Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2019 Nov 22;57(12):e01030-19. doi: 10.1128/JCM.01030-19

Implication of Broadly Neutralizing Bovine Monoclonal Antibodies in the Development of an Enzyme-Linked Immunosorbent Assay for Detecting Neutralizing Antibodies against Foot-and-Mouth Disease Virus Serotype O

Yimei Cao a,#, Kun Li a,#, Sheng Wang a, Yuanfang Fu a, Pu Sun a, Pinghua Li a, Xingwen Bai a, Jing Zhang a, Xueqing Ma a, Xiangchuan Xing a,b, Shasha Zhou a, Huifang Bao a, Dong Li a, Yingli Chen a, Zhiyong Li a, Zengjun Lu a,, Zaixin Liu a,
Editor: Brad Fenwickc
PMCID: PMC6879294  PMID: 31578261

Vaccination with inactivated vaccines is still the main measure to control foot-and-mouth disease (FMD) in areas where the disease is endemic, and the level of neutralizing antibody in vaccinated animals is directly related to their protection against virus challenge. Currently, neutralizing antibody is mainly detected using the virus neutralization test (VNT) based on cell culture, which is laborious and time-consuming and requires restrictive biocontainment facilities.

Keywords: foot-and-mouth disease virus, broadly neutralizing bovine monoclonal antibody, blocking ELISA, neutralizing antibody, serotype O

ABSTRACT

Vaccination with inactivated vaccines is still the main measure to control foot-and-mouth disease (FMD) in areas where the disease is endemic, and the level of neutralizing antibody in vaccinated animals is directly related to their protection against virus challenge. Currently, neutralizing antibody is mainly detected using the virus neutralization test (VNT) based on cell culture, which is laborious and time-consuming and requires restrictive biocontainment facilities. In this study, two broadly neutralizing antibodies (bnAbs), E46 and F128, were successfully produced using techniques for the isolation of single B cells from peripheral blood mononuclear cells (PBMCs) from bovines sequentially immunized with three topotypes of foot-and-mouth disease virus (FMDV) serotype O. Based on these bnAbs, a blocking enzyme-linked immunosorbent assay (ELISA) for detecting neutralizing antibodies (NA-ELISA) against FMDV serotype O was developed. The specificity and sensitivity of the test were estimated to be 99.21% and 100%, respectively. A significant correlation (P < 0.01) was observed between the NA-ELISA titers and the VNT titers for all sera from vaccinated animals and for all tested strains, suggesting that the NA-ELISA could detect neutralizing antibodies against FMDV serotype O strains of wide antigenic and molecular diversity and could be used for the evaluation of protective immunity.

INTRODUCTION

Foot-and-mouth disease (FMD) is a highly contagious and devastating disease of cloven-hoofed animals (1), and it causes considerable economic losses due to the reduced productivity, recovery efforts, and trade restrictions on affected countries (24). The causative agent, FMD virus (FMDV), belongs to the genus Aphthovirus within the Picornaviridae family (5). There are seven immunologically distinct serotypes of FMDV (serotypes O, A, C, Asia 1, SAT1, SAT2, and SAT3), with each serotype containing multiple and constantly evolving subtype strains (6). FMDV serotype O is widely prevalent in the world, and the Food and Agriculture Organization of the United Nations (FAO) World Reference Laboratory for FMD divided FMDV serotype O into 10 topotypes according to the differences in the nucleotide sequence of the VP1 gene and the epidemic region. The Southeast Asia (SEA) topotype, the Cathay topotype, and the Middle East-South Asia (ME-SA) topotype, the last of which contains the PanAsia lineage and the IND2001 lineage, are currently prevalent in China. The lack of cross-protection between serotypes and between some strains within a serotype greatly complicates FMD diagnosis and efforts to control it by vaccination (7).

Prophylactic and/or emergency vaccination with inactivated vaccines is the main measure used to control FMD in areas where it is endemic. Measurement of the potency of the vaccines is critical for controlling and eradicating FMDV. The gold standard test for FMD vaccine potency is in vivo challenge carried out in the primo-vaccinated target species. However, the live viral challenge tests have some disadvantages from the perspective of animal welfare, biosafety, and economics. Office International des Epizooties (OIE) experts have recommended the use of indirect tests, such as measurement of virus-neutralizing antibodies in cell culture and liquid-phase-blocking (LPB) enzyme-linked immunosorbent assay (ELISA) antibodies, to assess vaccine potency. Many researchers have shown that there is a good correlation between the neutralizing antibody titers of primo-vaccinated animals and their protection against virus challenge (810). The virus neutralization test (VNT) is more relevant to in vivo protection than other measures and is prescribed as a standard method for the detection of antibodies to FMDV structural proteins (11), although VNT is cumbersome and requires a biocontainment facility to handle live virus. The LPB-ELISA, on the other hand, has advantages over VNT because it is quicker and no live virus is required. However, the current LPB-ELISA based on polyclonal antisera has a low specificity. The percentage of animals giving false-positive results varies with the animal population studied. In particular, the occurrence of false-positive reactors was 4% in normal, unvaccinated cattle and as high as 18% in stressed cattle (12). Other research also showed that in some populations up to 10% of animals could be LPB-ELISA positive but VNT negative (13).

In this study, we developed a blocking ELISA for detecting neutralizing antibodies (NA-ELISA) against foot-and-mouth disease virus serotype O. The NA-ELISA used bovine monoclonal antibody (MAb) F128 of FMDV serotype O as the capture antibody and the other biotinylated bovine MAb, MAb E46, as the tracing antibody. Both F128 and E46 are bovine broadly neutralizing antibodies (bnAbs) against FMDV serotype O and are capable of neutralizing four representative viral strains within the Cathay, ME-SA (including both lineages), and SEA topotypes. The use of broadly neutralizing MAbs is expected to improve the specificity and accuracy of the ELISA compared to the use of polyclonal antisera. The relative sensitivity was determined by testing sera from animals infected with virulent FMDV. Specificity was determined by testing sera from unvaccinated naive animals.

MATERIALS AND METHODS

Ethics statement.

All animal experiments were performed following the management guidelines of the Gansu Ethical Review Committee (license no. SYXK-GAN-2014-003). All animals used in the present study were humanely bled and then euthanized at the end of the experiment.

Serum samples.

(i) Serum samples from naive animals. A total of 126 samples were collected on day 0 from bovines previously used in FMD vaccine potency studies (serum sample set I). These bovines were purchased from unvaccinated FMD-free herds. All serum samples were tested and found to be negative for antibodies against FMDV serotype O, A, and Asia 1 structural proteins by LPB-ELISA (titer, <0.6 [log10]) (14) and against FMDV nonstructural protein 3ABC by a 3ABC-specific ELISA (15).

(ii) Serum samples from infected animals. A total of 97 serum samples were collected from virulent FMDV O/Mya/98-infected animals, which included 81 swine and 16 bovines, at 10 to 14 days postinfection (dpi) (serum sample set II). The infected animals were from unvaccinated challenge controls in the FMD vaccine potency studies, and all developed clinical symptoms of FMD.

(iii) Serum samples from vaccinated animals. A total of 100 serum samples from vaccinated animals were used in this study (serum sample set III). The experimental groups were divided as follows. (i) Eight-five serum samples were collected from bovines that had been inoculated with a commercially available high-potency inactivated FMDV (FMDV O/Mya/98) vaccine at 28 days postvaccination (dpv) (serum sample set III-i). (ii) Fifteen serum samples were collected from three groups of five swine each inoculated with a lab-made inactivated FMDV O/Mya/98 (SEA topotype), O/HN/CHA/93 (Cathay topotype), and O/XJ/CHA/2017 (the IND2001 lineage of the ME-SA topotype) vaccine, respectively, at 28 dpv (serum sample set III-ii). All vaccines were formulated in Montanide ISA 201 VG adjuvant (Seppic, Paris, France).

(iv) Serum samples from other virus-infected animals. Five serum samples from porcine reproductive and respiratory syndrome virus (PRRSV)-infected swine, 3 serum samples from peste des petits ruminants virus (PPRV)-infected ovines, and 3 serum samples from bovine viral diarrhea virus (BVDV)-infected bovine were included in this study (serum sample set IV).

(v) Serum samples from animals infected with other serotypes of FMDV.Twenty serum samples from FMDV serotype A-infected swine and 29 serum samples from FMDV Asia 1-infected animals were also included (serum sample set V). The infected animals were from unvaccinated challenge controls in the FMD vaccine potency studies, and all developed clinical symptoms of FMD. All serum samples were obtained from the Key Laboratory of the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

Bovine vaccination and single-B-cell sorting by FACS.

Two 1-year-old healthy Qinchuan cattle (Bos taurus bovine no. 2334 and no. 0005) were first infected subcutaneously at two sites on the tongue with 10,000 50% bovine infective doses (BID50) of FMDV O/Mya/98. Then, booster vaccinations of inactivated FMDV O/HN/CHA/93 and FMDV O/Tibet/99 (the PanAsia lineage of the ME-SA topotype) vaccines were given on days 35 and 132, respectively. All vaccines were formulated in Montanide ISA 201 VG adjuvant (Seppic, Paris, France) and were given intramuscularly in the left neck of each animal. Heparinized peripheral blood was taken at various time points for isolating peripheral blood mononuclear cells (PBMCs) after the third vaccination.

PBMCs were isolated using Histopaque 1.083 (Sigma-Aldrich, USA) according to the manufacturer’s instructions. Freshly isolated PBMCs were first stained with biotinylated FMDV O/Mya/98 146S, anti-bovine CD21-phycoerythrin (PE) (Bio-Rad, USA), and anti-bovine IgM-fluorescein isothiocyanate (FITC) (Bio-Rad, USA) (labeling with FITC was done in-house) for 30 min at 4°C in phosphate-buffered saline (PBS) containing 2 mM EDTA and 0.5% bovine serum albumin (BSA), and parallel staining of PBMC samples lacking biotin-FMDV 146S was used as a fluorescence-minus-one (FMO) control. Then, the second-step antibody, mouse antibiotin-allophycocyanin (APC) (Miltenyi Biotec, Germany), was added, and the mixture was incubated for a further 20 min at 4°C. Single cells (FMDV 146S-APC positive, IgM-FITC negative, CD21-PE positive or negative) were sorted by flow cytometry (BD Aria II fluorescence-activated cell sorter [FACS]; BD USA) into full-skirt 96-well plates (Brand, Germany) containing lysis buffer on a BD fusion sorter and were immediately transcribed into cDNA using a SuperScript Vilo kit (Thermo Fisher Scientific, USA). The obtained cDNA templates were stored at −20°C for subsequent PCR amplification.

Cloning, expression, and purification of recombinant antibody F128 and E46.

Antibody variable-region VH (heavy chain) and VL (light chain) genes were amplified independently by a nested PCR method using primers for bovine IgG (Table 1). The final PCR products were sequenced. MAb F128 was amplified from B cells sorted from PBMCs from bovine no. 2334 at 242 days post-primary vaccination, and MAb E46 was amplified from B cells sorted from PBMCs from bovine no. 0005 at 223 days post-primary vaccination. The paired VH and VL genes were synthesized by GenScript, Inc., with codon optimization (for Cricetulus griseus) and then cloned into in-house vectors CH-pcDNA3.4 and CL-pcDNA3.4, respectively, which contain bovine IgG2 CH and CL, both with a tandem Myc and His tag at the C terminus. The expressing plasmids of VH and VL genes were then cotransfected into ExpiCHO-S cells using an ExpiFectamine CHO transfection kit (Invitrogen, USA). The antibodies were purified from the supernatant using a HisTrap Excel column (GE Life Sciences, USA). The purified bovine IgG MAbs were analyzed by reduced 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

TABLE 1.

Primers used for nested PCR amplification of the VH and VL genes of bovine IgG

Primer Sequencea
IgG VH outer-F CCCTCCTCTTTGTGCTSTCAGCCC
IgG VH outer-R GTCACCATGCTGCTGAGAGA
IgG VH inner-F AGAGGRGTYBTGTCCCAGG
IgG VH inter-R CTTTCGGGGCTGTGGTGGAGGC
IgG VL outer-F CACCATGGCCTGGTCCCCTCTG
IgG VL outer-R AAGTCGCTGATGAGACACACC
IgG VL inner-F TGGGCCCAGGCTGTRCTG
IgG VL inner-R GCGGGAACAGGGTGACCGAG
a

Degenerate bases were synthesized in these sequences, including S = C or G, Y = C or T, and R = A or G.

ELISA additivity test.

In order to test whether MAbs F128 and E46 recognize different antigenic sites, an ELISA additivity test was carried out as described by Friguet et al. (16). The coating was performed with 100 μl per well of FMDV O/Mya/98 146S antigen. The additivity index (AI) for a pair of MAbs was defined as follows: AI = {[2A1 + 2/(A1 + A2)] − 1} × 100, where A1, A2, and A1 + 2 are the optical density (OD) values reached in the ELISA with the first MAb alone, the second MAb alone, and the two MAbs together, respectively. If the two antibodies bound randomly at the same site, A1 + 2 should be equal to the mean value of A1 and A2 and AI would be equal to 0%. On the contrary, if the two antibodies bound independently at different sites, A1 + 2 should be the sum of A1 and A2 and AI would be equal to 100%. The AI at 50% was used as a cutoff value, and an AI of ≥50% indicated that the two antibodies recognized different antigenic sites.

Microneutralization assay.

The breadth of neutralizing activity of MAbs F128 and E46 against FMDV was determined using a VNT on monolayers of BHK-21 cells with representative FMDV strains O/Mya/98, O/HN/CHA/93, O/Tibet/99, and O/XJ/CHA/2017 (17). Briefly, 100 50% tissue culture infective doses (TCID50) of virus was added to 2-fold dilutions of antibody in a 96-well plate; after 1 h of incubation at 37°C, 5 × 104 cells/well were added to the plate for use as an indicator of residual infectivity. The microplates were incubated at 37°C for 3 days prior to fixing and staining. The neutralization titer (50% inhibitory concentration [IC50]) was expressed as the final antibody concentration that neutralized 100 TCID50 FMDV in 50% of the wells. An IC50 value of 50 μg/ml was used as a cutoff for neutralization, and an IC50 value of more than 50 μg/ml was considered nonneutralization activity.

Neutralizing antibodies in serum were also tested using a VNT on BHK-21 cells, and the endpoint titers were calculated as the reciprocal of the last serum dilution to neutralize 100 TCID50 of FMDV in 50% of the wells. Titers of ≥1.65 and ≤0.9 were considered positive and negative, respectively (18).

Biotinylation of MAb.

Highly purified MAb E46 was biotinylated with the EZ-Link Sulfo-NHS-LC-biotin reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions, and the resulting biotinylated MAb E46 was named Bio-E46.

Development of NA-ELISA.

Before the application of the NA-ELISA to detect neutralizing antibodies in sera, the optimum concentrations of the capture antibody (F128), the 146S antigen, the detector antibody (Bio-E46), and horseradish peroxidase (HRP)-streptavidin were determined by checkerboard titration, and the incubation time and blocking buffer were optimized on the basis of the ratio between the readings for negative (N) and positive (P) sera. The NA-ELISA’s optimal conditions were set as follows: 1 μg/ml of F128 in a 100-μl volume (carbonate-bicarbonate buffer) and coating at 4°C overnight; blocking with blocking buffer (5% sucrose and 1% BSA in PBS) at 37°C for 45 min; use of a serum-blocking reaction at 4°C overnight with 1 μg/ml of 146S antigen, 2 μg/ml of Bio-E46 in a 100-μl volume at 37°C for 1 h, and 100 μl of 1:30,000-diluted HRP-streptavidin at 37°C for 15 min; and visualization with tetramethylbenzidine (TMB) substrate at 37°C for 10 min to 15 min.

The NA-ELISA was performed as described previously (19, 20), with modifications. Briefly, serum samples were tested in 96-well plates in 2-fold dilutions. Eight sample dilutions (from 1:4 to 1:512) were incubated overnight at 4°C with a pretitrated dose (1 μg/ml) of FMDV serotype O 146S antigen in a saline buffer liquid phase (final dilution, 1:8 to 1:1,024). Subsequently, 100 μl of the serum-antigen mixtures was transferred to an ELISA plate that had been coated with 1 μg/ml of F128 in a 100-μl volume and preblocked with blocking buffer (5% sucrose and 1% BSA in PBS), and then the plate was incubated at 37°C for 1 h, when the 146S antigen that did not react with the test serum in the previous step was trapped. After five washes with PBS containing 0.05% Tween (vol/vol) (PBST), 2 μg/ml of Bio-E46 in a 100-μl volume was added to each well, and then the plate was incubated at 37°C for 1 h. After five washes, 100 μl of 1:30,000-diluted HRP-conjugated streptavidin was added, and the plates were incubated at 37°C for 15 min. After five washes with PBST, 100 μl of the enzyme substrate TMB was added to each well, and then the plate was incubated at 37°C for 10 min to 15 min. The reaction was terminated with 2 M H2SO4, and the optical density (OD) was measured using an automatic microplate reader (BioTek) at a wavelength of 450 nm. Two positive-control serum samples with known titers (reference serum samples with high and low titers) were assayed simultaneously as internal standards in each ELISA plate in 2-fold dilutions ranging from 1:4 to 1:512. One negative-control serum sample (from an unvaccinated naive animal) was tested in four 2-fold dilutions ranging from 1:4 to 1:32. Four wells were used for antigen control (100% reactivity), and two wells were used as reaction blanks without the 146S antigen and without serum. Antibody titers were expressed as the reciprocal (log10) of the serum dilutions giving 50% of the absorbance recorded in the antigen-control wells (OD50).

For the assay to be valid, the mean OD value of the antigen control needed to be 1.5 ± 0.3, the titer (log10) of the strongly positive serum control needed to be 2.7 ± 0.3, and the titer (log10) of the weakly positive serum control needed to be 1.8 ± 0.3. The titer (log10) of negative serum control needed to be less than 0.9.

Statistical analysis.

Pearson’s coefficient test was used to determine the correlation between the NA-ELISA titers and the VNT titers, and a P value of <0.05 was considered statistically significant.

Receiver operating characteristic (ROC) curve analysis (21) was used to estimate the cutoff value, sensitivity, and specificity of the assay by using 126 serum samples from naive bovines (serum sample set I) and 97 serum samples from experimentally infected animals (serum sample set II).

Statistical analysis, including Pearson’s coefficient test and ROC curve analysis, was performed using GraphPad Prism (version 6.0) software (San Diego, CA, USA).

Data availability.

The sequences of monoclonal antibodies F128 and E46 are available from the corresponding authors upon reasonable request.

RESULTS

Production of recombinant MAbs F128 and E46.

Pairs of VH and VL genes were successfully amplified from sorted single B cells by nested PCR and confirmed by sequencing. The VH and VL genes of MAb F128 were 387 bp and 336 bp, respectively, and the VH and VL genes of MAb E46 were 504 bp and 339 bp, respectively. The complete bovine IgG MAbs were successfully expressed in CHO-S cells, and purified MAbs were analyzed by reduced SDS-PAGE. The results showed that the heavy and light chains of MAb F128 were approximately 52 kDa and 25 kDa, respectively, and that the heavy and light chains of MAb E46 were approximately 56 kDa and 25 kDa, respectively.

Epitope specificity analysis of monoclonal antibodies.

The epitope specificity of the two MAbs was analyzed by an ELISA additivity test. This assay requires that the antigen be saturated with each MAb tested. First, we determined the minimum concentration of each antibody (4 μg/ml for both F128 and E46) at which saturation of quantitative antigen (1 μg/ml) was reached and used the concentrations to perform ELISA with a single antibody and with the pair of antibodies. ELISA was performed two times with duplicates in each plate, and the additivity index was calculated from the mean of four values. The mean OD value was determined to be 1.779 (A1) for F128, 0.332 (A2) for E46, and 2.094 (A1 + 2) for the mixture of F128 and E46. Thus, the AI for F128 and E46 was 98.3%. This result shows that the binding of the two MAbs was additive, suggesting that F128 and E46 recognize different epitopes.

Both F128 and E46 exhibit broadly neutralizing activity against FMDV.

The neutralization breadth of F128 and E46 was evaluated using four FMDV serotype O strains of three topotypes. E46 was found to efficiently neutralize all the tested FMDV strains, with the IC50s ranging from 5.73 to 24.44 μg/ml (Table 2). Similarly, F128 exhibited relatively high neutralizing activity against all four FMDV strains, with the IC50s ranging from 2.78 to 5.56 μg/ml. Taken together, these data demonstrate that both F128 and E46 are broadly neutralizing antibodies against FMDV serotype O.

TABLE 2.

Neutralization activities against representative FMDV serotype O strains

FMDV strain IC50a (μg/ml)
E46 F128
O/Mya/98 5.73 5.56
O/HN/CHA/93 5.73 2.78
O/Tibet/99 11.46 5.56
O/XJ/CHA/2017 24.44 2.78
a

The IC50 was determined to be the lowest antibody concentration that inhibited 50% cell death.

Determination of the cutoff, sensitivity, and specificity of the NA-ELISA.

A total of 223 serum samples with known status (126 serum samples from naive animals and 97 serum samples from infected animals) were examined using the NA-ELISA to determine the cutoff value, sensitivity, and specificity of the assay. The antibody titers of individual animals are shown in Fig. 1A. According to ROC curve analysis, the sensitivity and specificity values were optimal when the cutoff value for the NA-ELISA was 1.35, and the sensitivity and specificity were 100% and 99.21%, respectively (Fig. 1B). The area under the ROC curve (AUC) of the NA-ELISA was 0.9993 (standard error [SE] = 0.0009), with the 95% confidence interval being 0.9976 to 1.0010. Thus, samples with titers of <1.35 were considered negative, and those with titers of ≥1.35 were considered positive.

FIG 1.

FIG 1

ROC analysis for estimation of the cutoff value, sensitivity, and specificity of the NA-ELISA. (A) Dispersion of individual titers for naive sera and infected sera. Antibody titers below the sensitivity of the assay (0.9) were considered to have a titer of 0. (B) Values of the sensitivity and the specificity of the NA-ELISA determined at various cutoff values. The dashed line represents the selected cutoff value.

The specificity was also confirmed by performing the assay using 11 serum samples from PRRSV-infected swine (n = 5), PPRV-infected ovine (n = 3), and BVDV-infected bovine (n = 3) (serum sample set IV), and all serum samples were negative for neutralizing antibodies to FMDV serotype O by NA-ELISA.

The cross-reactivity with other serotypes of FMDV was evaluated using 20 serum samples positive for serotype A and 29 serum samples positive for serotype Asia 1 (serum sample set Ⅴ). The antibody titers of all 20 serotype A-positive serum samples were below 0.9 when examined by NA-ELISA, indicating that there was no cross-reaction with sera positive for serotype A. Of the 29 serum samples positive for serotype Asia 1, the antibody titers in 27 serum samples were lower than 0.9, the titer for 1 serum sample was 0.9, and the titer for 1 serum sample was 1.2. All of these values are below the cutoff value, indicating that there was also no cross-reaction with sera positive for serotype Asia 1. The results overall showed that the NA-ELISA developed in this study is specific for serotype O.

Correlation between antibody titers detected by NA-ELISA and VNT.

Endpoint titers were determined by NA-ELISA and VNT for 85 serum samples from bovines vaccinated with a commercially available inactivated FMDV serotype O vaccine (serum sample set III-i). The antibody titers of individual animals are summarized in Fig. 2A. Only 1 serum sample was negative and the other 84 serum samples were positive by NA-ELISA. All 85 serum samples were positive by VNT. The rate of coincidence of the results of the NA-ELISA and VNT was thus 98.8% (84/85). The Pearson correlation coefficient between the results of NA-ELISA and those of VNT was calculated by comparing the data at the individual level. The results of the NA-ELISA showed a statistically significant correlation with those of VNT (r = 0.6414, P < 0.0001) (Fig. 2B).

FIG 2.

FIG 2

Correlation of the titers obtained using the NA-ELISA and VNT. (A) Dispersion of individual titers determined by VNT (filled circles) and NA-ELISA (filled squares). (B) Correlation between the VNT titers and the NA-ELISA titers. Pearson’s correlation coefficient was computed using GraphPad Prism (version 6.0) software (San Diego, CA, USA). n, number of serum samples tested; r, correlation coefficient. The P value is two-tailed. The dotted lines represent the cutoff values.

The breadth of neutralizing antibodies can be tested by NA-ELISA.

To determine whether the NA-ELISA could effectively detect neutralizing antibodies of various FMDV serotype O strains, sera from 15 pigs inoculated with lab-made inactivated FMDV serotype O vaccines (serum sample set III-i) were detected by NA-ELISA and by VNT for the FMDV O/Mya/98, FMDV O/HN/CHA/93, and FMDV O/XJ/CHA/2017 strains. The animal grouping and test results are summarized in Table 3. For the three representative strains, the titers of homologous antibodies were found to be higher than those of heterologous antibodies by both methods, and a statistically significant correlation between the NA-ELISA titers and the VNT titers was observed for all strains tested. These results indicate that the NA-ELISA can detect neutralizing antibodies against FMDV strains of three topotypes with a wide antigenic and molecular diversity and that the results of the NA-ELISA show a good correlation with those of VNT.

TABLE 3.

Comparison of cross-neutralizing antibodies detected by NA-ELISA and VNT

FMDV strain Animal no. Antibody titer (log10)a
O/Mya/98
O/HN/CHA/93
O/XJ/CHA/2017
NA-ELISAb VNTc NA-ELISA VNT NA-ELISA VNT
O/Mya/98 (vaccine) 1 1.5 1.7 1.2 1.2 1.2 0.9
2 1.2 1.2 1.5 1.2 1.2 0.6
3 1.5 1.7 1.2 <0.6 1.2 0.6
4 1.5 1.7 1.2 0.9 1.2 0.6
5 1.5 1.7 1.2 0.9 1.2 0.6
O/HN/CHA/93 (vaccine) 1 2.1 2.1 2.1 2.4 1.8 1.5
2 1.5 1.8 1.8 2.1 1.5 0.9
3 1.2 1.2 1.8 1.8 1.8 0.8
4 0.9 0.8 <0.9 0.6 <0.9 0.6
5 1.5 1.5 1.8 1.8 1.5 1.2
O/XJ/CHA/2017 (vaccine) 1 1.8 1.5 1.8 1.7 1.8 2.1
2 2.1 1.8 2.1 2.1 2.4 2.4
3 1.8 1.2 1.5 1.7 2.1 2.1
4 1.8 1.5 1.8 1.7 2.1 2.1
5 2.1 1.8 1.8 1.7 2.1 1.8
a

Bold numbers indicate the values for homologous antibodies detected by VNT or NA-ELISA. Pearson’s correlation coefficient (r) between NA-ELISA titers and VNT titers was computed using GraphPad Prism (version 6.0) software (San Diego, CA, USA), and the r values for O/Mya/98, O/HN/CHA/93, and O/XJ/CHA/2017 were 0.7139, 0.8939, and 0.8760, respectively. A P value of <0.05 was considered statistically significant. P values (two-tailed) between NA-ELISA titers and VNT titers were 0.0028, <0.0001, and <0.0001 for O/Mya/98, O/HN/CHA/93, and O/XJ/CHA/2017, respectively.

b

Serum with a titer of ≥1.35 and a titer of <1.35 was considered positive and negative, respectively.

c

Serum with a titer of ≥1.65 and a titer of ≤0.9 was considered positive and negative, respectively.

DISCUSSION

Both VNT and LPB-ELISA are methods recommended by OIE for evaluating vaccine efficacy in vitro. VNT is highly reliable and precise for the evaluation of vaccine potency, but it is time-consuming and requires live virus. The LPB-ELISA can be used outside high-security laboratories with inactivated antigens, and the assay is simple, easy to scale up, and suitable for detecting antibodies of different species. However, the current LPB-ELISA method, based on rabbit and guinea pig polyclonal antisera (14, 19), has a low specificity (12, 13) and is difficult to standardize. The NA-ELISA developed here has the advantages of both VNT and the conventional polyclonal antibody-based LPB-ELISA.

In this study, two MAbs, MAbs F128 and E46, were successfully produced using a combination of FACS and techniques for the isolation of single B cells from PBMCs from bovines sequentially immunized with three topotypes of FMDV serotype O vaccines. MAbs are traditionally prepared from hybridomas. However, the long-term use of MAbs may also be problematic, as hybridomas suffer from stability issues. The production of recombinant MAbs from single B cells overcomes the problem of instability. In addition, these recombinant MAbs can be produced in large amounts to provide sufficient materials for various applications. The ELISA additivity test showed that the binding of the two MAbs was additive, suggesting that these antibodies bound to distinct epitopes, so they can be used simultaneously in the NA-ELISA as the capture antibody and the detecting antibody. To further characterize the functional activity of F128 and E46, a virus neutralization assay was performed using a diverse group of FMDV serotype O strains isolated in China in recent years. Both F128 and E46 exhibited potent neutralizing activity against all four tested strains of three different topotypes of FMDV serotype O (Table 2). The fact that the two MAbs were bnAbs renders them ideal for use in the NA-ELISA. Therefore, a blocking ELISA based on bovine bnAbs for detecting neutralizing antibodies against FMDV serotype O was developed. The specificity and sensitivity of the test were estimated to be 99.21% and 100%, respectively, with a cutoff value of 1.35 (log10). Although the results are not conclusive because only a limited number of known serum samples were analyzed, the initial results are encouraging. Further study is needed to precisely evaluate these parameters for the NA-ELISA with more standard positive and negative serum samples. To our knowledge, this is the first time that broadly neutralizing monoclonal antibodies have been reported to be used as the capture and tracer antibodies in a blocking ELISA for detecting neutralizing antibodies against FMDV.

FMDV shows a high degree of genetic variation, resulting in the appearance of seven immunological serotypes and multiple topotypes. Serotype O strains have a wide range of antigenic variation, making it difficult to match vaccine strains against the strains responsible for field outbreaks (22, 23). Therefore, the frequent updating of vaccine strains for vaccine production is necessary for the success of a vaccination campaign (24, 25). To solve the problems of FMDV antigenic diversity, bnAbs that could detect multiple topotypes of FMDV serotype O were used. Thus, when detecting neutralizing antibodies against FMDV in sera by the NA-ELISA, only the 146S antigen needs to be updated to match new vaccine strains. Our results show that the NA-ELISA can detect neutralizing antibodies to all tested strains of the three topotypes of FMDV serotype O currently circulating in China and is comparable to the gold standard VNT for antibody detection (Table 3). Pearson’s correlation coefficients were 0.8939 for FMDV O/HN/CHA/93, 0.8760 for FMDV O/XJ/CHA/2017, and 0.7139 for FMDV O/Mya/98, with a significant correlation (P < 0.05) between the NA-ELISA titers and the VNT titers being seen, indicating the potential use of the NA-ELISA instead of VNT for large-scale screening.

In conclusion, we have described an efficient method for the generation of recombinant broadly neutralizing monoclonal antibodies derived from single B cells. These broadly neutralizing antibodies can be applied to identify conserved epitopes of FMDV and to guide the rational design of universal FMDV vaccines. Work is under way to identify conserved epitopes by selecting MAb neutralization-resistant mutants (26) or screening a phage-displayed random 12-peptide library (27, 28). Neutralizing monoclonal antibodies can also be used for the development of detection methods. Here, a blocking ELISA for detecting neutralizing antibodies against FMDV serotype O based on two broadly neutralizing bovine monoclonal antibodies was successfully developed. The NA-ELISA has a high sensitivity and a high specificity, and the NA-ELISA titers are significantly positively correlated with the VNT titers, demonstrating that the NA-ELISA can be used as an alternative to VNT for detecting protective antibodies against FMDV serotype O. Our study is also applicable to the development of a neutralizing antibody detection ELISA for the six other serotypes of FMDV.

ACKNOWLEDGMENTS

This research was supported by a grant from the National Key Research and Development Program of China (grant 2017YFD0501104).

We thank Shuyun Qi and Yanhong Liu for their excellent technical assistance and the management of flow cytometry at the Lanzhou Veterinary Research Institute.

REFERENCES

  • 1.Arzt J, Baxt B, Grubman MJ, Jackson T, Juleff N, Rhyan J, Rieder E, Waters R, Rodriguez LL. 2011. The pathogenesis of foot-and-mouth disease II: viral pathways in swine, small ruminants, and wildlife; myotropism, chronic syndromes, and molecular virus-host interactions. Transbound Emerg Dis 58:305–326. doi: 10.1111/j.1865-1682.2011.01236.x. [DOI] [PubMed] [Google Scholar]
  • 2.Donaldson AI, Alexandersen S, Sørensen JH, Mikkelsen T. 2001. Relative risks of the uncontrollable (airborne) spread of FMD by different species. Vet Rec 148:602–604. doi: 10.1136/vr.148.19.602. [DOI] [PubMed] [Google Scholar]
  • 3.Knight-Jones TJ, Rushton J. 2013. The economic impacts of foot and mouth disease—what are they, how big are they and where do they occur? Prev Vet Med 112:161–173. doi: 10.1016/j.prevetmed.2013.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Porphyre T, Rich KM, Auty HK. 2018. Assessing the economic impact of vaccine availability when controlling foot and mouth disease outbreaks. Front Vet Sci 5:47. doi: 10.3389/fvets.2018.00047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Jamal SM, Belsham GJ. 2013. Foot-and-mouth disease: past, present and future. Vet Res 44:116. doi: 10.1186/1297-9716-44-116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Domingo E, Escarmís C, Baranowski E, Ruiz-Jarabo CM, Carrillo E, Núñez JI, Sobrino F. 2003. Evolution of foot-and-mouth disease virus. Virus Res 91:47–63. doi: 10.1016/s0168-1702(02)00259-9. [DOI] [PubMed] [Google Scholar]
  • 7.Rodriguez LL, Gay CG. 2011. Development of vaccines toward the global control and eradication of foot-and-mouth disease. Expert Rev Vaccines 10:377–387. doi: 10.1586/erv.11.4. [DOI] [PubMed] [Google Scholar]
  • 8.Pay TWF, Hingley PJ. 1986. The use of serum neutralising antibody assay for the determination of the potency of foot-and-mouth disease vaccines in cattle. Dev Biol Stand 64:153–161. doi: 10.1016/0264-410X(87)90011-9. [DOI] [PubMed] [Google Scholar]
  • 9.Ahl R, Haas B, Lorenz RJ, Wittman G. 1990. Alternative potency test of FMD vaccines and results of comparative antibody assays in different cell systems and ELISA, p 51–60. In Report of the meeting of the Research Group of the Standing Technical Committee of the European Commission for the Control of Foot-and-Mouth Disease. FAO, Rome, Italy. [Google Scholar]
  • 10.Pay TWF, Hingley PJ. 1992. Foot-and-mouth disease vaccine potency tests in cattle: the interrelationship of antigen dose, serum neutralizing antibody response and protection from challenge. Vaccine 10:699–706. doi: 10.1016/0264-410X(92)90092-X. [DOI] [PubMed] [Google Scholar]
  • 11.World Organization for Animal Health. 2012. Foot and mouth disease, p 145–173. In Manual of diagnostic tests and vaccines for terrestrial animals, vol 2, 7th ed Office International des Epizooties, Paris, France. [Google Scholar]
  • 12.Haas B. 1994. Application of the FMD liquid-phase blocking sandwich ELISA. Problems encountered in import/export serology and possible solutions, p 124–127. In Report of the session of the Research Group of the Standing Technical Committee of the European Commission for the Control of Foot-and-Mouth Disease, Vienna, Austria. [Google Scholar]
  • 13.Mackay DK, Bulut AN, Rendle T, Davidson F, Ferris NP. 2001. A solid-phase competition ELISA for measuring antibody to foot-and-mouth disease virus. J Virol Methods 97:33–48. doi: 10.1016/s0166-0934(01)00333-0. [DOI] [PubMed] [Google Scholar]
  • 14.Shao JJ, Wong CK, Lin T, Lee SK, Cong GZ, Sin FWY, Du JZ, Gao SD, Liu XT, Cai XP, Xie Y, Chang HY, Liu JX. 2011. Promising multiple-epitope recombinant vaccine against foot-and-mouth disease virus type O in swine. Clin Vaccine Immunol 18:143–149. doi: 10.1128/CVI.00236-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lu ZJ, Cao YM, Guo JH, Qi SY, Li D, Zhang Q, Ma JW, Chang HY, Liu ZX, Liu XT, Xie QG. 2007. Development and validation of a 3ABC indirect ELISA for differentiation of foot-and-mouth disease virus infected from vaccinated animals. Vet Microbiol 125:157–169. doi: 10.1016/j.vetmic.2007.05.017. [DOI] [PubMed] [Google Scholar]
  • 16.Friguet B, Djavadi-Ohaniance L, Pages J, Bussard A, Goldberg M. 1983. A convenient enzyme-linked immunosorbent assay for testing whether monoclonal antibodies recognize the same antigenic site. Application to hybridomas specific for the beta 2-subunit of Escherichia coli tryptophan synthase. J Immunol Methods 60:351–358. doi: 10.1016/0022-1759(83)90292-2. [DOI] [PubMed] [Google Scholar]
  • 17.Cao Y, Lu Z, Sun J, Bai X, Sun P, Bao H, Chen Y, Guo J, Li D, Liu X, Liu Z. 2009. Synthesis of empty capsid-like particles of Asia I foot-and-mouth disease virus in insect cells and their immunogenicity in guinea pigs. Vet Microbiol 137:10–17. doi: 10.1016/j.vetmic.2008.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Office International des Epizooties and Food and Agriculture Organization of the United Nations. 2005. Chapter 2.1.1. Foot-and-mouth disease In OIE manual of diagnostic tests and vaccines for terrestrial animals. Office International des Epizooties, Paris, France. [Google Scholar]
  • 19.Hamblin C, Barnett IT, Hedger RS. 1986. A new enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against foot-and-mouth disease virus. I. Development and method of ELISA. J Immunol Methods 93:115–121. doi: 10.1016/0022-1759(86)90441-2. [DOI] [PubMed] [Google Scholar]
  • 20.Maradei E, La Torre J, Robiolo B, Esteves J, Seki C, Pedemonte A, Iglesias M, D'Aloia R, Mattion N. 2008. Updating of the correlation between lpELISA titers and protection from virus challenge for the assessment of the potency of polyvalent aphtovirus vaccines in Argentina. Vaccine 26:6577–6586. doi: 10.1016/j.vaccine.2008.09.033. [DOI] [PubMed] [Google Scholar]
  • 21.DeLong ER, DeLong DM, Pearson C. 1988. Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach. Biometrics 44:837–845. doi: 10.2307/2531595. [DOI] [PubMed] [Google Scholar]
  • 22.Office International des Epizooties and Food and Agriculture Organization of the United Nations. 2006. Summary of antigenic characterization of FMD field isolates by matching with vaccine strains, p 15–18. In Annual OIE/FAO FMD Reference Laboratory Network report, January-December 2006. Office International des Epizooties, Paris, France. [Google Scholar]
  • 23.Office International des Epizooties and Food and Agriculture Organization of the United Nations. 2007. Summary of antigenic typing, p 20–22. In Annual OIE/FAO FMD Reference Laboratory Network report, January-December 2007. Office International des Epizooties, Paris, France. [Google Scholar]
  • 24.de Los Santos T, Diaz-San Segundo F, Rodriguez LL. 2018. The need for improved vaccines against foot-and-mouth disease. Curr Opin Virol 29:16–25. doi: 10.1016/j.coviro.2018.02.005. [DOI] [PubMed] [Google Scholar]
  • 25.Mahapatra M, Yuvaraj S, Madhanmohan M, Subramaniam S, Pattnaik B, Paton DJ, Srinivasan VA, Parida S. 2015. Antigenic and genetic comparison of foot-and-mouth disease virus serotype O Indian vaccine strain, O/IND/R2/75 against currently circulating viruses. Vaccine 33:693–700. doi: 10.1016/j.vaccine.2014.11.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Grazioli S, Fallacara F, Brocchi E. 2013. Mapping of antigenic sites of foot-and-mouth disease virus serotype Asia 1 and relationships with sites described in other serotypes. J Gen Virol 94:559–569. doi: 10.1099/vir.0.048249-0. [DOI] [PubMed] [Google Scholar]
  • 27.Liu WM, Yang BL, Wang MX, Wang HW, Yang DC, Ma WG, Zhou GH, Yu L. 2017. Identification of a conformational neutralizing epitope on the VP1 protein of type A foot-and-mouth disease virus. Res Vet Sci 115:374–381. doi: 10.1016/j.rvsc.2017.07.001. [DOI] [PubMed] [Google Scholar]
  • 28.Liu WM, Yang BL, Wang MX, Liang WF, Wang HW, Yang DC, Ma WG, Zhou GH, Yu L. 2017. Identification of a conserved conformational epitope in the VP2 protein of foot-and-mouth disease virus. Arch Virol 162:1877–1885. doi: 10.1007/s00705-017-3304-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The sequences of monoclonal antibodies F128 and E46 are available from the corresponding authors upon reasonable request.


Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES