Skip to main content
3 Biotech logoLink to 3 Biotech
. 2019 Nov 27;10(1):6. doi: 10.1007/s13205-019-1990-3

Integrated miRNA-seq analysis reveals the molecular mechanism underlying the effect of acupuncture on endometrial receptivity in patients undergoing fertilization: embryo transplantation

Yanyun Mu 1,#, Qian Li 1,#, Jie Cheng 1, Jie Shen 1, Xun Jin 1, Zhengyun Xie 2, Zhao Gao 3, Wenjing Zhang 4, Qixin Hua 5, Liangjun Xia 6, Youling Gao 1, Youbing Xia 1,7,✉
PMCID: PMC6879696  PMID: 31824817

Abstract

Endometrial receptivity (ER) is the main factor affecting in vitro fertilization (IVF) and embryo transplantation. Previous studies have shown that acupuncture might be useful for increasing ER. However, the underlying microRNA (miRNA) molecular mechanisms deserve to be further elucidated. In this study, we performed small RNA sequencing of endometrial samples from infertile women who either underwent acupuncture therapy or did not. Differentially expressed microRNAs (DEmiRNAs) were identified and used to predict target genes. Then, the functional and pathway were analyzed for the target genes. Moreover, quantitative reverse transcription PCR (qRT-PCR) was performed to validate the RNA-seq results. Finally, the miRNA-gene network was conducted by Cytoscape. A total of 39 DEmiRNAs were identified between the acupuncture group and the control group. The functional enrichment analysis suggested that the target genes of the DEmiRNAs were significantly enriched in GO biological process (BP) terms associated with transcription, such as regulation of DNA-templated transcription and positive regulation of DNA-templated transcription. The pathway analysis showed that DEmiRNAs might be involved in acupuncture therapy via Endocytosis, Axon guidance, Oxytocin signaling, the Hippo pathway, and Estrogen signaling pathways. Significant downregulation of hsa-miR-449a and hsa-miR-449b-3p, and significant upregulation of hsa-miR-3135b and hsa-miR-345-3p in the RNA-seq results were validated by qRT-PCR. Besides, these four DEmiRNAs and their 34 target genes conducted a miRNA–gene network. Our results predict that hsa-miR-449a, hsa-miR-3135b and hsa-miR-345-3p may underly mechanisms by which acupuncture therapy help increase ER and promote endometrium receptivity in preparation for in vitro fertilization and embryo transplantation.

Keywords: In vitro fertilization-embryo transplantation, Endometrium receptivity, Acupuncture, miRNA-seq

Introduction

During the past decades, researchers have made great advances in the field of in vitro fertilization (IVF) and embryo transfer for assisted reproductive technology (ART); however, implantation failure is still a major cause of low pregnancy rate in ART (Toth et al. 2011). The most important factors affecting the success of IVF include age, endosperm quality, and endometrial receptivity (Wu et al. 2014). Several studies have shown a significant correlation between endometrial receptivity (ER), pregnancy rate, and endometrial thickness (EMT), which is considered to be an indicator of ER. Patients with EMT > 7 mm on the day of human chorionic gonadotropin (HCG) administration had higher pregnancy rates than patients with a thin endometrium (EMT < 7 mm) (Kunicki et al. 2014; Kasius et al. 2014). Medications such as aspirin, vitamin E, and pentoxifylline have been used to increase EMT (Tesarik et al. 2004; Tourgeman et al. 2001; Weckstein et al. 1997; Acharya et al. 2009; Gleicher et al. 2013; Letur-Konirsch and Delanian 2003), but their effect is limited.

Acupuncture is a traditional Chinese medicine approach with more than 2000 years of history, recorded in The Medical Classic of the Yellow Emperor, an ancient treatise on this topic (Cochrane et al. 2014; Zhou and Benharash 2014). Many studies have shown that acupuncture is effective in the treatment of diseases (Linde et al. 2016b; Manheimer et al. 2012; Linde et al. 2016a; Johansson and Stener-Victorin 2013; Kuang et al. 2013). The use of acupuncture in reproductive endocrinology and infertility has become popular worldwide (Kuang et al. 2013). In addition, acupuncture applied on the lower limbs and in the lower abdomen can increase blood flow to the ovaries and uterus, and can thus increase the thickness of the endometrial lining (Stener-Victorin et al. 1996; Napadow et al. 2008). However, clinicians trained in Western medicine often refuse to recommend acupuncture to their patients, mainly because the specific mechanism of acupuncture treatment is unclear.

The relationship between acupuncture and endometrial receptivity has not been studied. To further elucidate the molecular mechanisms of acupuncture, in this study, we performed microRNA (miRNAs) sequencing of endometrial samples from infertile women who either underwent acupuncture therapy or did not. Then, identified the differentially expressed miRNAs (DEmiRNAs), and their functions were predicted. Moreover, a competitive miRNA–mRNA network was constructed to further interpret the molecular mechanism of acupuncture therapy on low endometrium receptivity. We anticipate our results could help understand the role of acupuncture in treating women’s health.

Materials and methods

Patients

The endometrial samples were collected from infertile women with thin endometrium at childbearing age undergoing embryo transplantation at our hospital from January 2016 to June 2017. All women experienced infertility for 1.5–9 years caused by thin endometrium combined with salpingitis, polycystic ovarian syndrome, or diminished ovarian reserve. A total of 12 women who planned to receive IVF embryo transplantation (ET) were recruited in the study (Table 1). The women were assigned to either the case group (n = 6) or the control group (n = 6) according to their characteristics or response during previous cycles. IVF was performed in women of both groups as previously described (Jeong et al. 2018). Additionally, women in the case group underwent acupuncture at six points, i.e., Guanyuan (CV4), Zigong (EX-CA1), Zusanli (ST36), Sanyinjiao (SP6), Shenshu (BL23), and Ciliao (BL32). Acupoint selection is based on traditional Chinese medicine theory and classical acupoint consensus and reference literature (Tanaka 2002; Villahermosa et al. 2013). EMT was measured at the maximal distance between each myometrial–endometrial interface by vaginal ultrasonography in the mid-luteal phase. This study was approved by the ethics committee of Nanjing Medical University (No. 2014, 204). All women provided written informed consent.

Table 1.

Primers sequences for qRT-PCR

Gene Direction Sequence
U6 Forward 5′ CGATACAGAGAAGATTAGCATGGC 3′
hsa-miR-449a Forward 5′ GCGCAGTGGCAGTGTATTGTT 3′
hsa-miR-449b-3p Forward 5′ GTGATGCAGCCACAACTACCC 3′
hsa-miR-449c-5p Forward 5′ CGCAGTAGGCAGTGTATTGCTAG 3′
hsa-miR-4463 Forward 5′ GCTCAGCAGGAGACTGGGGT 3′
hsa-miR-4446-3p Forward 5′ ACTACATCAGGGCTGGCAGTGA 3′
hsa-miR-3135b Forward 5′ ATTCGGCTGGAGCGAGTGC 3′
hsa-miR-345-3p Forward 5′ TGGTTATTAGCCCTGAACGAG 3′
Reverse 5′ AGTGCGTGTCGTGGAGTCG 3′

Forward is the specific primer for miRNA, and Reverse is the primer matching RT

Acupuncture therapy procedure

Women in the case group received acupuncture from the first day of two menstrual cycles before entering IVF-ET to the day of IVF-ET, with a frequency of once every other day. The procedure was as follows: women rested in a supine position; needles with a length ranging from 25 to 40 mm were inserted, and mild reinforcing and attenuating techniques were applied. The needle is retained for 30 s upon arrival of qi, then twirled 90°, and then lifted and thrust within a range of 2 mm with a frequency of 60–100 times/min. The needles were retained for 30 min at each acupuncture point. During needle retention, Han’s acupoint neurostimulator (HANS, LH202) was connected to the needles at Ciliao (BL32) and Zigong (EX-CA1). The frequency of HANS was 2–15 Hz and the intensity of stimulation was adjusted depending on the patients’ condition and comfort. Acupuncture was applied at Guanyuan (CV4) and Zusanli (ST36) as follows: the needle was inserted 2 cm and held vertically at each point for 10 min. The acupuncture session was stopped if the patient could not tolerate the discomfort.

RNA extraction

Endometrial samples were obtained during the mid-luteal phase of the menstrual cycle. Total RNA from the endometrial samples of the two groups was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A NanoDrop 2000 spectrophotometer (Wilmington, DE, USA) was used to measure the quantity and quality of the extracted RNA. The qualified RNA samples with an A260/280 ratio > 1.9 were used for cDNA library construction as described previously [21].

Small RNA library construction and sequencing

NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, Ipswich, MA, USA) was used to construct small RNA libraries. First, the RNA (1 µg total RNA) was ligated to the adapter; afterward, reverse transcription and PCR amplification were performed. Second, purification of amplified PCR products was performed using a QIAQuick PCR Purification Kit (NEB, Ipswich, MA, USA), and fractions were size-separated in 8% tris–borate-EDTA and 8% polyacrylamide gel electrophoresis (TBE-PAGE). Third, we evaluated the library quality using the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Last, we performed RNA sequencing at Shanghai Yingbio Biotechnology Co., Ltd., using the Illumina Hiseq 2500 Genome Analyzer platform in pair-end mode.

Sequencing data processing

The raw reads were qualified using Fast-QC (v0.11.7) (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) by filtering empty reads, adaptor sequences and low-quality sequences (> 50% of bases whose Q scores were ≤ 10%). We used the internationally recognized Burrows-Wheeler Aligner algorithm for miRNA mapping. We compared the filtered clean reads with the human miRNA, genome and Rfam databases, and obtained the expression of miRNA. Gene expression abundance was calculated in fragments per kilobase of exon per million fragments mapped (FPKM). miRNAs that were differentially expressed between the two groups (DEmiRNAs) were screened using the DESeq software (Wang et al. 2010), meeting the criteria of log2 fold change (FC) > 1 and false discovery rate (FDR) < 0.05.

miRNA target genes prediction

The target genes of the DEmiRNAs were predicted using miRanda and RNAhybrid (Kruger and Rehmsmeier 2006; Rehmsmeier et al. 2004). The energy threshold was set at < − 20 and the alignment score was set at > 150 for miRanda prediction, and we used a free energy threshold of < − 25 for RNAhybrid prediction. Only the target genes predicted by the two methods were retained for further analysis. Cytoscape V3.6.0 was used to construct the miRNA–gene network.

Functional enrichment analysis

The function of the gene was predicted by Gene Ontology (GO) analysis (http://www.geneontology.org), which covers three categories: cellular component (CC), molecular function (MF), and biological process (BP) (Ashburner et al. 2000). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (https://www.kegg.jp/) was performed to identify the cellular signal pathways in which DEmiRNAs target genes are involved. The threshold of significance for GO and KEGG analyses was defined as FDR < 0.05.

Validation of the DEmiRNAs

The expression levels of seven key DEmiRNAs were validated by quantitative reverse-transcription PCR (qRT-PCR). First, total RNA from endometrial samples was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Afterward, complementary DNA (cDNA) was reverse transcribed and synthesized using the PrimeScript RT kit (Takara, Dalian, China). Then, qRT-PCR was performed using a SYBR-Green PCR kit (Roche Diagnostics, Indianapolis, IN, USA) and a qRT-PCR system of StepOnePlus (Applied Biosystems, Foster City, CA, USA). The primer sequences used for the PCR are shown in Table 1. The qRT-PCR cycling conditions were as follows: 95 °C for 10 min, 45 cycles of 95 °C for 15 s, 60 °C for 60 s, dissociation at 95 °C for 10 s, 60 °C for 1 min, and 95 °C for 15 s. Relative gene expression was determined by the 2-ΔΔCt method using the U6 gene as internal control. The qRT-PCR were all repeated three times.

Statistical analysis

RNA sequence data were analyzed by bioinformatics methods as indicated above. Other data were analyzed using SPSS 21.0 (IBM, Chicago, USA). Differences between the two groups were compared by two-tailed Students’ t test, and P < 0.05 was accepted as statistically significant.

Results

General characteristics of the women included in the study

The characteristics of the women in the two groups are shown in Table 2. The age and duration of infertility (in years) were significantly higher in the case group than in the control group (P = 0.03 and P = 0.02, respectively). The other characteristics, including BMI, age of menarche, menstrual cycle, menstrual duration, and EMT before acupuncture, were comparable between the two groups (P > 0.05). However, EMT was significantly increased upon acupuncture therapy (P < 0.05).

Table 2.

General characteristic of women in this study

Terms Case (n = 6) Control (n = 6) P
Age, years 31 ± 2.37 27.5 ± 2.43 0.03
Infertility years 5.75 ± 2.40 2.83 ± 0.68 0.02
BMI, kg/m2 21.52 ± 1.35 20.77 ± 1.01 0.3
Age of menarche, years 14.33 ± 1.51 13 ± 0.89 0.09
Menstrual cycle, days 58.75 ± 60.04 32.08 ± 10.10 0.3
Menstrual duration 6.58 ± 0.86 5.58 ± 1.16 0.12
EMT before acupuncture and moxibustion 9.3 ± 1.15 10.26 ± 1.34 0.21
EMT after acupuncture and moxibustion 8.65 ± 0.73 10.26 ± 1.34 0.02

EMT was measured on the day of transplant

BMI body mass index, EMT endometrium thickness

Difference between the case and control groups was compared by Student’s test. P < 0.05 indicated statistical significance

Identification of DEmiRNAs

Considering P < 0.05 to indicate statistically significant differences, a total of 39 DEmiRNAs (including 14 upregulated miRNAs and 25 downregulated miRNAs) were screened in the case group and compared with those in the control group. Hierarchical cluster analysis indicated that these DEmiRNAs allow separating the samples into case and control groups (Fig. 1), suggesting the reliability of our analysis.

Fig. 1.

Fig. 1

Differentially expressed (DE) microRNAs (miRNA) between women who either received acupuncture (case group, Case 1–6) or did not (control group, NC 1–6). Hierarchical cluster analysis of DEmiRNAs in the control and case groups by small RNA-seq. The red and green colors denote miRNA mean upregulation and downregulation, respectively

Functional analysis of the DEmiRNAs

To further interpret the DEmiRNAs, we performed GO and pathway enrichment analysis for the target genes. A total of 23 GO BP terms were significantly enriched (FDR < 0.05). Most enriched GO BP terms were related to transcription (e.g., DNA-templated transcription, regulation of DNA-templated transcription, positive regulation of DNA-templated transcription, and positive regulation of transcription from RNA polymerase II promoter), transport (e.g., synaptic transmission), development (e.g., nervous system development and negative regulation of cell proliferation) (Fig. 2a). The pathway analysis revealed that 78 terms were enriched for the target genes of the DEmiRNAs, based on the cutoff value of FDR < 0.05, including Endocytosis, Axon guidance, Oxytocin signaling pathway, the Hippo pathway, Estrogen signaling pathway (Fig. 2b).

Fig. 2.

Fig. 2

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results. The top 20 enrichment terms of the GO BP analysis (a), and the top 30 enrichment terms of the pathway analysis (b) of DEmiRNAs. Significant terms are shown in red and non-significant terms are shown in green (P value < 0.05)

Validation of DEmiRNAs

To validate our results, we selected seven DEmiRNAs and performed qRT-PCR for further confirmation. As shown in Fig. 3, compared with control group, significantly downregulated expression of hsa-miR-449a and hsa-miR-449b-3p, and significantly upregulated expression of hsa-miR-3135b and hsa-miR-345-3p revealed by RNA-seq results were validated by qRT-PCR; however, the difference between the case and the control groups in the downregulation of hsa-miR-449c-5p, and in the upregulation of hsa-miR-4446-3p and hsa-miR-4463, did not reach statistical significance (P > 0.05) (Fig. 3). The raw data were uploaded to Sequence Read Archive (SRA) (http://www.ncbi.nlm.nih.gov/) with accession PRJNA587020.

Fig. 3.

Fig. 3

Validation of expression of the selected upregulated (a) and downregulated DEmiRNAs (b) in endometrial tissues of the case and control groups by qRT-PCR. The asterisk indicates statistically significant differences (t test, P < 0.05), n = 6

Construction of miRNA–gene network map

To better understand the interaction between miRNA and target genes in the estrogen pathway, a miRNA–gene network map was constructed using Cytoscape (Fig. 4). This network was constructed with upregulated and downregulated miRNAs along with their target genes. In this network, several miRNA–gene relationships were predicted. For example, the upregulation of both hsa-miR-3135b and hsa-miR-345-3p included adenylate cyclase 2 (ADCY2) and growth factor receptor-bound protein 2 (GRB2) as common target genes. Upregulated miRNAs included hsa-miR-3135b and hsa-miR-345-3p, with 21 and 10 predicted target genes, respectively. Downregulated mRNAs include hsa-miR-449a and hsa-miR-449b-3p, having 5 and 4 predicted target genes, respectively.

Fig. 4.

Fig. 4

The miRNA–gene network for DEmiRNAs was verified by qRT-PCR. The red and blue colors represent upregulation miRNA, and downregulation miRNA, respectively. The target gene predicted by TargetScan is shown in green

Discussion

The endometrium is a hormone-dependent tissue and the primary target organ of estrogen, which is essential for endometrial proliferation (Tourgeman et al. 2001; Hapangama et al. 2015). Several studies on ER and embryo implantation have reported the effects exerted by estrogen and estrogen receptors (Lessey and Young 2014; Young 2013; Dorostghoal et al. 2018; Kobayashi et al. 2017). The differential RNA was significantly enriched in this pathway. Hence, one of our objectives was to target the estrogen pathway. Based on the miRNA–gene network, we found that upregulated hsa-miR-3135b and hsa-miR-345-3p can be targeted to ADCY2 (Fig. 4). The ADCY2 gene is insensitive to Ca (2+), and codes for a membrane-associated enzyme that catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). The inhibition of cAMP-mediated signaling can activate the production of blood platelets, which increases the incidence of pregnancy in cows (Lange-Consiglio et al. 2015; Raslan and Naseem 2015; Cheng et al. 2002). Taken together, we hypothesized that acupuncture treatment may affect the activity of ADCY2 by affecting the expression of hsa-miR-3135b and hsa-miR-345-3p, thereby affecting the activity of the downstream cAMP signaling cascade and ultimately increasing ER.

Hsa-miR-449a was verified by qRT-PCR that significantly downregulates in the case group, and targeted the calmodulin-like protein 3 (CALML3), which is involved in the estrogen metabolic pathway. CALML3 is an estrogen receptor alpha coregulator that functions as a sensor and regulates gene expression (Qin et al. 2017). Previous studies have shown that CALML3 regulates myosin-10 (Arase et al. 2009; Rogers and Strehler 2001), which may play an important role in cell adhesion and motility, which influence ER (Yonezawa et al. 2003; Tokuo and Ikebe 2004; Bohil et al. 2006; Gnainsky et al. 2015; Evans-Hoeker and Young 2014). Our results indicate that acupuncture might increase ER by downregulating hsa-miR-449a and increasing the expression of CALML3 and myosin-10.

According to the pathway analysis, the Hippo pathway showed obvious changes. The Hippo pathway is an evolutionarily conserved signaling pathway that plays essential roles in growth control (Zhao et al. 2011). The activation of the Hippo/Yes-Associated Protein Pathway (YAP) promotes cell proliferation and Anti-apoptosis gene expression in the endometrium (Zhu et al. 2017). YAP, one of the core components of the Hippo pathway, can mediate the decidualization of uterine endometrial stromal cells in humans (Song et al. 2018). Previous research has found that the degradation of phosphorylated YAP downregulates interferon tau gene (IFNT) transcription after conceptus attachment to the uterine endometrium (Kusama et al. 2016). IFNT acts on the endometrium, regulating genes that play an important role in ER and conceptus growth, as well as in development and implantation (Spencer et al. 2004; Kim et al. 2003; Gray et al. 2004; Nagaoka et al. 2003; Gray et al. 2006; Kunii et al. 2018). Based on the above research results, we speculate that acupuncture exerts its effects through the Hippo pathway, and downregulates the IFNT gene, thus increasing ER.

Our results predict that hsa-miR-449a, hsa-miR-3135b and hsa-miR-345-3p may be underlying molecules by which acupuncture therapy may help increase ER and promote endometrium receptivity in preparation for in vitro fertilization-embryo transplantation.

Acknowledgements

This work was supported by the National Natural Science Foundation of China [Grant numbers 81473767, 81873371, 81403477, 81603674, 81403481, 81804179] and by the Jiangsu Provincial Science and Technology Project of the Traditional Chinese Medicine Bureau [Grant number YB2017005].

Author contribution

Conceptualization: Youbing Xia; Methodology: Yanyun Mu, Qian Li, Jie Cheng; Formal analysis and investigation: Yanyun Mu, Qian Li, Jie Shen, Zhengyun Xie, Zhao Gao, Wenjing Zhang, Qixin Hua; Writing—original draft preparation: Yanyun Mu, Jie Shen, Youling Gao; Writing—review and editing: Qian Li, Xun Jin, Liangjun Xia; Funding acquisition: Youbing Xia; Resources: Jie Cheng, …; Supervision: Youbing Xia. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data availability

The raw data were uploaded to Sequence Read Archive (SRA) (http://www.ncbi.nlm.nih.gov/) with accession PRJNA587020.

Compliance with ethical standards

Conflict of interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Ethical approval

This study was approved by the ethics committee of Nanjing Medical University (No. 2014, 204).

Informed consent

All women provided written informed consent.

Footnotes

Yanyun Mu and Qian Li contributed equally to this work and should be considered co-first authors.

References

  1. Acharya S, Yasmin E, Balen AH. The use of a combination of pentoxifylline and tocopherol in women with a thin endometrium undergoing assisted conception therapies—a report of 20 cases. Hum Fertil (Camb) 2009;12:198–203. doi: 10.3109/14647270903377178. [DOI] [PubMed] [Google Scholar]
  2. Arase T, Uchida H, Kajitani T, et al. The UDP-glucose receptor P2RY14 triggers innate mucosal immunity in the female reproductive tract by inducing IL-8. J Immunol. 2009;182:7074–7084. doi: 10.4049/jimmunol.0900001. [DOI] [PubMed] [Google Scholar]
  3. Ashburner M, Ball CA, Blake JA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25:25–29. doi: 10.1038/75556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bohil AB, Robertson BW, Cheney RE. Myosin-X is a molecular motor that functions in filopodia formation. Proc Natl Acad Sci USA. 2006;103:12411–12416. doi: 10.1073/pnas.0602443103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science. 2002;296:539–541. doi: 10.1126/science.1068711. [DOI] [PubMed] [Google Scholar]
  6. Cochrane S, Smith CA, Possamai-Inesedy A, Bensoussan A. Acupuncture and women’s health: an overview of the role of acupuncture and its clinical management in women’s reproductive health. Int J Womens Health. 2014;6:313–325. doi: 10.2147/IJWH.S38969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dorostghoal M, Ghaffari HO, Marmazi F, Keikhah N. Overexpression of endometrial estrogen receptor-alpha in the window of implantation in women with unexplained infertility. Int J Fertil Steril. 2018;12:37–42. doi: 10.22074/ijfs.2018.5118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Evans-Hoeker EA, Young SL. Endometrial receptivity and intrauterine adhesive disease. Semin Reprod Med. 2014;32:392–401. doi: 10.1055/s-0034-1376358. [DOI] [PubMed] [Google Scholar]
  9. Gleicher N, Kim A, Michaeli T, Lee HJ, Shohat-Tal A, Lazzaroni E, Barad DH. A pilot cohort study of granulocyte colony-stimulating factor in the treatment of unresponsive thin endometrium resistant to standard therapies. Hum Reprod. 2013;28:172–177. doi: 10.1093/humrep/des370. [DOI] [PubMed] [Google Scholar]
  10. Gnainsky Y, Granot I, Aldo P, Barash A, Or Y, Mor G, Dekel N. Biopsy-induced inflammatory conditions improve endometrial receptivity: the mechanism of action. Reproduction. 2015;149:75–85. doi: 10.1530/REP-14-0395. [DOI] [PubMed] [Google Scholar]
  11. Gray CA, Adelson DL, Bazer FW, Burghardt RC, Meeusen EN, Spencer TE. Discovery and characterization of an epithelial-specific galectin in the endometrium that forms crystals in the trophectoderm. Proc Natl Acad Sci USA. 2004;101:7982–7987. doi: 10.1073/pnas.0402669101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gray CA, Abbey CA, Beremand PD, Choi Y, Farmer JL, Adelson DL, Thomas TL, Bazer FW, Spencer TE. Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biol Reprod. 2006;74:383–394. doi: 10.1095/biolreprod.105.046656. [DOI] [PubMed] [Google Scholar]
  13. Hapangama DK, Kamal AM, Bulmer JN. Estrogen receptor beta: the guardian of the endometrium. Hum Reprod Update. 2015;21:174–193. doi: 10.1093/humupd/dmu053. [DOI] [PubMed] [Google Scholar]
  14. Jeong JE, Joo BS, Kim CW, Kim HG, Joo JK, Lee KS. Effects of three-area laser-assisted zona thinning in 8-cell human embryos on pregnancy outcomes in vitro fertilization. Clin Exp Reprod Med. 2018;45:25–30. doi: 10.5653/cerm.2018.45.1.25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Johansson J, Stener-Victorin E. Polycystic ovary syndrome: effect and mechanisms of acupuncture for ovulation induction. Evid Based Complement Alternat Med. 2013;2013:762615. doi: 10.1155/2013/762615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kasius A, Smit JG, Torrance HL, Eijkemans MJ, Mol BW, Opmeer BC, Broekmans FJ. Endometrial thickness and pregnancy rates after IVF: a systematic review and meta-analysis. Hum Reprod Update. 2014;20:530–541. doi: 10.1093/humupd/dmu011. [DOI] [PubMed] [Google Scholar]
  17. Kim S, Choi Y, Bazer FW, Spencer TE. Identification of genes in the ovine endometrium regulated by interferon tau independent of signal transducer and activator of transcription 1. Endocrinology. 2003;144:5203–5214. doi: 10.1210/en.2003-0665. [DOI] [PubMed] [Google Scholar]
  18. Kobayashi R, Terakawa J, Omatsu T, Hengjan Y, Mizutani T, Ohmori Y, Hondo E. The window of implantation is closed by estrogen via insulin-like growth factor 1 pathway. J Reprod Infertil. 2017;18:231–241. [PMC free article] [PubMed] [Google Scholar]
  19. Kruger J, Rehmsmeier M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006;34:W451–W454. doi: 10.1093/nar/gkl243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kuang H, Li Y, Wu X, Hou L, Wu T, Liu J, Ng EH, Stener-Victorin E, Legro RS, Zhang H. Acupuncture and clomiphene citrate for live birth in polycystic ovary syndrome: study design of a randomized controlled trial. Evid Based Complement Alternat Med. 2013;2013:527303. doi: 10.1155/2013/527303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kunicki M, Lukaszuk K, Woclawek-Potocka I, Liss J, Kulwikowska P, Szczyptanska J. Evaluation of granulocyte colony-stimulating factor effects on treatment-resistant thin endometrium in women undergoing in vitro fertilization. Biomed Res Int. 2014;2014:913235. doi: 10.1155/2014/913235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kunii H, Koyama K, Ito T, Suzuki T, Balboula AZ, Shirozu T, Bai H, Nagano M, Kawahara M, Takahashi M. Hot topic: pregnancy-induced expression of interferon-stimulated genes in the cervical and vaginal mucosal membranes. J Dairy Sci. 2018;101:8396–8400. doi: 10.3168/jds.2017-14251. [DOI] [PubMed] [Google Scholar]
  23. Kusama K, Bai R, Sakurai T, Bai H, Ideta A, Aoyagi Y, Imakawa K. A transcriptional cofactor YAP regulates IFNT expression via transcription factor TEAD in bovine conceptuses. Domest Anim Endocrinol. 2016;57:21–30. doi: 10.1016/j.domaniend.2016.05.002. [DOI] [PubMed] [Google Scholar]
  24. Lange-Consiglio A, Cazzaniga N, Garlappi R, Spelta C, Pollera C, Perrini C, Cremonesi F. Platelet concentrate in bovine reproduction: effects on in vitro embryo production and after intrauterine administration in repeat breeder cows. Reprod Biol Endocrinol. 2015;13:65. doi: 10.1186/s12958-015-0064-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lessey BA, Young SL. Homeostasis imbalance in the endometrium of women with implantation defects: the role of estrogen and progesterone. Semin Reprod Med. 2014;32:365–375. doi: 10.1055/s-0034-1376355. [DOI] [PubMed] [Google Scholar]
  26. Letur-Konirsch H, Delanian S. Successful pregnancies after combined pentoxifylline-tocopherol treatment in women with premature ovarian failure who are resistant to hormone replacement therapy. Fertil Steril. 2003;79(2):439–441. doi: 10.1016/s0015-0282(02)04579-x. [DOI] [PubMed] [Google Scholar]
  27. Linde K, Allais G, Brinkhaus B, Fei Y, Mehring M, Shin BC, Vickers A, White AR. Acupuncture for the prevention of tension-type headache. Cochrane Database Syst Rev. 2016;4:CD007587. doi: 10.1002/14651858.CD007587.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Linde K, Allais G, Brinkhaus B, Fei Y, Mehring M, Vertosick EA, Vickers A, White AR. Acupuncture for the prevention of episodic migraine. Cochrane Database Syst Rev. 2016;6:CD001218. doi: 10.1002/14651858.CD001218.pub3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Manheimer E, Cheng K, Wieland LS, Min LS, Shen X, Berman BM, Lao L. Acupuncture for treatment of irritable bowel syndrome. Cochrane Database Syst Rev. 2012;5:CD005111. doi: 10.1002/14651858.CD005111.pub3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nagaoka K, Sakai A, Nojima H, Suda Y, Yokomizo Y, Imakawa K, Sakai S, Christenson RK. A chemokine, interferon (IFN)-gamma-inducible protein 10 kDa, is stimulated by IFN-tau and recruits immune cells in the ovine endometrium. Biol Reprod. 2003;68:1413–1421. doi: 10.1095/biolreprod.102.008912. [DOI] [PubMed] [Google Scholar]
  31. Napadow V, Ahn A, Longhurst J, Lao L, Stener-Victorin E, Harris R, Langevin HM. The status and future of acupuncture mechanism research. J Altern Complement Med. 2008;14:861–869. doi: 10.1089/acm.2008.SAR-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Qin S, Ingle JN, Liu M, Yu J, Wickerham DL, Kubo M, Weinshilboum RM, Wang L. Calmodulin-like protein 3 is an estrogen receptor alpha coregulator for gene expression and drug response in a SNP, estrogen, and SERM-dependent fashion. Breast Cancer Res. 2017;19:95. doi: 10.1186/s13058-017-0890-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Raslan Z, Naseem KM. Compartmentalisation of cAMP-dependent signalling in blood platelets: the role of lipid rafts and actin polymerisation. Platelets. 2015;26:349–357. doi: 10.3109/09537104.2014.916792. [DOI] [PubMed] [Google Scholar]
  34. Rehmsmeier M, Steffen P, Hochsmann M, Giegerich R. Fast and effective prediction of microRNA/target duplexes. RNA. 2004;10:1507–1517. doi: 10.1261/rna.5248604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rogers MS, Strehler EE. The tumor-sensitive calmodulin-like protein is a specific light chain of human unconventional myosin ×. J Biol Chem. 2001;276:12182–12189. doi: 10.1074/jbc.M010056200. [DOI] [PubMed] [Google Scholar]
  36. Song R, Gu D, Zhang L, Zhang X, Yu B, Liu B, Xie J. Functional significance of hippo/YAP signaling for drug resistance in colorectal cancer. Mol Carcinog. 2018;57:1608–1615. doi: 10.1002/mc.22883. [DOI] [PubMed] [Google Scholar]
  37. Spencer TE, Johnson GA, Burghardt RC, Bazer FW. Progesterone and placental hormone actions on the uterus: insights from domestic animals. Biol Reprod. 2004;71:2–10. doi: 10.1095/biolreprod.103.024133. [DOI] [PubMed] [Google Scholar]
  38. Stener-Victorin E, Waldenstrom U, Andersson SA, Wikland M. Reduction of blood flow impedance in the uterine arteries of infertile women with electro-acupuncture. Hum Reprod. 1996;11:1314–1317. doi: 10.1093/oxfordjournals.humrep.a019378. [DOI] [PubMed] [Google Scholar]
  39. Tanaka TH. IVF acupuncture points acupuncture points used in IVF clinical trials. Fertil Steril. 2002;77:721–724. [Google Scholar]
  40. Tesarik J, Hazout A, Mendoza C. Enhancement of embryo developmental potential by a single administration of GnRH agonist at the time of implantation. Hum Reprod. 2004;19:1176–1180. doi: 10.1093/humrep/deh235. [DOI] [PubMed] [Google Scholar]
  41. Tokuo H, Ikebe M. Myosin × transports Mena/VASP to the tip of filopodia. Biochem Biophys Res Commun. 2004;319:214–220. doi: 10.1016/j.bbrc.2004.04.167. [DOI] [PubMed] [Google Scholar]
  42. Toth B, Wurfel W, Germeyer A, Hirv K, Makrigiannakis A, Strowitzki T. Disorders of implantation—are there diagnostic and therapeutic options? J Reprod Immunol. 2011;90:117–123. doi: 10.1016/j.jri.2011.05.002. [DOI] [PubMed] [Google Scholar]
  43. Tourgeman DE, Slater CC, Stanczyk FZ, Paulson RJ. Endocrine and clinical effects of micronized estradiol administered vaginally or orally. Fertil Steril. 2001;75:200–202. doi: 10.1016/s0015-0282(00)01640-x. [DOI] [PubMed] [Google Scholar]
  44. Villahermosa DIM, Santos LG, Nogueira MB, Vilarino FL, Barbosa CP. Influence of acupuncture on the outcomes of in vitro fertilisation when embryo implantation has failed: a prospective randomised controlled clinical trial. Acupunct Med. 2013;31:157–161. doi: 10.1136/acupmed-2012-010269. [DOI] [PubMed] [Google Scholar]
  45. Wang L, Feng Z, Wang X, Zhang X. DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics. 2010;26:136–138. doi: 10.1093/bioinformatics/btp612. [DOI] [PubMed] [Google Scholar]
  46. Weckstein LN, Jacobson A, Galen D, Hampton K, Hammel J. Low-dose aspirin for oocyte donation recipients with a thin endometrium: prospective, randomized study. Fertil Steril. 1997;68:927–930. doi: 10.1016/s0015-0282(97)00330-0. [DOI] [PubMed] [Google Scholar]
  47. Wu Y, Gao X, Lu X, Xi J, Jiang S, Sun Y, Xi X. Endometrial thickness affects the outcome of in vitro fertilization and embryo transfer in normal responders after GnRH antagonist administration. Reprod Biol Endocrinol. 2014;12:96. doi: 10.1186/1477-7827-12-96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yonezawa S, Yoshizaki N, Sano M, Hanai A, Masaki S, Takizawa T, Kageyama T, Moriyama A. Possible involvement of myosin-X in intercellular adhesion: importance of serial pleckstrin homology regions for intracellular localization. Dev Growth Differ. 2003;45:175–185. doi: 10.1034/j.1600-0854.2004.00688.x. [DOI] [PubMed] [Google Scholar]
  49. Young SL. Oestrogen and progesterone action on endometrium: a translational approach to understanding endometrial receptivity. Reprod Biomed Online. 2013;27:497–505. doi: 10.1016/j.rbmo.2013.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhao B, Tumaneng K, Guan KL. The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat Cell Biol. 2011;13:877–883. doi: 10.1038/ncb2303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhou W, Benharash P. Effects and mechanisms of acupuncture based on the principle of meridians. J Acupunct Meridian Stud. 2014;7:190–193. doi: 10.1016/j.jams.2014.02.007. [DOI] [PubMed] [Google Scholar]
  52. Zhu HY, Ge TX, Pan YB, Zhang SY. Advanced Role of Hippo Signaling in Endometrial Fibrosis: implications for Intrauterine Adhesion. Chin Med J (Engl) 2017;130:2732–2737. doi: 10.4103/0366-6999.218013. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data were uploaded to Sequence Read Archive (SRA) (http://www.ncbi.nlm.nih.gov/) with accession PRJNA587020.


Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES