Abstract
RecQ helicases are a family of proteins involved in maintaining genome integrity with functions in DNA repair, recombination, and replication. The human RecQ helicase family consists of five helicases: BLM, WRN, RECQL, RECQL4, and RECQL5. Inherited mutations in RecQ helicases result in Bloom Syndrome (BLM mutation), Werner Syndrome (WRN mutation), Rothmund-Thomson Syndrome (RECQL4 mutation), and other genetic diseases, including cancer. The RecQ helicase family is evolutionarily conserved, as Drosophila melanogaster have three family members: DmBlm, DmRecQL4, and DmRecQL5 and DmWRNexo, which contains a conserved exonuclease domain. DmBlm has functional similarities to human BLM (hBLM) as mutants demonstrate increased sensitivity to ionizing radiation (IR) and a decrease in DNA double-strand break (DSB) repair. To determine the extent of functional conservation of RecQ helicases, hBLM was expressed in Drosophila using the GAL4 > UASp system to determine if GAL4 > UASp::hBLM can rescue DmBlm mutant sensitivity to IR. hBLM was able to rescue female DmBlm mutant sensitivity to IR, supporting functional conservation. This functional conservation is specific to BLM, as human GAL4 > UASp::RECQL was not able to rescue DmBlm mutant sensitivity to IR. These results demonstrate the conserved role of BLM in maintaining the genome while reinforcing the applicability of using Drosophila as a model system to study Bloom Syndrome.
Subject terms: Genomic instability, Double-strand DNA breaks
Introduction
One of the fundamental biological processes of the cell is to transmit genetic information to its daughter cells efficiently and accurately. Loss of genome integrity may cause detrimental changes, including mutations and other rearrangements, that can lead to cell death in single-cell organisms or tumorigenesis in multicellular organisms. Maintaining genome integrity at both the cellular and organismal level is important as genome instability is a hallmark of human diseases associated with cancer, premature aging, and developmental defects. One factor that may result in genome instability is DNA damage. There are multiple types of DNA damage, including inter and intrastrand crosslinks, base-pair mutations, and single- and double-strand breaks (DSBs)1.
One family of proteins important for repairing DSBs are RecQ helicases, which are identified through their conserved RecQ helicase superfamily domain2. RecQ helicases are involved in maintenance of genome integrity, specifically through DNA repair of DSBs and DNA damage that occurs during DNA replication3,4. The human RecQ helicase family consists of five helicases: BLM, WRN, RECQL, RECQL4, and RECQL5. Inherited mutations in RecQ helicases result in several genetic diseases, including Bloom Syndrome (mutations in BLM), Werner Syndrome (mutations in WRN), Rothmund-Thomson Syndrome (mutations in RECQL4), and other diseases, including cancer5. While loss of RecQ helicases leads to genome instability, the importance of these proteins is highlighted by their conservation across many species. All model organisms have at least one RecQ helicase, from single-celled prokaryotes to multicellular eukaryotes6 (Figs. 1 and S1). For example, Drosophila melanogaster has three RecQ helicases: DmBlm, DmRecQL4, and DmRecQL5 and an ortholog of the human WRN exonuclease domain, DmWRNexo7.
Figure 1.
RecQ helicase family. Schematic representation of the RecQ helicase protein family within and across multiple species. The highly conserved RecQ helicase superfamily domains (blue) align all protein schematics, and functionally relevant motifs or stretches of amino acid acids are colored as indicated (not to scale). *DmWRNexo lacks the RecQ helicase domain and is not considered a RecQ helicase, but included for illustrative purposes. NLS, Nuclear Localization Signal; RQC, RecQ C-terminal; HRDC, Helicase and RNaseD C-terminal. Protein lengths (amino acids) are provided.
A well-characterized RecQ helicase found in many eumetazoans is BLM (Figs. 1 and S1). Loss of BLM helicase function in humans results in Bloom Syndrome (BS), a rare autosomal recessive disease. Clinical manifestations of the disease include short stature, male infertility, and predisposition to all forms of cancer due to the high increase in chromosome instability8,9. BLM is involved in several aspects of the DSB repair pathway called homologous recombination (HR) including 5′ to 3′ end resection10,11, branch migration of the D loop12, and dissolution of double Holliday junctions by decatenation13–15. Mutations in BLM result in chromatid gaps and breaks, chromosome rearrangements, and an increase in sister chromatid exchanges16,17.
These characteristics and deficiencies seen in BS patients and cells demonstrate chromosome instability, which may also be reflected in hypersensitivity to DNA-damaging agents. Supporting this, there is an increase in hypersensitivity of both human BS cells and Drosophila Blm mutants to ionizing radiation (IR)18,19. Moreover, BLM orthologs have similar roles in both organisms based on biochemical20 and genetic experiments21,22. The two BLM orthologs also share similar protein domains (Fig. 1), consensus in the RecQ helicase domain (Supplementary Fig. S2A)23, and 30% identity and 47% similarity across the entire protein sequence24. These observations prompted us to investigate the extent of functional conservation of BLM between these humans and Drosophila. Specifically, the ability of BLM to repair IR-induced DSBs was tested by examining the sensitivity of DmBlm mutants to IR in the presence of hBLM.
Additionally, based on the conservation of RecQ helicase domain within species (Supplementary Figs. S1 and S2B), and the presence of RECQL in humans (hRECQL; Fig. 1), we determined whether hRECQL shares similar functions to repair IR-induced damage. This was tested by investigating whether hRECQL could rescue IR sensitivity in DmBlm mutants. Taken together, analyzing functional conservation of both BLM and RECQL can provide insights into evolutionary patterns of RecQ helicases.
Results
GAL4 > UASp system is effective in rescuing DmBlmN1 mutant IR sensitivity by wild-type DmBlm expression
One of the benefits of the GAL4 > UAS system is the ability to express a gene of interest both spatially and temporally, depending on the GAL4 driver as well as the UAS sequence associated with a gene of interest25. One of the first GAL4 > UAS systems developed utilized the UASt sequence, which results in expression in somatic cells of males and females26. However, considering DmBlm plays important roles in both mitotic and meiotic recombination in Drosophila19,22,27–30, additional expression in the female germline was also established using the GAL4 > UASp system, where GAL4 drivers were able to express UASp gene fusions in the female germline, as well as male and female somatic cells31,32. To confirm that GAL4 > UASp system could express the RECQ genes of interest at levels capable of rescuing DmBlm mutant phenotypes, IR sensitivity was measured in DmBlmN1 null mutants19 with and without GAL4 > UASp::DmBlm expression. DmBlmN1 mutants with GAL4 > UASp::DmBlm expression had significantly greater survival at 10 and 15 Gy than DmBlmN1 mutants without GAL4 expression (Fig. 2; p < 0.01, 0.05 respectively; two-tailed unpaired Student’s t-Test), confirming that the GAL4 > UASp expression system was sufficient to rescue IR sensitivity in both males and females (Supplementary Fig. S3A,B).
Figure 2.

DmBlm rescue of DmBlmN1 mutant IR sensitivity. DmBlmN1 heterozygotes carrying UASp::DmBlm transgene were crossed to DmBlmN1 heterozygotes carrying the Act5c::GAL4 transgene. Larvae progeny of this cross were exposed to gamma irradiation up to 20 Gy. Survival to adulthood of UASp::DmBlm homozygous DmBlmN1 mutants, relative to survival of all flies, is shown for mutants with (rescue, blue) or without (mutant, red) Act5c::GAL4. *p < 0.05, **p < 0.01, two-tailed unpaired Student’s t-Test. Means and standard errors of the mean of 2–4 replicates from two different experiments are shown.
hBLM expression rescues DmBlmN1 mutant female IR sensitivity
Considering the strong sequence conservation between DmBlm and hBLM as well as the similar roles these proteins play in genome maintenance, it was determined whether there is functional conservation of BLM between Drosophila and humans. To determine if hBLM could rescue DmBlm mutant phenotypes, a GAL4 > UASp::hBLM system was established. To validate the effectiveness of our system, the expression of hBLM mRNA was measured. Females with both Act5c::GAL4 and UASp::hBLM showed over 1000-fold increase of hBLM mRNA expression compared to females with only the UASp::hBLM transgene (Fig. 3A; 1042.9 +/− 139.7-fold increase; p < 0.0001, unpaired Student’s t-Test). Males with both Act5c::GAL4 and UASp::hBLM transgenes showed over 100-fold increase of hBLM mRNA expression compared to UASp::hBLM males (Fig. 3A; 170.5 +/− 37.5-fold increase; p < 0.01, unpaired Student’s t-Test). Differences in expression between females and males was significant (p < 0.01, two-tailed unpaired Student’s t-Test).
Figure 3.
hBLM expression and localization. (A) Flies with Act5c::GAL4 and UASp::hBLM transgenes (blue) showed greater hBLM mRNA expression than baseline levels without the GAL4 > UASp expression system (red). Mean fold change and standard errors of the mean are shown. (B) UASp::hBLM was co-transfected with Act5c::GAL4 into S2 Drosophila cells. Localizing to the nucleus (stained with DAPI) was evident in transfected cells using hBLM-specific immunofluorescence. Scale bar is 32 µm.
After confirming the GAL4 > UASp system could increase expression levels in the whole organism, nuclear localization, a requirement for accurate IR-induced DSB DNA repair, was analyzed. UASp::hBLM was transiently transfected into Drosophila S2 cells with and without Act5c::GAL4 expression vector. hBLM localized to the DAPI-stained nucleus in the presence of GAL4 (Fig. 3B).
To determine if hBLM maintained functional conservation with DmBlm, Drosophila containing UASp::hBLM with or without Act5c::GAL4 transgenes were irradiated at varying IR doses and survivors were quantified. DmBlmN1 mutant females with GAL4 > UASp::hBLM expression had greater survival than DmBlmN1 mutant females without GAL4 expression at 7.5 and 10 Gy (p < 0.05 and p < 0.01, respectively; two-tailed unpaired Student’s t-Test; Fig. 4A). DmBlmN1 mutant males with GAL4 > UASp::hBLM expression did not have a statistically significant difference in relative survival than DmBlmN1 mutant males without GAL4 expression (Fig. 4B; p > 0.05 at all doses; two-tailed unpaired Student’s t-Test).
Figure 4.

hBLM rescue of DmBlm mutant IR sensitivity. DmBlmN1 heterozygotes carrying UASp::hBLM transgene were crossed to DmBlmN1 heterozygotes carrying the Act5c::GAL4 transgene. Larvae progeny of this cross were exposed to gamma irradiation up to 15 Gy. Survival to adulthood of UASp::hBLM homozygous DmBlmN1 mutants, relative to survival of all flies, is shown for mutants with (rescue, blue) or without (mutant, red) Act5c::GAL4. (A) DmBlmN1 UASp::hBLM females with GAL4 > UASp::hBLM expression had significantly greater survival than DmBlmN1 mutants without GAL4 expression at 7.5 and 10 Gy. *p < 0.05, **p < 0.01, two-tailed unpaired Student’s t-Test. (B) Both the DmBlmN1 mutant UASp::hBLM males and DmBlmN1 mutant UASp::hBLM males expressing GAL4 showed similar sensitivity to IR (p > 0.05 for all IR doses, two-tailed unpaired Student’s t-Test). Means and standard errors of the mean of four replicates from two different experiments are shown.
hRECQL expression does not rescue DmBlmN1 mutant IR sensitivity
Considering the rescue of DmBlm mutant female IR-sensitivity, and that RECQL is unique to humans (Fig. 1), we wanted to investigate whether there was functional redundancy between RecQ helicases. Evolutionary analysis suggests that RECQL and BLM may share a common ancestor relative to the other RECQ helicases (Supplementary Fig. S1). Thus, we tested whether hRECQL expression could also rescue DmBlmN1 mutant sensitivity to IR. Relative mRNA expression levels of GAL4 > UASp::hRECQL were analyzed in whole flies. Females with both transgenes showed 100-fold increase of hRECQL mRNA expression compared to females with only the UASp::hRECQL transgene (Fig. 5A; 128.4 +/− 26.0 -fold change). Males with both Act5c::GAL4 and UASp::hRECQL transgenes showed statistically significant fold-change differences in hRECQL mRNA expression compared to UASp::hRECQL males (Fig. 5A; 15.8 +/− 1.1-fold change; p < 0.05, two-tailed unpaired Student’s t-Test). hRECQL nuclear localization in Drosophila S2 cells was tested by measuring overlap with nuclear DAPI staining. UASp::hRECQL was transiently transfected into S2 cells with and without Act5c::GAL4 expression vector. hRECQL localized to the nucleus in the presence of GAL4 (Fig. 5B).
Figure 5.
hRECQL expression, localization, and IR sensitivity. (A) Flies with Act5c::GAL4 and UASp::hRECQL transgenes (blue) showed greater hRECQL mRNA expression than baseline levels without the GAL4 > UASp expression (red). Mean fold change and standard errors of the mean are shown. (B) UASp::hRECQL was co-transfected with Act5c::GAL4 in S2 Drosophila cells. Localizing to the nucleus (stained with DAPI) was evident in transfected cells using hRECQL-specific immunofluorescence. Scale bar is 20 µm. (C) DmBlmN1 heterozygotes carrying UASp::hRECQL transgene were crossed to DmBlmN1 heterozygotes carrying the Act5c::GAL4 transgene. Larvae progeny of this cross were exposed to gamma irradiation up to 20 Gy. Survival to adulthood of UASp::hRECQL homozygous DmBlmN1 mutants, relative to survival of all flies, is shown for mutants with (rescue, blue) or without (mutant, red) Act5c::GAL4 (p > 0.05 for all IR doses, two-tailed unpaired Student’s t-Test). Error bars indicate standard errors of the mean from the average survival of three to six replicates from two different experiments.
Drosophila containing UASp::hRECQL with or without Act5c::GAL4 transgenes were irradiated at varying IR doses and survivors were scored. DmBlmN1 mutants with GAL4 > UASp::hRECQL expression did not have a statistically significant difference in relative survival than DmBlmN1 mutants without GAL4 expression (Fig. 5C; p > 0.05 at all doses, two-tailed unpaired Student’s t-Test). This was consistent when analyzing female and male survival (Supplementary Fig. S4).
Discussion
The RecQ helicase family of proteins contain both common and unique roles in maintaining genome stability during replication and recombination3,4. Considering the established roles in the RecQ helicase BLM and sequence similarity within the RecQ helicase domain between species (Supplementary Figs. S1 and S2)24, we investigated whether there was also functional conservation of BLM across species. Strikingly, GAL4 > UASp::hBLM transgenic expression was able to rescue DmBlm mutant hypersensitivity to IR in females despite the expression of hBLM without human RMI1 in this study. Human BLM requires RMI1 to promote BLM-dependent dissolution15 and TOP3α to complete the dHJ dissolution by branch migration in humans33,34. Additionally, germline mutations in both TOP3α and RMI1 result in Bloom Syndrome-like features35. However, while there is a Drosophila ortholog of TOP3α (DmTop3α), there is no identified ortholog of RMI1. DmTop3α contains topoisomerase functions to maintain the genome, including DSB repair via homologous recombination30,36,37. This suggests that DmTop3α may be functioning with hBLM in this context and that the requirement for RMI1 is either specific to human cells, or that a yet-to-be-identified Drosophila ortholog is able to function in the absence of human RMI1 to repair IR-induced damage.
While hBLM was able to rescue IR hypersensitivity in DmBlmN1 mutant females, a rescue in males was not observed. This distinction between sexes is not from a difference in expression levels for males and females of Actin5c, the promoter driving GAL4 expression, or Rpl32, the housekeeping gene used in our qPCR analyses38. A likely explanation for the sex difference in rescue is due to the observation that the UASp sequence results in higher expression in females than in males in the presence of GAL432. Interestingly, the GAL4 > UASp system did not result in differential rescue between sexes with expression of wild-type DmBlm (Supplementary Fig. S3A,B), which is consistent with the similar relative fold-increase in expression of DmBlm in the presence of GAL4 between sexes (Supplementary Fig. S3C). While factors such as integration site of the UASp transgenes could impact expression or mRNA stability, our results indicate that the ability of hBLM to repair IR-induced damage in Drosophila may be dose-dependent. Future studies using UASt or multiple insertions of the UASp::hBLM transgene could test this hypothesis. It is important to note that the GAL4 > UASp system in flies may lead to expression levels that differ from endogenous hBLM expression levels in humans. Thus, our interpretation of our results is that the GAL4 > UASp::hBLM expression can rescue DmBlm mutant sensitivity,
An alternative interpretation of our results is that hBLM and DmBlm function differently such that overexpression of hBLM compensates for the DmBlm mutant defect. This would posit that in DmBlm mutants expressing hBLM, IR-induced damage is repaired by an unknown hBLM-dependent and DmBlm-independent pathway. However, we suggest that it is more likely that there is functional conservation between hBLM and DmBlm based on foundational work with model systems. For example, in the budding yeast Saccharomyces cerevisiae, mutant phenotypes are rescued with galactose-induced overexpression of human orthologs in almost half of the genes analyzed39. Kachroo, et al. found that amino acid similarity above 50% was a strong predictor for functional conservation across many pathways39. Specific to DNA repair, expression of human RAD52, a homologous recombination protein conserved from bacteriophages to humans, rescues homologous recombination defects in S. cerevisiae rad52 mutants40. Similarly, functional conservation between humans and Drosophila has been determined using similar approaches41–43. Considering functional conservation analyses in model systems and the 47% amino acid identity between hBLM and DmBlm24, we suggest that functional conservation is the more likely explanation for the results reported here.
Considering the ability of hBLM to rescue DmBlm mutant IR sensitivity and the presence of a fifth RecQ helicase in humans, we tested whether hRECQL could also rescue DmBlm mutant sensitivity. Phylogenetic analyses suggest that the additional RECQL family member in humans may be due to duplicate gene evolution which resulted in subfunctionalization (Supplementary Fig. S1), where each duplicated gene, BLM and RECQL, retained different subfunctions of the ancestral gene44. To determine if hRECQL maintained functions similar to hBLM, we tested whether hRECQL could rescue DmBlm mutant phenotypes similar to hBLM. However, despite conservation of the RecQ helicase domains of DmBlm and hRECQL (Supplementary Fig. S2B) and 36% identity and 54% similarity across the entire protein sequence24, expression of GAL4 > UASp::hRECQL was not able to rescue DmBlm mutant IR hypersensitivity. This suggests that these two human RecQ helicases do not maintain common functions in repairing IR-induced DNA damage and that RECQL and BLM are indeed a result of gene duplication and subfunctionalization from a common ancestor. This is also supported by the well-characterized, distinct roles of RecQ helicase family during replication and recombination3,4,45,46. Our data and phylogenetic analyses suggest that hBLM most likely maintains the ancestral gene functions observed in DmBlm, whereas hRECQL maintains functions that are distinct from BLM. However, expression levels must be considered, as relative fold change in expression of RECQL in the presence of GAL4 was ~10 times less in males and females compared to hBLM transgenic lines.
In conclusion, RECQL has a unique function in humans that is not conserved in Drosophila Blm. However, our result that GAL4 > UASp::hBLM rescues IR sensitivity of DmBlmN1 null mutant females suggests evolutionary functional conservation of the BLM gene between Drosophila and humans. These findings support the use of Drosophila as a model organism to study Bloom Syndrome due to the functional conservation between cellular pathways. This evolutionary conservation also supports the critical role of BLM in maintaining genome integrity in all cells, thus suggesting why the loss of BLM function in Bloom Syndrome patients results in disease associated with high levels of genome instability.
Materials and Methods
Drosophila stocks and maintenance
Drosophila were maintained on standard Nutri-fly Bloomington Formulation medium (Genesee Scientific) at 25 °C using 12-hour light/dark cycles. The Galactose responsive transcription factor 4 (GAL4) stock contains constitutively and ubiquitously expressed GAL4 driven by Actin 5c promoter (Act5c::GAL4) and was a kind gift from Gary Karpen (UC-Berkeley). The stock containing the DmBlmN1 19 null allele and UASp::DmBlm stock, which expresses DmBlm under the regulation of GAL447 were from Jeff Sekelsky (UNC-Chapel Hill). DmBlmN1 homozygous mutants were derived from two stocks backcrossed by several generations. The Upstream Activation Sequence UASp::hBLM stock and UASp::hRECQL were established in this study.
hBLM expression construct and stock
hBLM cDNA from pCAGGS + hBLM_R12 (R12 clone from Winfried Edelman) was amplified with the primers 5′ ATCAGATCCGCGGCCGCATGGCTGCTGTTCCTCAA (forward) and 5′ CGACTCTAGAGGATCCGGTTTATGAGAATGCATATGAAGGC (reverse) using the CloneAmp HiFi PCR premix according to the manufacturer’s protocol (Clontech). The PCR oligos contained additional NotI (forward) and BamHI (reverse) restriction enzyme sites (underlined) that were used for subcloning. Amplified hBLM coding sequence with NotI/BamHI ends was inserted into a BamHI/NotI linearized, ubiquitously expressed UASp fly expression vector, known as pP{UASp}31, using the Takara In-Fusion cloning kit following the manufacturer’s instructions (Clontech). Plasmid-purified pP{UASp::hBLM} was sent for injection and mapping (BestGene) into D. melanogaster y w mutant stock. Ten w + G1 transformants were selected to establish balanced lines (BestGene). One line inserted in non-repetitive sequences of Chromosome 3 (ideal for downstream recombination with the DmBlmN1 allele) at locus 70B1 in a gene of unknown function, CG10133.
The line that inserted at locus 70B1 was used to establish a recombinant line of UASp::hBLM with the DmBlmN1 allele using standard genetic techniques. Briefly, crosses were set up for recombination of UASp::hBLM and the DmBlmN1 allele to occur within the female germline. Potential recombinant events in the next generation were isolated. To confirm recombination of the DmBlmN1 allele on the UASp::hBLM chromosome, flies were screened for DmBlmN1 using DmBlmN1-specific PCR. Genomic DNA was isolated using Squishing Buffer (10 mM Tris-Cl pH 8.2, 25 mM NaCl) and Proteinase K (10 µg), incubation at 37 °C for 30 minutes, followed by inactivation at 95 °C for five minutes. PCR was performed using SapphireAmp Fast PCR Master Mix (Clontech) and DmBlmN1-specific primers: 5′ TGAAGGGTGGACCGACGGTC (forward) and 5′ GCCAGAATATCCAAGCGGAC (reverse) following the manufacturer’s instructions.
hRECQL expression construct and stock
hRECQL cDNA in pCAGGS + hRECQL was amplified with the primers 5′ ATCAGATCCGCGGCCGCTGTGACCGGCGGCTCTAGA (forward) and 5′ CGACTCTAGAGGATCCATTGCTAGCGGCCGCTCGAG (reverse). Amplified hRECQL was inserted into ubiquitously expressed pP{UASp}31 and integrated into Chromosome 3 (BestGene) as described above for UASp:hBLM. The UASp::hRECQL DmBlmN1 recombinant line was established as described above for UASp::hBLM DmBlmN1.
Ionizing radiation sensitivity assays
IR sensitivity assays were completed as described previously19. Recombinant female DmBlmN1 heterozygotes carrying a UASp::X (DmBlm, hBLM, or hRECQL) transgene were crossed to male DmBlmN1 heterozygotes carrying the Act5c::GAL4 transgene. Drosophila were transferred every 24 h up to three times within each experiment, which served as experimental replicates. Third instar larvae progeny of this cross were exposed to gamma IR at various doses (0, 5, 7.5, 10, 15, or 20 Gy). Average relative survival for each class was calculated [# surviving DmBlmN1 mutants (with or without Act5c::GAL4 and UASp::X)/total number of surviving flies] at each dose. The average survival rate was then normalized to relative survival at 0 Gy. An average of 207 (±6.9 S.E.M) total flies for each sex and each dose for all experiments were counted as the total number of flies surviving to determine relative survival as described above. Average relative survival at each dose was determined from 2–6 experimental replicates. Significance was determined by two-tailed unpaired Student’s t-test between average relative survival of UASp::X DmBlmN1 mutants without Act5c::GAL4 compared to average relative survival of UASp::X DmBlmN1 mutants with Act5c::GAL4 at each IR dose.
qPCR analysis of BLM and RECQL transgenes
For hBLM and hRECQL expression analysis, untreated DmBlmN1 mutant males and females with UASp::X transgene with (rescue) or without (mutant) Act5c::GAL4 from IR sensitivity assays were collected. For DmBlm analysis, untreated wild-type males and females with UASp::DmBlm with or without Act5c::GAL4 were collected. Two flies from the isogenic lines were combined to represent one biological replicate and 1–2 biological replicates per sex and genotype were harvested. mRNA was purified by acid guanidinium thiocyanate-phenol-chloroform extraction with TRIzol (Invitrogen) and RNA Clean and Concentration-5 (Zymo Research). Contaminating DNA was removed by DNA-free rDNase I treatment (Invitrogen). Reverse transcription was performed using Applied Biosystems High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific), and qPCR was completed with the RT2 SYBR Green Master Mix (Qiagen), using RT2 qPCR Primers for D. melanogaster RpL32 (PPD10569B), D. melanogaster Blm (PPD08711A), human RECQL (PPH14762A), and human BLM (PPH02711B) (Qiagen). All qPCR measurements were obtained using the Mic qPCR Cycler and software (Bio Molecular Systems) using technical triplicates for each biological sample. Cq values for each experimental gene were normalized to that of DmRpL32 (Cq) to determine relative expression. ΔΔCq values were calculated relative to flies without Act5c::GAL4 (mutant) to determine relative expression fold change (2-ΔΔCq) in the presence of Act5c::GAL4.
Cell culture, transfection, and immunofluorescence
S2 cells were cultured at 28 °C in Schneider medium supplemented with 10% heat-inactivated fetal bovine serum. Cells were plated at a density of 1.7 × 106 cells per well of a 6-well tissue culture plate containing Poly-L-Lysine coated coverslips. Following a three-hour incubation, cells were then transfected with 2500 ng of appropriate DNA constructs using Cellfectin (Invitrogen) as per the manufacturer’s protocol.
For immunofluorescent labeling, S2 cells were fixed two days post-transfection with 4% formaldehyde in PBS for 15 min. Cells were then permeabilized and blocked with 0.1% Triton X-100, 1% BSA in TBS for 1 hour at room temperature. Coverslips were incubated cell side down overnight in a humidified chamber with polyclonal hBLM antibody (Invitrogen PA5-27384; 1:120 dilution), or hRECQL antibody (Santa Cruz, H-110; 1:500 dilution) in blocking solution. The following day, cells were briefly washed in 1X PBS + 0.1% Tween-20 and then incubated in HRP-conjugated secondary antibody at a 1:500 dilution in blocking solution for one hour in the dark (Alexa Fluor 594 donkey anti-rabbit IgG for hBLM and Alexa Fluor 594 goat anti-rabbit IgG for hRECQL). Post-treatment slides were washed briefly, counterstained with DAPI, and mounted with Vectashield (Vector laboratories) on Superfrost Plus slides (Sigma) and sealed with nail polish. Slides were allowed to dry for 24 hours pre-imaging. Histological negative controls included staining of non-transfected cells as well as cells transfected with only UASp or GAL4 expression vectors individually (data not shown). Images were captured within one week of experimental procedure using a fluorescent confocal ZEISS Axiovert 200 m microscope at 40X (for hBLM) or 63X (for hRECQL) magnification.
Supplementary information
Acknowledgements
This research was supported by the National Institutes of Health grant 1R15GM110454-01 (J.R.L.), and Georgetown Undergraduate Research Opportunities Program (GUROP; P.T., C.M.H., R.L.C.). We would like to thank Dr. Manus Patten and members of the LaRocque lab for thoughtful discussion.
Author contributions
J.R.L., Y.D. and M.B. designed experiments, all authors performed experiments, R.L.C. and J.R.L. wrote the manuscript, and all authors reviewed the manuscript.
Data availability
All data generated or analyzed during this study are included in this published article (and its Supplementary Information Files).
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
is available for this paper at 10.1038/s41598-019-54101-5.
References
- 1.Hakem R. DNA-damage repair; the good, the bad, and the ugly. EMBO J. 2008;27:589–605. doi: 10.1038/emboj.2008.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Marchler-Bauer A, et al. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Croteau DL, Popuri V, Opresko PL, Bohr VA. Human RecQ helicases in DNA repair, recombination, and replication. Annu. Rev. Biochem. 2014;83:519–552. doi: 10.1146/annurev-biochem-060713-035428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Popuri V, et al. The Human RecQ helicases, BLM and RECQ1, display distinct DNA substrate specificities. J Biol. Chem. 2008;283:17766–17776. doi: 10.1074/jbc.M709749200. [DOI] [PubMed] [Google Scholar]
- 5.Fu W, Ligabue A, Rogers KJ, Akey JM, Monnat RJ., Jr. Human RecQ helicase pathogenic variants, population variation and “missing” diseases. Hum. Mutat. 2017;38:193–203. doi: 10.1002/humu.23148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Knoll A, Puchta H. The role of DNA helicases and their interaction partners in genome stability and meiotic recombination in plants. J. Exp. Bot. 2011;62:1565–1579. doi: 10.1093/jxb/erq357. [DOI] [PubMed] [Google Scholar]
- 7.Kusano K, Berres ME, Engels WR. Evolution of the RECQ family of helicases: A Drosophila homolog, DmBlm, is similar to the human bloom syndrome gene. Genetics. 1999;151:1027–1039. doi: 10.1093/genetics/151.3.1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bloom D. Congenital telangiectatic erythema resembling lupus erythematosus in dwarfs; probably a syndrome entity. AMA Am. J. Dis. Child. 1954;88:754–758. [PubMed] [Google Scholar]
- 9.Ellis NA, Sander M, Harris CC, Bohr VA. Bloom’s syndrome workshop focuses on the functional specificities of RecQ helicases. Mech. Ageing Dev. 2008;129:681–691. doi: 10.1016/j.mad.2008.09.005. [DOI] [PubMed] [Google Scholar]
- 10.Nimonkar AV, et al. BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-MRN constitute two DNA end resection machineries for human DNA break repair. Genes Dev. 2011;25:350–362. doi: 10.1101/gad.2003811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gravel S, Chapman JR, Magill C, Jackson SP. DNA helicases Sgs1 and BLM promote DNA double-strand break resection. Genes Dev. 2008;22:2767–72. doi: 10.1101/gad.503108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bugreev DVM, Brosh RM, Jr., Mazin AV. RECQ1 possesses DNA branch migration activity. J. Biol. Chem. 2008;283:20231–20242. doi: 10.1074/jbc.M801582200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Karow JK, Constantinou A, Li JL, West SC, Hickson ID. The Bloom’s syndrome gene product promotes branch migration of Holliday junctions. Proc. Natl. Acad. Sci. USA. 2000;97:6504–6508. doi: 10.1073/pnas.100448097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wu L, Hickson ID. The Bloom’s syndrome helicase suppresses crossing over during homologous recombination. Nature. 2003;426:870–874. doi: 10.1038/nature02253. [DOI] [PubMed] [Google Scholar]
- 15.Wu L, et al. BLAP75/RMI1 promotes the BLM-dependent dissolution of homologous recombination intermediates. Proc. Natl. Acad. Sci. USA. 2006;103:4068–4073. doi: 10.1073/pnas.0508295103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chaganti RS, Schonberg S, German J. A manyfold increase in sister chromatid exchanges in Bloom’s syndrome lymphocytes. Proc. Natl. Acad. Sci. USA. 1974;71:4508–4512. doi: 10.1073/pnas.71.11.4508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.German J, Archibald R, Bloom D. Chromosomal breakage in a rare and probably genetically determined syndrome of man. Science. 1965;148:506–507. doi: 10.1126/science.148.3669.506. [DOI] [PubMed] [Google Scholar]
- 18.Beamish H, et al. Functional link between BLM defective in Bloom’s syndrome and the ataxia-telangiectasia-mutated protein, ATM. J Biol. Chem. 2002;277:30515–30523. doi: 10.1074/jbc.M203801200. [DOI] [PubMed] [Google Scholar]
- 19.McVey M, Andersen SL, Broze Y, Sekelsky J. Multiple functions of Drosophila BLM helicase in maintenance of genome stability. Genetics. 2007;176:1979–1992. doi: 10.1534/genetics.106.070052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bugreev DV, Yu X, Egelman EH, Mazin AV. Novel pro- and anti-recombination activities of the Bloom’s syndrome helicase. Genes Dev. 2007;21:3085–3094. doi: 10.1101/gad.1609007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Adams MD, McVey M, Sekelsky J. Drosophila BLM in double-strand break repair by synthesis-dependent strand annealing. Science. 2003;299:265–267. doi: 10.1126/science.1077198. [DOI] [PubMed] [Google Scholar]
- 22.McVey M, LaRocque JR, Adams MD, Sekelsky JJ. Formation of deletions during double-strand break repair in Drosophila DmBlm mutants occurs after strand invasion. Proc. Natl. Acad. Sci. USA. 2004;101:15694–15699. doi: 10.1073/pnas.0406157101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16:10881–10890. doi: 10.1093/nar/16.22.10881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hu Y, et al. An integrative approach to ortholog prediction for disease-focused and other functional studies. BMC Bioinformatics. 2011;12:357. doi: 10.1186/1471-2105-12-357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Phelps CB, Brand AH. Ectopic gene expression in Drosophila using GAL4 system. Methods. 1998;14:367–379. doi: 10.1006/meth.1998.0592. [DOI] [PubMed] [Google Scholar]
- 26.Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–415. doi: 10.1242/dev.118.2.401. [DOI] [PubMed] [Google Scholar]
- 27.McVey M, Adams MD, Staeva-Vieira E, Sekelsky J. Evidence for multiple cycles of strand invasion during repair of double-strand gaps in Drosophila. Genetics. 2004;167:699–705. doi: 10.1534/genetics.103.025411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ertl HA, et al. The role of Blm helicase in homologous recombination, gene conversion tract length, and recombination between diverged sequences in Drosophila melanogaster. Genetics. 2017;207:923–933. doi: 10.1534/genetics.117.300285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Hatkevich T, et al. Bloom syndrome helicase promotes meiotic crossover patterning and homolog disjunction. Curr. Biol. 2017;27:96–102. doi: 10.1016/j.cub.2016.10.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Johnson-Schlitz D, Engels WR. Template disruptions and failure of double Holliday junction dissolution during double-strand break repair in Drosophila BLM mutants. Proc. Natl. Acad. Sci. USA. 2006;103:16840–16845. doi: 10.1073/pnas.0607904103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rorth P. Gal4 in the Drosophila female germline. Mech. Dev. 1998;78:113–118. doi: 10.1016/S0925-4773(98)00157-9. [DOI] [PubMed] [Google Scholar]
- 32.DeLuca SZ, Spradling AC. Efficient expression of genes in the Drosophila germline using a UAS promoter free of interference by Hsp70 piRNAs. Genetics. 2018;209:381–387. doi: 10.1534/genetics.118.300874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Johnson FB, et al. Association of the Bloom syndrome protein with topoisomerase IIIalpha in somatic and meiotic cells. Cancer Res. 2000;60:1162–1167. [PubMed] [Google Scholar]
- 34.Wu L, et al. The Bloom’s syndrome gene product interacts with topoisomerase III. J. Biol. Chem. 2000;275:9636–9644. doi: 10.1074/jbc.275.13.9636. [DOI] [PubMed] [Google Scholar]
- 35.Martin CA, et al. Mutations in TOP3A cause a Bloom syndrome-like disorder. Am. J. Hum. Genet. 2018;103:221–231. doi: 10.1016/j.ajhg.2018.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Plank JL, Chu SH, Pohlhaus JR, Wilson-Sali T, Hsieh TS. Drosophila melanogaster topoisomerase IIIalpha preferentially relaxes a positively or negatively supercoiled bubble substrate and is essential during development. J. Biol. Chem. 2005;280:3564–3573. doi: 10.1074/jbc.M411337200. [DOI] [PubMed] [Google Scholar]
- 37.Chen SH, Wu CH, Plank JL, Hsieh TS. Essential functions of C terminus of Drosophila topoisomerase IIIalpha in double Holliday junction dissolution. J. Biol. Chem. 2012;287:19346–19353. doi: 10.1074/jbc.M112.363044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Graveley BR, et al. The developmental transcriptome of Drosophila melanogaster. Nature. 2011;471:473–479. doi: 10.1038/nature09715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kachroo AH, et al. Systematic humanization of yeast genes reveals conserved functions and genetic modularity. Science. 2015;348:921–925. doi: 10.1126/science.aaa0769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Manthey GM, Clear AD, Liddell LC, Negritto MC, Bailis AM. Homologous recombination in budding yeast expressing the human RAD52 gene reveals a Rad51-independent mechanism of conservative double-strand break repair. Nucleic Acids Res. 2017;45:1879–1888. doi: 10.1093/nar/gkw1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bellen HJ, Yamamoto S. Morgan’s legacy: fruit flies and the functional annotation of conserved genes. Cell. 2015;163:12–14. doi: 10.1016/j.cell.2015.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wangler MF, Yamamoto S, Bellen HJ. Fruit flies in biomedical research. Genetics. 2015;199:639–653. doi: 10.1534/genetics.114.171785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ugur B, Chen K, Bellen HJ. Drosophila tools and assays for the study of human diseases. Dis. Models Mech. 2016;9:235–244. doi: 10.1242/dmm.023762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Lynch M, Conery JS. The evolutionary fate and consequences of duplicate genes. Science. 2000;290:1151–1155. doi: 10.1126/science.290.5494.1151. [DOI] [PubMed] [Google Scholar]
- 45.Urban V, Dobrovolna J, Janscak P. Distinct functions of human RecQ helicases during DNA replication. Biophys. Chem. 2017;225:20–26. doi: 10.1016/j.bpc.2016.11.005. [DOI] [PubMed] [Google Scholar]
- 46.Sharma S, Phatak P, Stortchevoi A, Jasin M, LaRocque JR. RECQ1 plays a distinct role in cellular response to oxidative DNA damage. DNA Repair (Amst) 2012;11:537–549. doi: 10.1016/j.dnarep.2012.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kohl KP, Jones CD, Sekelsky J. Evolution of an MCM complex in flies that promotes meiotic crossovers by blocking BLM helicase. Science. 2012;338:1363–1365. doi: 10.1126/science.1228190. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analyzed during this study are included in this published article (and its Supplementary Information Files).



