9], pretreated to unmask antigen using 10 mM citrate buffer (pH 6.0) for 10 min at 98 °C, and blocked with 5% goat serum. Sections were then incubated at 4 °C overnight with anti-csal1 antibody (1:100, Abcam, Cambridge, MA, USA) or anti-csal3 antibody (1:50, Novus, Littleton, CO, USA) as shown in Supplemental Table S1 followed by goat anti-rabbit fluorescence antibody coupled to Cy3 (1:100, Boster Biological Technology, Wuhan, China) for a 60-min incubation. Nuclei counterstain was with DAPI (4′, 6-diamidino-2-phenylindole) (Sigma, St Louis, MO, USA) for 5 min. After being washed thrice with PBS, slides were coverslipped using a mounting solution. All fluorescence images were captured using the same exposure time by fluorescence microscopy system (Zeiss), and the pictures were merged using Axio Vision Rel. 4.8 software (Carl Zeiss Ltd., Oberkochen, Germany) as previously reported [37].

Cell culture

The GCs isolated from the PFs (6–8 mm diameters) were cultured in Medium199 (M199; Gibco, Waltham, MA, USA) supplemented with 10% (v/v) fetal calf serum (Gibco) at 37 °C with 5% CO2 in humidified chambers. The cultured GCs used in this experiment have been purified and quantified in our laboratory [4, 10]. The specificity of the GCs has been identified by the H & E staining procedure and fluorescence staining analysis [9, 12].

Quantitative real-time PCR analysis (qPCR)

Total RNA was isolated from the various-sized PFs and csal1, csal3-transfected cells at 1 × 106 cells/well using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. Total RNA (100 ng) was reverse transcribed using a reverse transcription kit (TaKaRa, Dalian, China). Expressions of csal1, csal3, CCND1, Bcat, StAR, CYP11A1, FSHR, and 18S rRNA were analyzed using qPCR. RT-qPCR primers were also from TaKaRa (Table 1). SYBR Green RT-qPCR assay for the target genes was performed in optical 96-well plates using the SYBR Premix EX TaqII (TaKaRa, DRR081A) and 7500 Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA), according to the manufacturer’s instructions. Results were detected quantitatively in real-time by relative quantitation of two standard curves. Using the 2−ΔΔCt method, the mRNA expression results were normalized against 18S rRNA as an internal control. All experiments were performed three times, each time in triplicate.

Table 1.

The sequences of genes for RT-qPCR.

Gene Primer sequences (5′-3′) Accession no. Size (bp)
csal1 5′-CCCAGGAAGCAAGGTGTA-3′ NM_204707.1 167
5′-CGTTGGCATGTCCGTATT-3′
csal3 5′-CTCCTCATCGG CTGTTGG-3′ NM_204647.1 197
5′-GTGGTGGGCTGTCTGGTT-3′
18S rRNA 5′-GAAACGGCTACCACATCC-3′ AF173612.1 169
5′-CACCAGACTTGCCCTCCA-3′
FSHR 5′-TCCTGTGCTAACCCTTTCCTCTA-3′ NM_205079.1 207
5′-AACCAGTGAATAAATAGTCCCATC-3′
StAR 5′-AGCAGATGGGCGACTGGAAC-3′ AF220436.1 148
5′-GGGAGCACCGAACACTCACAA-3′
CCND1 5′-AAACGATTCCTCTGACCGCA-3′ NM_205381.1 125
5′-GGTCATTGCAGCCAGATTCC-3′
CYP11A1 5′-TCCGCTTTGCCTTGGAGTCTGTG-3′ NM_001001756.1 112
5′-ATGAGGGTGACGGCGTCGATGAA-3′
Bcat 5′-CGGAGGACAAACCACAAGACTAC-3′ NM_205081.1 184
5′-TATCCGCCAGAGTGGAAAGAAC-3′

Western blotting

Western blotting for csal1 and csal3 was performed. GCs were washed, harvested, lysed with a lysis buffer (20 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% SDS, 1% Triton X-100, 10 μg/ml of leupeptin, 1 mM of aprotinin, and 1 mM of PMSF) on ice for 30 min, and centrifuged at 14 000 g at 4 °C for 15 min. Proteins were resolved by SDS-PAGE, transferred onto PVDF membranes, blocked at room temperature for 1 h in 5% BSA, and then incubated overnight at 4 °C on a rotator with the primary antibodies: csal1 (1:500, Abcam, Cambridge, MA, USA), csal3 (1:500, Novus, Littleton, CO, USA), and β-actin (1:200, Boster Biological Technology, Wuhan, China), which was used as a loading control. Membranes were washed four times with TBST and incubated for 1 h with appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000, S Boster Biological Technology, Wuhan, China) (Supplemental Table S1). Immunoreactivity was visualized with an enhanced chemiluminescence detection reagent (ECL,ThermoScientific, Rockford, USA). All experiments were performed three times, each time in triplicate.

Construction of expressing vector

The chicken csal1 and csal3 cDNA sequences (NM_204707.1 and NM_204647.1) were amplified by specific primers (Table 2) for csal1 and csal3 genes from a chicken cDNA library by PCR, and cloned into a pUC57-Simple plasmid (Sangon Biotech Co., Ltd., Shanghai, China). After the recombined plasmids were identified by restriction enzyme (EcoR I and Pme I, TaKaRa, Dalian, China) digestion assay (Supplemental Figure 1), sequencing of the targeted fragments was performed. Then, the csal1 and csal3 cDNA sequences were subcloned separately into pYr-adshuttle-4 expressive vector containing an N-terminal hemagglutinin epitope (HA) tag (Biobuffer Biotech Service Co. Ltd., Wuhan, China) to generate the pYr-adshuttle-4-csal1/csal3 expression construct as previously described [4].

Table 2.

The sequences of csal1 and csal3 for construction of expressing vector.

Gene Recombinant vector Primer pairs (the forward and reverse, 5′-3′) Restriction sites
csal1 pUC57-simple-csal1 Forward:5′CCGGAATTCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCG-3′ EcoRI
Reverse:5′AGCTTTGTTTAAACGGCGCGCCGGCTAATTTGTTACGATTTCTTTGTT-3′ Pme I
csal3 pUC57-simple-csal3 Forward:5′CCGGAATTCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCT-3′ EcoRI
Reverse:5′AGCTTTGTTTAAACGGCGCGCCGGTTAATTTATGCCAATCTCTTTATTAT-3′ Pme I

Note: The underlined nucleotides indicate the location corresponding to each of the restriction sites. The Kozak sequence is indicated with a dotted line.

Cell transfection

The transfection for the csal1 and csal3 gene expression using the recombinant plasmid vector pYr-adshuttle-4-csal1/csal3 was performed as previously reported [4, 10]. Briefly, the GCs were randomly grouped and transfected with pYr-adshuttle-4-csal1/csal3 and pYr-adshuttle-4 blank vector using the Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA). The cultures (105 cells/well in a 24-well plate) were conducted in a basal medium containing 1 μl/ml polybrene (hexadimethrine bromide, Sigma) and incubated at 37 °C with 5% CO2 according to the manufacturer’s instructions [4]. After 24 h of continuous culture, the GCs were collected, and the transfection efficiency was confirmed by qPCR and western blotting.

RNAi

Specific siRNA sequences targeting the chicken csal1 and csal3 gene were designed using InvivoGen siRNA Wizard v3.1 (http://www.invivogen.com/sirnawizard/). All designed siRNA sequences were blasted against the chicken genome database to eliminate the cross-silence phenomenon with nontarget genes. The most effective csal1- and csal3-specific siRNAs were further screened by RT-qPCR and Western blotting. Cells transfected with scramble siRNA that does not target any gene were used as the negative control (Table 3). As mentioned above, GCs were plated in 24-well plates, and the siRNAs were transfected into the cultured cells with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

Table 3.

siRNA sequences for the target sites in the csal1 and csal3 gene.

Gene Sequences
csal1 5′-GCUUCCAGCAUUAACAAUATT-3′
csal3 5′-GCGAGUACACCCAAUAUAUTT-3′
Scrambled 5′-UUCUCCGAACGUGUCACGUTT-3′

Granulosa cell proliferation assay

BrdU (5′-bromo-2′-deoxyuridine) Cell Proliferation Assay Kit (Invitrogen, Carlsbad, CA, USA) was performed according to the manufacturer’s instructions to detect the variation of cell proliferation after cell transfection for csal1 or csal3 expression briefly after cell culture in a CO2-incubator at 37 °C overnight. Subsequently, the supernatant in each well was removed by pipetting and washed twice with PBS. The cells were fixed by adding 100 μl of 4% formaldehyde in PBS to each well for 15 min at room temperature. Then 0.5% Triton X-100 in PBS was added to each well for 20 min at room temperature for permeabilization, and the DNA was denatured with the denaturing agent for 30 min at 37 °C. Subsequently, the diluted anti-BrdU-peroxidase was added and kept at 37 °C for 1 h. The reaction was completed by adding a DAPI solution for 5 min. Subsequently, the redundant supernatant was washed four times with PBS. Fluorescence images were captured using a fluorescence microscopy system (Zeiss), and the pictures were merged using Axio Vision Rel. 4.8 software (Carl Zeiss Ltd., Oberkochen, Germany). The number of BrdU+ cells was expressed as a percentage and calculated relative to the total number of cells counted in the microscope fields observed in the negative control. Twenty fields were analyzed, and each condition was averaged. Each experiment was performed in triplicate and repeated three times. The method was according to that of our groups [12].

Statistical analysis

The statistical analyses were performed using the SPSS 17.0 software package (IBM, Armonk, NY, USA). All experiments were repeated at least three times using different batches of sampled hens. To quantify the mRNA expression using the qPCR analysis, four amplified products per hen from independent reactions were utilized. All groups of quantitative variables were checked for normal distribution by the Kolmogorov-Smirnov test. Since the conditions of normality of distribution and homogeneity of variance were satisfied, these data were analyzed with a one-way ANOVA followed by a Dunnett Multiple Comparison test. In the experiment with less than three groups, a Student t-test was performed for comparisons between the treatment and control groups after confirmation of normal distributions for nonparametric analysis. Statistical significance was declared at P < 0.01 or P < 0.05.

Results

Immunolocalization of csal1 and csal3 in the chicken ovarian follicles

In order to examine the biological roles of csal1 and csal3 factors in chicken follicle development, we initially localized csal1 and csal3 proteins in various-sized prehierarchichal ovarian follicles by immunofluorescence. As shown in Figure 1, the csal1 protein was found to be predominantly expressed in the GCs and oocytes of the PFs as well as in the ovarian stroma and epithelium, and the protein was mostly localized in the cytoplasm rather than in the nucleus. As shown in Figure 2, the expression and distributions of csal3 protein were very similar to the csal1. This result indicated that both csal1 and csal3 might be involved in the hen ovarian PF development in a translocation mechanism.

Figure 1.

Figure 1

Immunofluorescence localization of csal1 in the prehierarchichal follicles of the chicken ovary. Paraformaldehyde-fixed tissue sections were probed with anti-chicken csal1. The positive csal1 signal was detected as red staining. Intense immunofluorescence staining was detected in the GCs, oocytes, and in the ovarian stroma and epithelium in the various-sized prehierarchichal follicles (A, D, G, and J). Blue staining represents artificial coloring of the nuclei with DAPI staining (B, E, H, and K). Scale bars, 20 μm (A, B, C, G, H, and I); 5 μm (D, E, F, J, K, and L). (A)–(F) were from the PF of 1–3.9 mm in diameter and (G)–(L) were from the PF of 6–6.9 mm in diameter. Oocyte (OC), GC, theca cell (TC), somatic cells (SCs), and epithelium (EP) are indicated in the images.

Figure 2.

Figure 2

Immunofluorescence localization of csal3 in the prehierarchichal follicles of the chicken ovary. Paraformaldehyde-fixed tissue sections were probed with anti-chicken csal3. The positive csal3 signal was detected as red staining. Intense immunofluorescence staining was detected in the GCs, oocytes, and in the ovarian stroma and epithelium in the various-sized prehierarchichal follicles (A, D, G, and J). Blue staining represents artificial coloring of the nuclei with DAPI staining (B, E, H, and K). Scale bars, 20 μm (A, B, C, G, H, and I); 5 μm (D, E, F, J, K, and L). (A)–(F) were from the PF of 1–3.9 mm in diameter, (G)–(L) were from the PF of 5–5.9 mm in diameter. Oocyte (OC), GC, theca cell (TC), somatic cells (SC), and epithelium (EP) are indicated.

Expression of csal1 and csal3 genes in GCs of the PF

The RT-qPCR analysis showed that the csal1 and csal3 mRNAs were highly expressed in the GCs of all PFs sampled from 1–3.9 up to 7–8 mm in diameters. The highest expression of csal1 mRNA was observed in GCs of the ovarian follicles with 6–6.9 mm (1.865 ± 0.174) and the lowest in the ovarian follicles with 4–4.9 mm (0.516 ± 0.193). The highest expression of csal3 mRNA was determined in GCs of the ovarian follicles with 7–8 mm (2.470 ± 0.318) and the lowest in the ovarian follicles with 1–3.9 mm (1.098 ± 0.232) (Figure 3). Although the mRNA expression patterns of csal1gene appeared to be different from the csal3, the gradually increasing abundance of csal1 and csal3 mRNA in the follicles from 1–3.9 up to 7–8 mm in diameters was observed.

Figure 3.

Figure 3

Expression of csal1 and csal3 genes in GCs of the PF. The expression of csal1 (A) and csal3 (B) was analyzed using RT-qPCR, and values were normalized to the 18S rRNA. The bar graphs show the mean ± SD. Data labeled with different letters are significantly different from each other (P < 0.05).

csal1 plays an inhibitory role in granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR genes

To determine the roles of csal1 gene in ovarian follicular development, siRNA-mediated knockdown of csal1 gene was performed by transfection of csal1-specific siRNA into the GCs (Figure 4A and B). Our findings showed that the expression levels of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA abundance were significantly increased (P < 0.01) after the GCs were transfected with csal1-specific siRNA (Figure 4C). Moreover, as the expression of csal1 gene was knocked down, the expression of csal3 mRNA was also noticeably downregulated (Figure 4D). These results suggested that csal1 may mainly serve as a suppressor in the GC proliferation as well as in GC differentiation and steroidogenesis within chicken ovaries by synergistic action with the transcription factor csal3.

Figure 4.

Figure 4

Effects of silencing csal1 on the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA and granulosa cell proliferation. GCs from the PFs (6–8 mm in diameter) were transfected with specific siRNA targeting csal1 gene, scrambled siRNA (NC, negative control), and no siRNA (BC, blank control). (A) The expression of csal1 gene before and after the GCs transfected with specific siRNA was analyzed using RT-qPCR. (B) Expression levels of csal1 protein in the GCs before and after the specific siRNA interference (RNAi) were detected by western blotting. The β-actin was used as the loading control. (C) The influence of silencing csal1 on CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA abundances in the GCs was determined. (D) The influence of silencing csal1 on csal3 mRNA abundances in the GCs was examined. (E) Chicken GCs were transfected with csal1-specific siRNA, scrambled siRNA (NC, negative control), and absence of any siRNA (BC, blank control). The effects of csal1 knockdown on the GC proliferation were detected by BrdU assay. All cell nuclei show blue fluorescence indicative of DAPI staining; the BrdU-labeled cells showed red fluorescence indicating their newly synthesized DNA (×200). (F) Quantification of granulosa cell proliferation rate after cells transfected with the csal1 specific siRNA. Values are presented as mean ± SD. Asterisk indicates that the values are significantly different at **P < 0.01, 1, *P < 0.05.

Furthermore, to delineate the suppressive effect of csal1 gene on the GC proliferation, a BrdU cell proliferation assay was utilized to determine the cell proliferation rate. BrdU is a nucleoside analog of thymidine, which incorporates into newly synthesized DNA in proliferating cells during the synthesis of DNA [38]. As shown in Figure 4E and F, a significant enhancement of GCs proliferation was observed by knocking down of the csal1 gene (P < 0.01) compared to the negative control.

Conformity of the suppressive roles of csal1 on granulosa cell proliferation, differentiation, and steroidogenesis

To further confirm the exact role of csal1 gene in the follicle development as evaluated by csal1 knockdown, overexpression of csal1 gene was carried out by transfecting the reconstructed vector pYr-adshuttle-4-csal1 into the GCs. The expression of mRNA and protein were determined by RT-qPCR and western blot analysis, respectively. As shown in Figure 5A and B, the expression of csal1 mRNA and protein was remarkably elevated in the cells at 24 h of post-transfection with an expression vector (P < 0.01). Under the stimulation of the overexpressed csal1, expression of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA was significantly decreased (P < 0.01) (Figure 5C). Moreover, the cell proliferation rate of the GCs is dramatically decreased in the overexpressed csal1 group compared to the negative control (P < 0.01, Figure 5E and F). These results consolidated that csal1 plays an inhibitory role in GC proliferation, differentiation, and steroidogenesis during the PF growth and development in vitro. Unexpectedly, the expression level of csal3 mRNA was significantly upregulated simultaneously as csal1 was overexpressed (Figure 5D). It was inferred that transcription factor csal1 acts synergistically with a csal3 molecule in the follicle development.

Figure 5.

Figure 5

Repression of csal1 on granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR genes in GCs. The GCs were transfected with reconstructed pYr-adshuttle-4-csal1 plasmids (OE, overexpression group), pYr-adshuttle empty vector (NC, negative control), and no plasmid (BC, blank control). (A) The expression of csal1 gene before and after the GCs transfected with pYr-adshuttle-4-csal1 expression vector was examined by RT-qPCR. The values on the bar graphs are the mean ± SD. (B) Expression levels of csal1 protein in the GCs before and after the transfection with pYr-adshuttle-4-csal1 vector were detected by western blotting. The β-actin was used as the loading control. (C) The influence of csal1 overexpression on CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA abundances in the GCs was examined. (D) The influence of csal1 overexpression on csal3 mRNA abundances in the GCs was examined. (E) The effects of csal1 overexpression on the GC proliferation were detected by BrdU assay. All cell nuclei show blue fluorescence indicative of DAPI staining; the BrdU-labeled cells showed red fluorescence indicating their newly synthesized DNA (×200). (F) Quantification of granulosa cell proliferation rate after cells transfected with the pYr-adshuttle-4-csal1 plasmid. Asterisk indicates that the values are significantly different at **P < 0.01, *P < 0.05.

The similar effect of csal3 on granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR genes to csal1 in the GCs

To explore the functions of csal3 gene in ovarian follicular development, siRNA-mediated knockdown of csal3 gene was conducted by transfection of csal3-specific siRNA into the GCs from the PFs as shown in Figure 6A and B. Knockdown of csal3 in the GCs was performed to investigate how csal3 affects the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR. Interestingly, the expression levels of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA were remarkably enhanced (P < 0.01, Figure 6C). As the expression of csal3 was knocked down, the expression of csal1 mRNA was also significantly decreased (Figure 6D). Moreover, knockdown of csal3 significantly increased the GC proliferation (P < 0.01, Figure 6E and F). The current results are coincidently consistent with the data of knockdown csal1 in the GCs. Furthermore, silencing of csal3 in the GCs also significantly downregulated the expression of csal1.

Figure 6.

Figure 6

Effects of silencing csal3 on granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA. The GCs were transfected with specific siRNA targeting csal3 gene, scrambled siRNA (NC, negative control), and no siRNA (BC, blank control). (A) The expression of csal3 gene before and after the GCs transfected with specific siRNA was analyzed using RT-qPCR. The values on the bar graphs are the mean ± SD. (B) Expression levels of csal3 protein in the GCs before and after the specific siRNA interference (RNAi) were detected by western blotting. The β-actin was used as the loading control. (C) The influence of silencing csal3 on CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA abundances in the GCs was examined. (D) The influence of silencing csal3 on csal1 mRNA abundances in the GCs was examined. (E) The effects of csal3 knockdown on the GC proliferation were detected by BrdU assay. All cell nuclei show blue fluorescence indicative of DAPI staining; the BrdU-labeled cells showed red fluorescence indicating their newly synthesized DNA (×200). (F) Quantification of granulosa cell proliferation rate after cells transfected with the csal3-specific siRNA. Asterisk indicates that the values are significantly different at **P < 0.01, *P < 0.05.

Conformity of the suppressive roles of csal3 on granulosa cell proliferation, differentiation, and steroidogenesis to those of csal1

To further testify the suppressive role of transcription factor csal3 on granulosa cell proliferation, differentiation, and steroidogenesis, transfection of the recombined expression vector pYr-adshuttle-4-csal3 into the GCs was performed (Figure 7A and B). The expression levels of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA were remarkably decreased under the overexpression of csal3 (Figure 7C). This result is coincidently consistent with the data of overexpressed csal1 in the GCs. Furthermore, when overexpression of csal3 was conducted in the GCs, the expression level of csal1 was also significantly upregulated (Figure 7D). Moreover, the cell proliferation rate was remarkably reduced (P < 0.01) in the csal3 overexpressed group compared to the negative control (Figure 7E and F), which is concordant with that of csal1 overexpression. Taken together, these results provided strong evidence that csal3 plays an inhibitory role in GC proliferation in vitro through a synergistic action with the csal1.

Figure 7.

Figure 7

The inhibitory effect of csal3 on granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR. The GCs were transfected with reconstructed pYr-adshuttle-4-csal3 plasmids (OE, overexpression group), pYr-adshuttle-4 empty vector (NC, negative control), and no plasmid (BC, blank control). (A) The expression of csal3 gene before and after the GCs transfected with pYr-adshuttle-4-csal3 expression vector was examined by RT-qPCR. The values on the bar graphs are the mean ± SD. (B) Expression levels of csal3 protein in the GCs before and after the transfection with pYr-adshuttle-4-csal3 vector were detected by western blotting. The β-actin was used as the loading control. (C) The influence of csal3 overexpression on CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA abundances in the GCs was examined. (D) The influence of csal3 overexpression on csal1 mRNA abundances in the GCs was examined. (E) All cell nuclei show blue fluorescence indicative of DAPI staining; the BrdU-labeled cells showed red fluorescence indicating their newly synthesized DNA (original magnification ×200). (F) Quantification of granulosa cell proliferation rate after cells transfected with the pYr-adshuttle-4-csal3 plasmid. Asterisk indicates that the values are significantly different at **P < 0.01, *P < 0.05.

Synergistic effect of csal1 and casl3 on granulosa cell proliferation, differentiation, and steroidogenesis

To further substantiate the synergistic effect of csal1 and casl3 on granulosa cell proliferation, differentiation, and steroidogenesis, knockdown or overexpression of csal1 and csal3 in the cultured GCs was conducted. The cells transfected with csal1- and csal3-specific siRNAs had significantly increased expression of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA, and GC proliferation (Figure 8A–F). Conversely, after the stimulation by transfecting the reconstructed expression vectors of pYr-adshuttle-4-csal1 and pYr-adshuttle-4-csal3 into the GCs, the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA, and the proliferation level of GCs were more remarkably downregulated than the groups transfected only with the pYr-adshuttle-4-csal1 or pYr-adshuttle-4-csal3 vector (Figure 8G–L). Collectively, these results further corroborated that csal1 and csal3 play a synergistic inhibitory effects on GC proliferation, differentiation, and steroidogenesis in PF growth and development.

Figure 8.

Figure 8

Synergistic inhibition of csal1 and csal3 in granulosa cell proliferation and the expression of CCND1, Bcat, StAR, CYP11A1, and FSHR. The GCs were transfected with specific siRNA targeting csal1 or/and csal3 genes, scrambled siRNA (NC, negative control), and no siRNA (BC, blank control) (A–F). The GCs were transfected with reconstructed pYr-adshuttle-4-csal1 or/and pYr-adshuttle-4-csal3 plasmids, pYr-adshuttle-4 empty vector (NC, negative control), and no plasmid (BC, blank control) (G–L). Values are presented as mean ± SD. Data labeled with different letters are significantly different from each other (P < 0.01).

Discussion

In recent years, an increasing number of studies have investigated the factors that control follicular development and selection of undifferentiated PFs into the differentiated preovulatory follicle hierarchy [4, 9, 10, 13]. The biological roles of members of the SALL family in ovarian development have attracted much attention [17, 18, 30]. Previous studies have well-documented that members of the SALL family involve in many developmental processes, such as embryonic development, organogenesis, and tissue specification [16, 20, 39–41]. Moreover, the transcription factors SALL1 and SALL3 are involved in the human ovarian cancer suppression [17, 18, 42]. However, the exact roles of csal1 and csal3 in chicken ovarian follicular development remained unclear. In this study, we initially investigated the expression profiles of chicken csal1 and csal3 mRNA in the ovarian PFs (1–3.9 to 7–8 mm in diameters) by using qPCR analysis. Although mRNA expression patterns of csal1gene appeared to be different from the csal3, the gradually increasing high expression level of csal1 and csal3 mRNA in the follicles from 1–3.9 up to 7–8 mm in diameters indicated that csal1 and csal3 exert an indispensable role in the regulation of chicken PF growth and development. Furthermore, csal1 and csal3 proteins were predominantly localized in the cytoplasm of oocytes and GCs, ovarian stroma, and epithelium (Supplemental Figures 2 and 3), suggesting that csal1 and csal3 may be involved in both the oocyte growth and development and the granulosa cell proliferation through a translocation mechanism in PFs of the hen ovary as previously reported [25].

To provide direct evidence for substantiating csal1 and csal3 proteins in the regulation of the PF development, we utilized an in vitro system to investigate the effect of csal1 and csal3 on cell proliferation, differentiation, follicle selection, and steroidogenesis within GCs from the PF. It is well known that ovarian GCs are essential for follicular growth, development, and follicular atresia [43]. The controlled ovarian cell proliferation is critical for the normal function of the ovary. However, uncontrolled GC proliferation and decreased cell death and differentiation can lead to hyperplasia of the granulosa layer and the formation of granulosa cell tumors [44]. However, the occurrence and alteration of GC proliferation and differentiation are subjected to the control of many intrinsic and extrinsic factors, such as positive/negative feedbacks of hormone secretion and intrafollicular growth factor production [13, 45]. As aforementioned, csal1 and csal3 molecules were presumed to be involved in ovarian PF growth and development by regulating GC proliferation. To date, there is no direct evidence to confirm that csal1 and csal3 are involved in GC proliferation and ovarian development, but it was reported that human SALL1 synergistically activates canonical Wnt signaling and the N-terminal truncated SALL1 downregulates the synergistic transcriptional enhancement for Wnt signal by native SALL1 [29]. WNT/β-catenin signaling is involved in cell proliferation and differentiation [46, 47], ovarian development [48], and ovarian granulosa cell tumor development [49]. SALL1 expression in human and murine breast cancer cells inhibited cancer cell growth and proliferation, whereas knockdown of SALL1 in breast cancer cells promoted cancer cell growth and proliferation [42]. Moreover, SALL2 can suppress tumorigenesis through cell cycle inhibition and induction of apoptosis [50], and the latest study proved that SALL2 is a negative regulator of cell proliferation [19]. In the current study, we found that overexpression of csal1/csal3 gene in the GCs contributed to a significant decrease in cell proliferation (P < 0.01). Conversely, knockdown of csal1/csal3 by RNAi resulted in a remarkable increase in cell proliferation (P < 0.01). These data attested that csal1 and csal3 genes exert an inhibitory effect on the development of the PFs. To our knowledge, this is the first direct evidence showing the biological roles of the csal1 and csal3 factors in the GC proliferation during growth and development of the PF in the chicken ovary. However, the molecular mechanism that underlies the negative regulation of csal1 and csal3 genes in the GC proliferation is unknown.

It has been reported that GC proliferation is highly regulated by reproductive hormones and growth factors in an endocrine, paracrine, and autocrine manner [9, 45, 51]. Therefore, endocrinal hormones, local ovarian-follicular growth factors, and signaling pathways involved in the regulation of normal ovarian granulosa cell functions may also affect the ovarian folliculogenesis, growth, and development. CCND1 is one of the important cell cycle regulators associated with cell cycle arrest [5, 6, 52]. The decreased expression levels of CCND1 have been demonstrated to inhibit cell proliferation, whereas the enhanced levels of CCND1 promote cell proliferation and tumorigenesis; therefore, CCND1 was accepted as a key regulator of cell cycle and proliferation [6]. Inhibition on CCND1 is bound to induce cell cycle arrest and further contribute to the inhibited proliferation of the human granulosa-like tumor cells [53]. Owing to the promotion of CCND1 and β-catenin to cell proliferation [6, 8, 49, 53], they are known to be a critical enhancer or activator for follicular growth and development in the ovary. Furthermore, it has been reported that SALL1 and SALL3 were able to directly interplay with the CCND1 and β-catenin proteins, respectively [41]. In the present study, the abundance of CCND1 and Bcat mRNA was significantly decreased in the cultured GCs with overexpression of csal1/csal3 and significantly increased under the knockdown of csal1/csal3. It initially revealed that upregulated csal1 and csal3 resulted in the inhibition of CCND1 and Bcat mRNA expression in the cultured GCs and with a synchronous decrease of GC proliferation level in vitro. It indicated that transcription factor csal1 and csal3 might primarily play an inhibitory effect on the ovarian GC proliferation by downregulating CCND1 and Bcat expression. Furthermore, this hypothesis is also strongly supported by the decreased expression levels of csal1 and csal3 in the GCs once the PFs entering the hierarchy stage (Supplemental Figure 4), in which the downregulated csal1 and csal3 expressions facilitate GC to proliferate further and to relieve the inhibition of CCND1 and Bcat expression simultaneously.

It is well known that FSHR plays a decisive role in the avian follicular selection of GCs by enhancing FSH-responsiveness [3,54,55] and a relatively higher mRNA expression level of FSHR was evaluated in the GC layer from the 6–8 mm follicles for selection [15]. FSHR knockdown induces porcine GC apoptosis and follicular atresia [56]. An increased expression level of FSHR transcription in the GCs of PFs (6–8 mm in diameter) has been generally accepted as an indicator to initiate follicle selection [3, 4, 10]. Furthermore, at or immediately after follicle selection, the transition of GCs from an undifferentiated to a differentiated state was initiated, and increased expression of CYP11A and StAR plus progesterone production was accompanied [45, 57]. Therefore, the elevated expression of FSHR mRNA is also one of the earliest markers for differentiating GCs [45].

Granulosa cell proliferation and differentiation have been reported as a crucial cellular process during ovarian follicle growth and development after follicle selection [45]. StAR serves as a key molecule in steroidogenesis and a marker of granulosa cell differentiation [58]. StAR immunoreactivity is detected in GCs of large preovulatory follicles, but not in small and medium immature follicles [58, 59]. The steroidogenesis (predominantly progesterone production) was mediated by increased expression of mRNA encoding StAR and CYP11A [60]. CYP11A1 gene encodes the P450scc enzyme that is the first and rate-limiting enzyme in the steroidogenic pathway, converting cholesterol to pregnenolone [61]. In the current study, overexpression of csal1/csal3 in GCs significantly decreased the expression of FSHR, CYP11A1, and StAR mRNA, whereas knocking down csal1/csal3 enhanced their expression. These data suggested that csal1 and csal3 genes might exert a suppressing role in follicle selection, GC differentiation, and steroidogenesis in the ovarian PFs.

Interestingly, we also found that when csal1 was overexpressed, the abundance of csal3 mRNA was synchronously elevated. On the contrary, when csal1 was knocked down, the abundance of csal3 mRNA was simultaneously downregulated. It presented the synergistic transcriptional enhancement or reduction for csal1and csal3 genes between each other in GCs under the overexpression or RNA interference (RNAi) state. Moreover, either csal1or csal3 overexpression has significantly decreased the abundance of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA in the follicular GCs and the proliferation levels of GCs from the PFs. Moreover, simultaneously silencing csal1and csal3 leads to a much higher increase of the abundance of CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA expression and the GC proliferation level than that in knockdown of csal1 or csal3 exclusively. In contrast, overexpression of both csal1and csal3 contributes to a more significant decrease of the CCND1, Bcat, StAR, CYP11A1, and FSHR mRNA expression and the GC proliferation levels than that in overexpressing csal1 or csal3 singly. These data demonstrated the synergistic functional role between csal1 and csal3 genes on the granulosa cell proliferation, differentiation, and steroidogenesis during PF development in hen ovary. Further studies are necessary to elucidate the precise regulatory mechanisms, and whether csal1and csal3 have similar functions in the ovary of older hens.

Conclusions

In sum, our study for the first time demonstrates the suppressive role of the transcription factors csal1 and csal3 in GC proliferation and steroidogenesis by downregulating their downstream genes: CCND1, Bcat, StAR, CYP11A1, and FSHR and moreover, the molecular mechanisms underlying the synergistic inhibitory effects induced by the csal1 and csal3 on GC proliferation, differentiation, and steroidogenesis during PF development in the hen ovary. Our ongoing study will delineate the precise regulation of csal1 and csal3 genes in PF development.

Conflict of interest

The authors have declared that no conflict of interest exists.

Supplementary Material

Supplemental_Fig_1_ioz137
Supplemental_Fig_2_ioz137
Supplemental_Fig_3_ioz137
Supplemental_Fig_4_ioz137
Supplementary_Table_S1_ioz137

References

  • 1. Gilchrist RB, Ritter LJ, Myllymaa S, Kaivo-Oja N, Dragovic RA, Hickey TE, Ritvos O, Mottershead DG. Molecular basis of oocyte-paracrine signaling that promotes granulosa cell proliferation. J Cell Sci 2006; 119:3811–3821. [DOI] [PubMed] [Google Scholar]
  • 2. Woodruff TK, Shea LD. The role of the extracellular matrix in ovarian follicle development. Reprod Sci 2007; 14:6–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Qin N, Fan XC, Zhang YY, Xu XX, Tyasi TL, Jing Y, Mu F, Wei ML, Xu RF. New insights into implication of the SLIT/ROBO pathway in the prehierarchical follicle development of hen ovary. Poult Sci 2015; 94:2235–2246. [DOI] [PubMed] [Google Scholar]
  • 4. Xu RF, Qin N, Xu XX, Sun X, Chen XX, Zhao JH. Inhibitory efect of SLIT2 on granulosa cell proliferation mediated by the CDC42-PAKsERK1/2 MAPK pathway in the prehierarchical follicles of the chicken ovary. Sci Rep 2018; 8:9168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Alqudah MA, Agarwal S, Al-Keilani MS, Sibenaller ZA, Ryken TC, Assem M. NOTCH3 is a prognostic factor that promotes glioma cell proliferation, migration and invasion via activation of CCND1 and EGFR. PLoS One 2013; 8:e77299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Yang M, Cui G, Ding M, Yang W, Liu Y, Dai D, Chen L. miR-935 promotes gastric cancer cell proliferation by targeting SOX7. Biomed Pharmacother 2016; 79:153–158. [DOI] [PubMed] [Google Scholar]
  • 7. Nhieu JT, Renard CA, Wei Y, Cherqui D, Zafrani ES, Buendia MA. Nuclear accumulation of mutated beta-catenin in hepatocellular carcinoma is associated with increased cell proliferation. Am J Pathol 1999; 155:703–710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Gordon MD, Nusse R. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J Biol Chem 2006; 281:22429–22433. [DOI] [PubMed] [Google Scholar]
  • 9. Qin N, Fan XC, Xu XX, Tyasi TL, Li SJ, Zhang YY, Wei ML, Xu RF. Cooperative effects of FOXL2 with the members of TGF-β superfamily on FSH receptor mRNA expression and granulosa cell proliferation from hen prehierarchical follicles. PLoS One 2015; 10:e0141062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Xu RF, Qin N, Xu XX, Sun X, Chen XX, Zhao JH. Implication of SLIT3-ROBO1/ROBO2 in granulosa cell proliferation, differentiation and follicle selection in the prehierarchical follicles of hen ovary. Cell Biol Int 2018; 42:1643–1657. [DOI] [PubMed] [Google Scholar]
  • 11. Johnson AL, Solovieva EV, Bridgham JT. Relationship between steroidogenic acute regulatory protein expression and progesterone production in hen granulosa cells during follicle development. Biol Reprod 2002; 67:1313–1320. [DOI] [PubMed] [Google Scholar]
  • 12. Lyu ZC, Qin N, Tyasi TL, Zhu HY, Liu DH, Yuan SG, Xu RF. The hippo/MST pathway member SAV1 plays a suppressive role in development of the prehierarchical follicles in hen ovary. PLoS One 2016; 11:e0160896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Johnson AL. Ovarian follicle selection, and granulosa cell differentiation. Poult Sci 2015; 94:781–785. [DOI] [PubMed] [Google Scholar]
  • 14. Xie M, Li M, Zhou J, Ding X, Shao Y, Jing J, Liu Y, Yao B. Brain-derived neurotrophic factor promotes human granulosa-like tumor cell steroidogenesis and proliferation by activating the FSH receptor-mediated signaling pathway. Sci Rep 2017; 7:180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Woods DC, Johnson AL. Regulation of follicle-stimulating hormone-receptor messenger RNA in hen granulosa cells relative to follicle selection. Biol Reprod 2005; 72:643–650. [DOI] [PubMed] [Google Scholar]
  • 16. Farrell ER, Münsterberg AE. csal1 is controlled by a combination of FGF and Wnt signals in developing limb buds. Dev Biol 2000; 225:447–458. [DOI] [PubMed] [Google Scholar]
  • 17. Sung CK, Li DW, Andrews E, Drapkin R, Benjamin T. Promoter methylation of the SALL2 tumor suppressor gene in ovarian cancers. Mol Oncol 2013; 7:419–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Miao F, Zhang XS, Cao YN, Wang Y, Zhang XS. Effect of siRNA-silencing of SALL2 gene on growth, migration and invasion of human ovarian carcinoma A2780 cells. BMC Cancer 2017; 17:838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hermosilla VE, Salgado G, Riffo E, Escobar D, Hepp MI, Farkas C, Galindo M, Morín V, García-Robles MA, Castro AF, Pincheira R. SALL2 represses cyclins D1 and E1 expression and restrains G1/S cell cycle transition and cancer-related phenotypes. Mol Oncol 2018; 12:1026–1046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Lorente SJ, Truchado GM, Perry KJ, Henry JQ, Grande C. Molecular, phylogenetic and developmental analyses of SALL proteins in bilaterians. EvoDevo 2018; 9:9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Jürgens G. Head and tail development of the drosophila embryo involves Spalt, a novel homeotic gene. EMBO J 1988; 7:189–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Kühnlein RP, Frommer G, Friedrich M, Gonzalez-Gaitan M, Weber A, Wagner-Bernholz JF, Gehring WJ, Jäckle H, Schuh R. Spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the drosophila embryo. EMBO J 1994; 13:168–179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Razin SV, Borunova VV, Maksimenko OG, Kantidze OL. Cys2His2 zinc finger protein family: classification, functions, and major members. Biochemistry 2012; 77:217–226. [DOI] [PubMed] [Google Scholar]
  • 24. Sweetman D, Smith T, Farrell E, Munsterberg A. Expression of csal1 in pre limb-bud chick embryos. Int J Dev Biol 2005; 49:427–430. [DOI] [PubMed] [Google Scholar]
  • 25. Sweetman D, Smith T, Farrell ER, Chantry A, Munsterberg A. The conserved glutamine-rich region of chick csal1 and csal3 mediates protein interactions with other Spalt family members. Implications for Townes-brocks syndrome. J Biol Chem 2003; 278:6560–6566. [DOI] [PubMed] [Google Scholar]
  • 26. Kohlhase J, Hausmann S, Stojmenovic G, Dixkens C, Bink K, Schulz-Schaeffer W, Altmann M, Engel W. SALL3, a new member of the human spalt-like gene family, maps to 18q23. Genomics 1999; 62:216–222. [DOI] [PubMed] [Google Scholar]
  • 27. Farrell ER, Tosh G, Church E, Münsterberg AE. Cloning and expression of CSAL2, a new member of the spalt gene family in chick. Mech Dev 2001; 102:227–230. [DOI] [PubMed] [Google Scholar]
  • 28. Kiefer SM, McDill BW, Yang J, Rauchman M. Murine SALL1 represses transcription by recruiting a histone deacetylase complex. J Biol Chem 2002; 277:14869–14876. [DOI] [PubMed] [Google Scholar]
  • 29. Sato A, Kishida S, Tanaka T, Kikuchi A, Kodama T, Asashima M, Nishinakamura R. SALL1, a causative gene for Townes-Brocks syndrome, enhances the canonical Wnt signaling by localizing to heterochromatin. Biochem Biophys Res Commun 2004; 319:103–113. [DOI] [PubMed] [Google Scholar]
  • 30. Hermosilla VE, Hepp MI, Escobar D, Farkas C, Riffo EN, Castro AF, Pincheira R. Developmental SALL2 transcription factor: a new player in cancer. Carcinogenesis 2017; 38:680–690. [DOI] [PubMed] [Google Scholar]
  • 31. Gilbert AB, Perry MM, Waddington D, Hardie MA. Role of atresia in establishing the follicular hierarchy in the ovary of the domestic hen (Gallus domesticus). J Reprod Fertil 1983; 69(1):221–227. [DOI] [PubMed] [Google Scholar]
  • 32. Onagbesan O, Bruggeman V, Decuypere E. Intra-ovarian growth factors regulating ovarian function in avian species: a review. Anim Reprod Sci 2009; 111(2–4):121–140. [DOI] [PubMed] [Google Scholar]
  • 33. Knight PG, Al-Musawi SL, Lovell TM, Gladwell RT. Chapter 7: Control of follicular development: intra-ovarian actions of transforming growth factor-beta (TGF-B) superfamily members In: Biology of Breeding Poultry. Cambridge: CABI North American Office; 2009; 89–107. [Google Scholar]
  • 34. Tilly JL, Kowalski KI, Johnson AL. Stage of ovarian follicular development associated with the initiation of steroidogenic competence in avian granulosa cells. Biol Reprod 1991; 44(2):305–314. [DOI] [PubMed] [Google Scholar]
  • 35. Johnson AL, Bridgham JT, Witty JP, Tilly JL. Expression of bcl-2 and nr-13 in hen ovarian follicles during development. Biol Reprod 1997, 57(5):1096–1103. [DOI] [PubMed] [Google Scholar]
  • 36. Davis AJ, Brooks CF, Johnson PA. Estradiol regulation of follistatin and inhibin alpha- and beta(B)-subunit mRNA in avian granulosa cells. Gen Comp Endocrinol 2000; 119(3):308–316. [DOI] [PubMed] [Google Scholar]
  • 37. Gallerani G, Cocchi C, Bocchini M, Piccinini F, Fabbri F. Characterization of tumor cells using a medical wire for capturing circulating tumor cells: a 3D approach based on immunofluorescence and DNA FISH. J Vis Exp 2017; 130:56936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Taupin P. BrdU immunohistochemistry for studying adult neurogenesis: paradigms, pitfalls, limitations, and validation. Brain Res Rev 2007; 53:198–214. [DOI] [PubMed] [Google Scholar]
  • 39. Nishinakamura R, Matsumoto Y, Nakao K, Nakamura K, Sato A, Copeland NG, Gilbert DJ, Jenkins NA, Scully S, Lacey DL, Katsuki M, Asashima M et al. Murine homolog of SALL1 is essential for ureteric bud invasion in kidney development. Development 2001; 128:3105–3115. [DOI] [PubMed] [Google Scholar]
  • 40. Onai T, Sasai N, Matsui M, Sasai Y. Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling. Dev Cell 2004; 7:95–106. [DOI] [PubMed] [Google Scholar]
  • 41. de Celis JF, Barrio R. Regulation and function of Spalt proteins during animal development. Int J Dev Biol 2009; 53:1385–1398. [DOI] [PubMed] [Google Scholar]
  • 42. Ma C, Wang F, Han B, Zhong X, Si F, Ye J, Hsueh EC, Robbins L, Kiefer SM, Zhang Y, Hunborg P, Varvares MA et al. SALL1 functions as a tumor suppressor in breast cancer by regulating cancer cell senescence and metastasis through the NuRD complex. Mol Cancer 2018; 17:78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Wang N, Zhao F, Lin P, Zhang G, Tang K, Wang A, Jin Y. Knockdown of XBP1 by RNAi in mouse granulosa cells promotes apoptosis, inhibits cell cycle, and decreases estradiol synthesis. Int J Mol Sci 2017; 18:1152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Fu D, Lv X, Hua G, He C, Dong J, Lele SM, Li DW, Zhai Q, Davis JS, Wang C. YAP regulates cell proliferation, migration, and steroidogenesis in adult granulosa cell tumors. Endocr Relat Cancer 2014; 21:297–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Johnson AL, Woods DC. Dynamics of avian ovarian follicle development: cellular mechanisms of granulosa cell differentiation. Gen Comp Endocrinol 2009; 163:12–17. [DOI] [PubMed] [Google Scholar]
  • 46. Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127:469–480. [DOI] [PubMed] [Google Scholar]
  • 47. Kumar M, Camlin NJ, Holt JE, Teixeira JM, McLaughlin EA, Tanwar PS. Germ cell specific overactivation of WNT/β-catenin signalling has no effect on folliculogenesis but causes fertility defects due to abnormal foetal development. Sci Rep 2016; 6:27273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Tanwar PS, Zhang L, Kaneko-Tarui T, Curley MD, Taketo MM, Rani P, Roberts DJ, Teixeira JM. Mammalian target of rapamycin is a therapeutic target for murine ovarian endometrioid adenocarcinomas with dysregulated Wnt/β-catenin and PTEN. PLoS One 2011; 6:e20715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Boerboom D, Paquet M, Hsieh M, Liu J, Jamin SP, Behringer RR, Sirois J, Taketo MM, Richards JS. Misregulated Wnt/beta-catenin signaling leads to ovarian granulosa cell tumor development. Cancer Res 2005; 65:9206–9215. [DOI] [PubMed] [Google Scholar]
  • 50. Wu Z, Cheng K, Shi L, Li Z, Negi H, Gao G, Kamle S, Li D. Sal-like protein 2 upregulates p16 expression through a proximal promoter element. Cancer Sci 2015; 106:253–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Kranc W, Budna J, Kahan R, Chachuła A, Bryja A, Ciesiółka S, Borys S, Antosik MP, Bukowska D, Brussow KP, Bruska M, Nowicki M et al. Molecular basis of growth, proliferation, and differentiation of mammalian follicular granulosa cells. J Biol Regul Homeost Ag 2017; 31:1–8. [PubMed] [Google Scholar]
  • 52. Totty ML, Morrell BC, Spicer LJ. Fibroblast growth factor 9 (FGF9) regulation of cyclin D1 and cyclin-dependent kinase-4 in ovarian granulosa and theca cells of cattle. Mol Cell Endocrinol 2017; 440:25–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Xiang YG, Song YX, Li Y, Zhao DM, Ma L, Tan LY, Tan L. miR-483 is down-regulated in polycystic ovarian syndrome and inhibits KGN cell proliferation via targeting insulin-like growth factor 1 (IGF1). Med Sci Monit 2016; 22:3383–3393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Yamamura N, Takeishi M, Goto H, Tagami M, Mizutani T, Miyamoto K, Doi O, Kamiyoshi M. Expression of messenger RNA for gonadotropin receptor in the granulosa layer during the ovulatory cycle of hens. Comp Biochem Physiol A Mol Integr Physiol 2001; 129:327–337. [DOI] [PubMed] [Google Scholar]
  • 55. Hernandez AG, Bahr JM. Role of FSH and epidermal growth factor (EGF) in the initiation of steroidogenesis in granulosa cells associated with follicular selection in chicken ovaries. Reproduction 2003; 125:683–691. [PubMed] [Google Scholar]
  • 56. Du X, Zhang L, Li X, Pan Z, Liu H, Li Q. TGF-β signaling controls FSHR signaling-reduced ovarian granulosa cell apoptosis through the SMAD4/miR-143 axis. Cell Death Dis 2016; 7:e2476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Kim D, Ocón-Grove O, Johnson AL. Bone morphogenetic protein 4 supports the initial differentiation of hen (Gallus gallus) granulosa cells. Biol Reprod 2013; 88(6): 161. [DOI] [PubMed] [Google Scholar]
  • 58. Bentsi-Barnes IK, Kuo FT, Barlow GM, Pisarska MD. Human forkhead L2 represses key genes in granulosa cell differentiation including aromatase, P450scc, and cyclin D2. Fertil Steril 2010; 94:353–356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Pollack SE, Furth EE, Kallen CB, Arakane F, Kiriakidou M, Kozarsky KF, Strauss JF. Localization of the steroidogenic acute regulatory protein in human tissues. J Clin Endocrinol Metab 1997; 82:4243–4251. [DOI] [PubMed] [Google Scholar]
  • 60. Johnson AL, Lee J. Granulosa cell responsiveness to follicle stimulating hormone during early growth of hen ovarian follicles. Poult Sci 2016; 95:108–114. [DOI] [PubMed] [Google Scholar]
  • 61. Wang MQ, Ramirez J, Han JY, Jia Y, Domenico J, Seibold MA, Hagman JR, Gelfand EW. The steroidogenic enzyme Cyp11a1 is essential for development of peanut-induced intestinal anaphylaxis. J Allergy Clin Immunol 2013; 132:1174–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental_Fig_1_ioz137
Supplemental_Fig_2_ioz137
Supplemental_Fig_3_ioz137
Supplemental_Fig_4_ioz137
Supplementary_Table_S1_ioz137

Articles from Biology of Reproduction are provided here courtesy of Oxford University Press

RESOURCES