Skip to main content
American Journal of Physiology - Heart and Circulatory Physiology logoLink to American Journal of Physiology - Heart and Circulatory Physiology
. 2019 Oct 18;317(5):H1116–H1124. doi: 10.1152/ajpheart.00153.2019

Deletion of the microRNA-degrading nuclease, translin/trax, prevents pathogenic vascular stiffness

Eric Tuday 1,*, Yohei Nomura 2,*, Deepa Ruhela 3, Mitsunori Nakano 2, Xiuping Fu 4, Aparna Shah 4, Barbara Roman 3, Atsushi Yamaguchi 6, Steven S An 7,8, Charles Steenbergen 3, Jay M Baraban 4, Dan E Berkowitz 9, Samarjit Das 3,5,
PMCID: PMC6879913  PMID: 31625778

Abstract

Vascular stiffness plays a key role in the pathogenesis of hypertension. Recent studies indicate that the age-associated reduction in miR-181b levels in vascular smooth muscle cells (VSMCs) contributes to increased vascular stiffness. As these findings suggest that inhibiting degradation of miR-181b might prevent vascular stiffening, we have assessed whether the microRNA-degrading translin/trax (TN/TX) complex mediates degradation of miR-181b in the aorta.We found that TN−/− mice display elevated levels of miR-181b expression in the aorta. Therefore, we tested whether TN deletion prevents vascular stiffening in a mouse model of hypertension, induced by chronic high-salt intake (4%NaCl in drinking water for 3 wk; HSW). TN−/− mice subjected to HSW stress do not show increased vascular stiffness, as monitored by pulse wave velocity and tensile testing. The protective effect of TN deletion in the HSW paradigm appears to be mediated by its ability to increase miR-181b in the aorta since HSW decreases levels of miR-181b in WT mice, but not in TN KO mice. We demonstrate for the first time that interfering with microRNA degradation can have a beneficial impact on the vascular system and identify the microRNA-degrading TN/TX RNase complex as a potential therapeutic target in combatting vascular stiffness.

NEW & NOTEWORTHY While the biogenesis and mechanism of action of mature microRNA are well understood, much less is known about the regulation of microRNA via degradation. Recent studies have identified the protein complex, translin(TN)/trax(TX), as a microRNA-degrading enzyme. Here, we demonstrate that TN/TX is expressed in vascular smooth muscle cells. Additionally, deletion of the TN/TX complex selectively increases aortic miR-181b and prevents increased vascular stiffness caused by ingestion of high-salt water. To our knowledge, this is first report describing the role of a microRNA RNAse in cardiovascular biology or pathobiology.

Keywords: hypertension; miR-181b; miRNA-degradation, translin/trax complex, vascular stiffness

INTRODUCTION

Hypertension presents a major worldwide public health concern because of its high prevalence and the fact that it drives the progression of cardiovascular disease (CVD). Increased aortic stiffness is now recognized as playing a key role in the pathophysiology of isolated arterial hypertension (22, 30) and in the development of atherosclerosis (20). Furthermore, vascular stiffness is an independent predictor of cardiovascular events, such as cardiovascular death, heart failure, and stroke (3, 23, 27, 29) and is also associated with other known CVD risk factors (31). Therefore, interventions aimed at halting the progression of, and possibly reversing, arterial stiffness are under investigation as a new strategy for treating systolic hypertension (1, 7, 33, 35, 43).

Recent advances have focused attention on the role of the microRNA system in regulating vascular smooth muscle function and the pathophysiology of hypertension (4, 6, 8, 21, 41). In particular, miR-765 (24), miR-1185 (9), miR-181b (18), and miR-21 (32) have been shown to regulate vascular stiffness. Furthermore, recent studies indicate that elevated levels of miR-181b might exert beneficial effects on vascular health by reducing vascular inflammation and inhibiting thrombin-mediated endothelial activation and arterial thrombosis (25, 40).

To better understand how miRNA signaling pathways regulate arterial stiffness, we have investigated the impact of manipulating miR-181b levels, one of the most abundant miRNAs in the aorta, on aortic stiffness (18). These studies demonstrated that expression of miR-181b, but not miR-181a, in the aorta decreases with age, suggesting that this drop may contribute to age-related development of increased aortic stiffness (18). Furthermore, selective deletion of the miR-181a/b-1 locus, which causes near complete loss of miR-181a/b expression in aorta, produces age-related elevation in aortic stiffness that is accompanied by heightened activation of the TGF-β pathway and ultimately increased deposition of collagen in the extracellular matrix (ECM) (18). Thus, taken together, these findings suggest that 1) decreased levels of miR-181b in the aorta play a pivotal role in age-related increases in aortic stiffness and 2) strategies designed to increase miR-181b levels, such as inhibiting its degradation, may combat this process.

The translin/trax (TN/TX) RNase complex is one of three pathways identified to date that mediate degradation of pre-miRNAs (5), with each thought to target different subpopulations of microRNAs. For example, the Lin28 pathway, the best characterized of these microRNA degradation pathways, targets the let-7 family of pre-miRNAs for degradation by binding to a consensus motif located in their loop region. In contrast, the substrate specificity of the TN/TX complex is still poorly defined, however, the available evidence indicates that it targets a pattern of mismatches in the stem of pre-miRNAs (14). To help identify candidate miRNA targets of the TN/TX complex, Asada et al. (25) examined the microRNA profiles of multiple tissues from TN KO mice, as well as several cell lines engineered to have reduced expression of TN/TX. They found that knockdown of TN/TX in sarcoma cells increased levels of a small subset of microRNAs that includes miR-181b, suggesting that its degradation is mediated by TN/TX. The RNase activity of the TN/TX complex is completely dependent on formation of a heteromeric complex containing both TN and TX (26). Therefore, we have proceeded to examine whether TN KO mice, which lack the TN/TX complex, display increased levels of miR-181b in the aorta and, if so, whether these mice display resistance to development of aortic stiffness.

To study the role of miR-181b in the development of vascular stiffness, we elected to use a model of accelerated vascular stiffening through the consumption of a high-salt diet. Chronic high-salt intake has been shown to induce hypertension (13, 16, 28) and is associated with elevated levels of TGF-β (34), oxidative stress, endothelial dysfunction, and vascular stiffness (10, 11, 44).

METHODS

Animals.

We used 12–16-wk-old male wild-type (WT) and TN−/− mice littermates that were generated by breeding TN+/− mice taken from a colony established at Johns Hopkins from the line generated in Dr. M. Kasai’s laboratory (15). These mice had been backcrossed to C57BL6 for over 10 generations. Genotyping of mice was performed on DNA isolated from tail snips using real-time PCR conducted by Transnetyx (Cordova, TN). For experiments that involved only WT mice, we used 12–16-wk-old male C57BL6/j mice as WT from Jackson Laboratories.

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Johns Hopkins University.

High-salt water preparation protocol.

Sodium chloride water (17, 42) (4.0% ; high-salt water: HSW) was provided for 3 wk for the HSW group, while normal drinking water (NW) was supplied for the same duration for comparison groups.

RNA isolation and qPCR.

Total RNA and miRNA-enriched fractions were isolated from aortic tissue using RNeasy and miRNeasy kits, respectively (Qiagen, Valencia, CA), per manufacturer’s instructions. To avoid genomic DNA contamination, DNase digestion was performed using RNase free DNase kit (Qiagen, Valencia, CA), per manufacturer’s instruction.

To characterize the integrity of the isolated RNA, spectrophotometric evaluation was performed using Nanodrop (Thermo Scientific, Wilmington, DE). Only RNA samples with an A260 (absorbance at 260 nm) value greater than 1.80 were used for further experiments. The ratio of the readings at 260 nm and 280 nm (A260/A280) was also measured to check the purity of the isolated RNA. For further and more accurate purity and integrity estimation of the isolated RNA, samples were profiled by the Bioanalyzer 2100 (Agilent Technologies). Only high-quality RNA, A260/A280 ~2.00 and RIN >8, was used for these experiments.

For samples that passed these tests of purity and integrity, the RNA was reverse transcribed using miScript Reverse Transcription Kit (Qiagen, CA). For mRNA we used HiFlex and for miRNA we used HiSpec buffers, respectively. PCR was performed using a miScript SYBR green PCR kit (Qiagen, Valencia, CA) and detected with a CFX96 detector (Bio-Rad). All reactions were performed in triplicate. Quantitative PCR (qPCR) was performed with primers for miR-181a, miR-181b, let-7a, miR-126-3p, and pre-miR-181b (Qiagen, CA). Additionally, qPCR was performed for Translin (TN) and Trax (TX) from the mRNA fraction of cDNAs. The primer sequences used for qPCR analysis of TN and TX mRNAs are shown in Table 1.

Table 1.

Primer sequences used for qPCR analysis of TN and TX mRNAs

Forward Primer (5′-3′) Reverse Primer (5′-3′)
TN TGGTCTTCCTGGCAGCATTT AGAAATGTGAAGGGGCCGAG
TX GCCAAAGTGGAGAACGCTTG AAATGCGCGGGAGTGTAAGA

qPCR, quantitative PCR; TN, translin; TX, trax.

miRNA sequencing.

High-quality RNA samples (based on Bioanalyzer analysis) were used to prepare the library using the QIAseq miRNA Library kit (Qiagen, Valencia, CA), as per the company’s instructions. The presequencing QC of the library was evaluated by both Qubit (ThermoFisher) and Bioanalyzer assays using an Ultrasensitive chip. The library was then cataloged by adding an index code. The NextSeq platform was used to run the samples. Primary and secondary data analyses were performed using NGS data analysis software at qiagen.com/GeneGlobe.

Noninvasive pulse wave velocity measurements.

A high-frequency, high-resolution Doppler spectrum analyzer (DSPW, Indus Instruments) was used under anesthesia (19, 36).

Noninvasive blood pressure measurement.

Blood pressures (BP) were measured with the tail-cuff noninvasive BP measurement system using volume pressure recording sensors (CODA, Kent Scientific).

Tensile testing.

Thoracic aortas were harvested and cut into 2-mm rings. The aortic ring and a 0.5-mm segment proximal to each ring were imaged at ×10 magnification to measure inner diameters (Di), outer diameters (Do), and the vessel length (L). The diameter and the length were measured with Image J software (National Institutes of Health). The 2-mm aortic rings were mounted onto the pins of an electromechanical puller (DMT560; Danish Myo Technology, Aarhus, Denmark). After calibration and alignment, the pins were slowly moved apart using an electromotor at a rate of 20 μm/s to apply radial stress on the specimen until breakage. Displacement and force were recorded continuously. Engineering stress (S) was calculated by normalizing force (F) to the initial stress-free area of the specimen (S = F/2t × L; where t = thickness and L = length of the sample). Engineering strain (λ) was calculated as the ratio of displacement to the initial stress-free diameter (Di) (39).

TGF-β1 measurement.

TGF-β1 ELISA kit (R&D Systems, Minneapolis, MN) was used to detect TGF-β1 from mice serum as directed by the manufacturer's instructions.

Digital image analysis.

Histologic specimens were collected from various experimental conditions, fixed, and processed by our histology core laboratory. Slides were obtained and stained via Masson trichrome methods. The slides were then digitized on an Aperio AT system (Leica Biosystems, Nussloch, Germany). With the use of Aperio ImageScope tools, the collagen percent staining and media area were then measured.

Western blot analysis.

Protein (35 μg) was resolved by SDS-PAGE and electrotransferred to polyvinylidene fluoride (PVDF) membranes for Western blot analysis. Antibodies that recognize TN (1:6,000) and TX (1:6,000) were generated as previously described (12). Immunoreactive proteins were visualized using an enhanced chemiluminescence analysis kit (EMD Millipore, Billerica, MA)

Statistical analysis.

The results are presented as means ± SE. For multiple comparisons, one-way or two-way analysis of variance (ANOVA) and the Bonferroni or Holm-Sidak post hoc tests were used. P < 0.05 was considered statistically significant. All analyses were performed using Prism 8 (GraphPad Software) or SigmaStat (San Jose, CA).

RESULTS

TN/TX complex downregulates miR-181b in the aorta.

TN and TX expression profiles in the aorta were evaluated by performing qPCR on RNA isolated from intact or endothelium-denuded aortas. Both TN and TX showed equal expression in intact and denuded aortas (Fig. 1A). This pattern indicates that TN and TX are expressed in vascular smooth muscle and may also be expressed in vascular endothelial cells.

Fig. 1.

Fig. 1.

Translin/trax (TN/TX) complex downregulates miR-181b in the aortic vascular smooth muscle cells (VSMCs). A: quantitative PCR (SYBR) analysis of TN and TX mRNAs in total RNA isolated from intact and denuded aortas. TN and TX expression was normalized to GAPDH. Vascular endothelial (VE)-cadherin expression was measured as a positive control of the denuded aorta. The means of the values obtained from intact tissue were set to 1.0; mean values obtained from denuded tissue are presented as the fold change relative to intact tissue. B: Scatterplot was generated by comparing TN knockout (TN−/−) aorta miRNA-sequencing data with wild-type (WT) littermate aorta data. C: reads per million (RPM) values were calculated from the miRNA-sequencing data from aorta samples from WT and TN−/− mice. The graph presents RPM valuses for the 15 most abundant miRNAs in aorta. D: RPM values were calculated from the RNA-sequencing data from aorta samples from WT and TN−/− mice (n = 3). qPCR analysis of pre-miR-181b (E) and miR-181b (F) expression in total RNA from the aortas of WT and TN−/− mice (n = 4 or 5). miRNA expression was normalized to SNORD61 and then normalized to WT expression. Values shown in all panels are means ± SE; *P < 0.05 and ***P < 0.001.

To gauge the impact of TN deletion on miRNA expression in aorta, we performed RNA-Seq to compare the miRNA profiles of aorta samples harvested from WT and TN−/− mice. Several miRNAs were identified as candidates that may be upregulated in the TN−/− aorta (Fig. 1B). Of the 15 most abundant miRNAs in the aorta, only two, miR-181a and miR-181b (Fig. 1D), showed increased levels in TN−/− aorta in this screen (Fig. 1C). To validate the RNA-Seq results indicating that TN deletion increases miR-181b in the aorta, we measured levels of both pre-miR-181b and miR-181b by qPCR. Consistent with the view that TN/TX targets pre-miRs, we found that both these species are elevated (Fig. 1, E and F). Taken together, these data support our hypothesis that the TN/TX microRNA-degrading enzyme targets miR-181b with a high degree of selectivity in the aorta.

High-salt water increases vascular stiffness and reduces miR-181b levels: blockade by TN deletion.

Based on these findings, we wanted to assess whether deletion of TN, which abolishes expression of the TN/TX complex, would block development of arterial stiffness. We chose to test this hypothesis using a well-established model of hypertension that is associated with increased arterial stiffness, ingestion of high-salt water (HSW) (13, 16, 28). First, we confirmed that this paradigm elicits increased arterial stiffness in WT mice by comparing their responses to NW and HSW. We monitored PWV in the descending aorta, as well as systolic blood pressure, under baseline conditions and then weekly after switching the mice to HSW (Fig. 2, A and B). Furthermore, tensile testing of the descending aorta performed ex vivo after 3 wk of HSW treatment confirmed that HSW elicits a leftward shift in the stress-strain relationship of the WT mice placed on HSW (Fig. 2, C and D). Then, we compared the response of WT and TN−/− mice to HSW. While WT mice displayed a marked increase in PWV at 2 and 3 wk, TN−/− mice did not (Fig. 3A). As found for WT mice, HSW also induces an increase in systolic blood pressure in TN−/− mice (Fig. 3B), Furthermore, tensile testing confirmed that TN−/− mice are protected from developing vascular stiffness induced by HSW (Fig. 3C).

Fig. 2.

Fig. 2.

High-salt water (HSW) stress increases vascular stiffness. A: pulse wave velocity (PWV) was measured weekly in wild-type (WT) mice given normal water (NW) or HSW (n = 6). Data presented in A were analyzed by 2-way ANOVA with repeated measures, which showed significant effects of treatment (P < 0.0001) and time (P < 0.01), as well as a significant interaction between these variables (P < 0.01). Post hoc Bonferroni’s test showed significant differences at time points denoted by ****P < 0.0001 B: tail-cuff based measurement of systolic blood pressure after 3 wk of HSW (n = 13) and NW (n = 8). Tensile testing was performed on thoracic aortas that were either intact (C) or decellularized (D) from WT animals given NW or HSW (n = 5–6 mice with 3 to 4 aortic rings per mouse). The curved line plots the mean values at each value of strain. SE is presented as dots located above and below the curve. Data were analyzed by 2-way ANOVA with repeated measures. Analysis of data presented in C showed significant effects of treatment (P < 0.02) and strain (P < 0.0001), as well as a significant interaction between these variables (P < 0.0001). Similarly, analysis of data presented in D showed significant effects of treatment (P < 0.05) and strain (P < 0.0001), as well as a significant interaction between these variables (P < 0.0001). Post hoc testing by t-test at a strain of 2.5 showed P < 0.01 for C and P < 0.05 for D as shown in bar graph inserts. Values shown are means ± SE; *P < 0.05, **P < 0.01 and ****P < 0.0001.

Fig. 3.

Fig. 3.

Translin (TN) deletion blocks increase in vascular stiffness and decrease in miR-181b expression produced by high-salt water (HSW) stress. A: weekly pulse wave velocity (PWV) measurements comparing responses of TN knockout (TN−/−) and control [wild-type (WT)] (n = 8) mice treated with HSW. Analysis of data presented in A showed significant effects of genotype (P < 0.05) and time (P < 0.01), as well as a significant interaction between these variables (P < 0.05). Post hoc Bonferroni’s test showed significant differences at time points denoted by *P < 0.05. B: tailoremetric measurement of systolic blood pressure after 3 wk of normal water (NW) and HSW in TN−/− mice C: tensile testing was performed on the thoracic aorta from WT and TN−/− mice treated with HSW (n = 6 animals with 3 to 4 aortic rings per animal). Data were analyzed by 2-way ANOVA with repeated measures, which showed significant effects of genotype (P < 0.02) and strain (P < 0.0001), as well as a significant interaction between these variables (P < 0.0001). Post hoc testing by t-test at a strain of 2.5 showed P < 0.02. Quantitative PCR data examining pre-miR-181b (D) and miR-181b (E) expression in total RNA from aortas of WT or TN−/− mice treated with NW or HSW (n = 3). Pre- or mature miR-181b expression was normalized to SNORD61 and then to the WT NW group. F: Let-7a and miR-126-3p in total RNA normalized to SNORD61 from aortas of WT mice treated with NW or HSW (n = 3). Values are means ± SE. *P < 0.05, ***P < .001, #P < 0.01 WT + HSW vs. TN−/− + HSW.

To assess whether the protective effect of TN deletion may be mediated by its ability to elevate levels of miR-181b, we investigated if HSW affects miR-181b levels. Analysis of aortic tissue harvested from WT mice exposed to HSW displayed decreased levels of both pre-miR-181b and mature miR-181b relative to a parallel cohort of mice with access to NW (Fig. 3, D and E). Furthermore, TN deletion normalized miR-181b levels in mice subjected to HSW stress. To determine if HSW exposure produces a widespread decrease in miRNA levels, we measured HSW exposure impact on levels of two other highly abundant miRNAs in aorta, let-7a and miR-126-3p, and found they are unaffected (Fig. 3F).

In previous studies (19), we found that deletion of miR-181b leads to increased aortic stiffness that is accompanied by heightened activation of the TGF-β pathway and increased deposition of collagen in the ECM. Accordingly, we proceeded to check if translin deletion blocked these changes induced by HSW. To this end, we compared the effect of HSW on TGF-β1 levels in WT and TN−/− mice (Fig. 4A) and found a significant effect of genotype (P = 0.004), as well as a significant interaction between genotype and treatment (P = 0.005). As TGF-β1 is known to induce ECM proliferation, we performed histological analysis of aorta samples (Fig. 4B). Collagen staining and media thickness (Fig. 4, C and 4D) are significantly increased in WT mice exposed to HSW. In contrast, TN−/− mice exposed to HSW do not exhibit similar changes.

Fig. 4.

Fig. 4.

High-salt water (HSW) effects on serum TGF-β1 and aortic wall collagen content and media area. A: serum TGF-β1 levels in wild-type (WT) and translin knockout (TN−/−) mice when exposed to normal water (NW) and HSW (n = 6–8). Because of unequal variance across these groups, the data were rank transformed and then analyzed by 2-way ANOVA using the general linear model. Post hoc testing using the Holm-Sidak method showed a significant difference between the WT + HSW and TN−/− + HSW groups (P < 0.001). B and C: Masson trichrome staining. Collagen content of aortic rings expressed as a percentage of total ring area in WT and TN−/− exposed to NW and HSW. D: aortic media area in WT and TN−/− mice exposed to NW or HSW. Values are means ± SE. *P < 0.05, ***P < .001.

Lastly, to explore the possibility that HSW increases degradation of pre-miR-181b by upregulating TN/TX, we monitored mRNA levels of TN and TX by qPCR (Fig. 5, A and B). While TN mRNA levels are unchanged, TX mRNA levels are elevated. Furthermore, we confirmed that TX protein levels are increased as well (Fig. 5C). As TN can form either homomeric complexes, which do not possess RNase activity, or heteromeric complexes with TX, which do (26), increased expression of TX could boost TN/TX RNase activity and, thereby, decrease levels of miR-181b in the aorta.

Fig. 5.

Fig. 5.

High-salt water (HSW) upregulates trax (TX) expression. Quantitative PCR data examining TN (A) and TX mRNA (B) levels in wild-type (WT) mouse aorta with normal water (NW) or HSW (n = 3). The expression data were normalized to β-actin. C: Western blot analysis of TN and TX expression in aortic tissue from WT mice given access to NW or HSW (n = 3). TN and TX expression was normalized to α-tubulin. C, right: quantification of band intensities. Values are means ± SE. *P < 0.05.

DISCUSSION

The ability of TN deletion to confer robust protection in the HSW paradigm has two important implications. From the perspective of identifying novel strategies to combat hypertension and vascular stiffness, these results focus attention on TN/TX as a candidate therapeutic target. Asada et al. (5) used recombinant TN/TX to screen a chemical library and identified lead compounds that inhibit TN/TX RNase activity in vitro but do not inhibit Dicer, providing initial evidence of selectivity. Thus, that report demonstrates that the TN/TX RNase complex is a “druggable” target. The findings from this study identify a paradigm useful for testing the efficacy of TN/TX RNase inhibitors in vivo. From the broader perspective of developing strategies to treat disorders thought to be due to decreased levels of selected miRNAs, these findings provide proof of principle that targeting miRNA-degrading pathways can be effective. To date, three miRNA degradation pathways have been identified, with each thought to target a relatively small subset of miRNAs (14). Consistent with this view, miRNA profiling of aortic tissue from WT and TN−/− mice, reported herein, indicates that suppressing the TN/TX miRNA-degradation pathway elicits increases limited to a relatively small subpopulation of miRNAs. Thus, the presence of multiple miRNA-degrading pathways with restricted substrate specificities suggests that targeting individual pathways may be a useful strategy for eliciting selective increases in small cohorts of miRNAs. Furthermore, this line of reasoning implies that identification of additional miRNA-degrading pathways may yield novel therapeutic targets.

To our knowledge, this is the first study examining the regulation or function of TN/TX in cardiovascular diseases. Several lines of evidence indicate that the protective effects of TN deletion in the HSW paradigm reflect its ability to block degradation of miR-181b. First, miR-181b levels are decreased by HSW. Second, previous studies have provided compelling evidence that decreased levels of miR-181b contribute to increased vascular stiffness by extracellular matrix (ECM) remodeling as the lack of miR-181b allows for the overexpression of TGF-βi (inducible by TGB-β), which activates the TGF-β1 signaling cascade. Activation of TGF-β1 increases collagen deposition and increases ECM cross-linking (18). Our findings in this study are consistent with this model, as the TN−/− animals exposed to HSW had stable levels of TGF-β1 and did not exhibit vascular remodeling that would be consistent with increased vascular stiffness. Third, our studies indicate that TN deletion increases miR-181b levels selectively. However, further studies are needed to confirm whether other miRNAs elevated by TN deletion may also contribute to its protective effects. In addition, it will also be important to investigate whether the protective effects of TN deletion are restricted to models of hypertension that elicit reductions in miR-181b levels or not.

One possible interpretation of our findings is that the detrimental effects of HSW on vascular stiffness may be due to its activation of TN/TX and subsequent degradation of miR-181b and/or other target miRNAs (Fig. 6). This working model is supported by three observations: 1) HSW increases expression of TX, 2) TN deletion robustly blocks the ability of HSW to increase vascular stiffness, and 3) TN deletion blocks the decline in miR-181b levels triggered by HSW.

Fig. 6.

Fig. 6.

Working model of vascular stiffness regulation by miR-181b and translin/trax (TN/TX) complex. Left: chronic exposure of wild-type mice to high-salt water (HSW) leads to increased vascular stiffness. This treatment elicits decreased levels of pre-miR-181b and mature miR-181b, suggesting that increased activity of TN/TX RNase mediates degradation of pre-miR-181b and/or mature miR-181b. Consistent with this model, chronic HSW treatment does not elevate aortic stiffness in TN knockout (TN KO) mice, which display elevated levels of pre-miR-181b and miR-181b (right). Absence of TN/TX in TN KO mice is indicated by an oval containing gray diagonal stripes.

Recent studies suggest that the activity of TN/TX may be regulated via its interaction with PLC-β1 (2). Thus, it is tempting to speculate that persistent activation of Gq by heightened levels of vasopressin (AVP) and other endogenous pressors elicited by HSW could lead to activation of TN/TX activity by triggering dissociation of PLC-β1 from TN/TX, which then binds to activated Gq. It has been suggested that increased vascular stiffness represents an adaptive response by vessels subjected to chronic increases in tone (37, 38). Thus, we propose that heightened activation of TN/TX secondary to persistent stimulation of Gq may represent a key signaling pathway that mediates this adaptive, but deleterious, response. Accordingly, further studies are warranted to examine the proposed link between Gq/ PLC-β signaling and regulation of TN/TX activity.

In summary, these studies demonstrate, for the first time, that selectively interfering with microRNA degradation can have a beneficial impact on the vascular system and identify the microRNA-degrading TN/TX complex as a potential therapeutic target in combatting vascular stiffness.

GRANTS

This work was supported by American Heart Association Grant 14SDG18890049; Maryland Stem Cell Research Fund Grant Mscrfd-4313 (to S. Das); National Institutes of Health Grants 5-R01-HL-039752 (to C. Steenbergen), T32-HL007227-42 (to E. Tuday), and DA-00266; Johns Hopkins Synergy Award (to J. M. Baraban); Magic That Matters (to E. Tuday, J. M. Baraban, and S. Das); and Stimulating and Advancing Anesthesiology & Critical Care Medicine Research (to D. Ruhela, and S. Das).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Y.N., D.R., X.F., A.S., B.R., S.S.A., C.S., J.M.B., D.E.B., and SD conceived and designed research; E.T., Y.N., D.R., M.N., X.F., A.S., and B.R. performed experiments; E.T., Y.N., D.R., M.N., X.F., A.S., and B.R. analyzed data; E.T., Y.N., D.R., M.N., X.F., A.S., B.R., S.S.A., J.M.B., D.E.B., and SD interpreted results of experiments; E.T., Y.N., D.R., X.F., and SD prepared figures; E.T., Y.N., X.F., A.S., C.S., J.M.B., D.E.B., and SD drafted manuscript; E.T., Y.N., A.Y., S.S.A., C.S., J.M.B., D.E.B., and SD edited and revised manuscript; E.T., Y.N., D.R., X.F., A.S., A.Y., S.S.A., C.S., J.M.B., D.E.B., and SD approved final version of manuscript.

REFERENCES

  • 1.Agabiti-Rosei E, Porteri E, Rizzoni D. Arterial stiffness, hypertension, and rational use of nebivolol. Vasc Health Risk Manag 5: 353–360, 2009. doi: 10.2147/VHRM.S3056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Aisiku OR, Runnels LW, Scarlata S. Identification of a novel binding partner of phospholipase cβ1: translin-associated factor X. PLoS One 5: e15001, 2010. doi: 10.1371/journal.pone.0015001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Aisu H, Saito M, Inaba S, Morofuji T, Takahashi K, Sumimoto T, Okura T, Higaki J. Association of worsening arterial stiffness with incident heart failure in asymptomatic patients with cardiovascular risk factors. Hypertens Res 40: 173–180, 2017. doi: 10.1038/hr.2016.116. [DOI] [PubMed] [Google Scholar]
  • 4.Albinsson S, Suarez Y, Skoura A, Offermanns S, Miano JM, Sessa WC. MicroRNAs are necessary for vascular smooth muscle growth, differentiation, and function. Arterioscler Thromb Vasc Biol 30: 1118–1126, 2010. doi: 10.1161/ATVBAHA.109.200873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Asada K, Canestrari E, Fu X, Li Z, Makowski E, Wu YC, Mito JK, Kirsch DG, Baraban J, Paroo Z. Rescuing dicer defects via inhibition of an anti-dicing nuclease. Cell Rep 9: 1471–1481, 2014. doi: 10.1016/j.celrep.2014.10.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bhattachariya A, Dahan D, Turczyńska KM, Swärd K, Hellstrand P, Albinsson S. Expression of microRNAs is essential for arterial myogenic tone and pressure-induced activation of the PI3-kinase/Akt pathway. Cardiovasc Res 101: 288–296, 2014. doi: 10.1093/cvr/cvt253. [DOI] [PubMed] [Google Scholar]
  • 7.Boutouyrie P, Lacolley P, Briet M, Regnault V, Stanton A, Laurent S, Mahmud A. Pharmacological modulation of arterial stiffness. Drugs 71: 1689–1701, 2011. doi: 10.2165/11593790-000000000-00000. [DOI] [PubMed] [Google Scholar]
  • 8.Carr G, Barrese V, Stott JB, Povstyan OV, Jepps TA, Figueiredo HB, Zheng D, Jamshidi Y, Greenwood IA. MicroRNA-153 targeting of KCNQ4 contributes to vascular dysfunction in hypertension. Cardiovasc Res 112: 581–589, 2016. doi: 10.1093/cvr/cvw177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Deng H, Song Z, Xu H, Deng X, Zhang Q, Chen H, Wang Y, Qin Y, Li Y. MicroRNA-1185 Promotes Arterial Stiffness though Modulating VCAM-1 and E-Selectin Expression. Cell Physiol Biochem 41: 2183–2193, 2017. doi: 10.1159/000475576. [DOI] [PubMed] [Google Scholar]
  • 10.Edwards DG, Farquhar WB. Vascular effects of dietary salt. Curr Opin Nephrol Hypertens 24: 8–13, 2015. doi: 10.1097/MNH.0000000000000089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Feng W, Dell’Italia LJ, Sanders PW. Novel Paradigms of Salt and Hypertension. J Am Soc Nephrol 28: 1362–1369, 2017. doi: 10.1681/ASN.2016080927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Finkenstadt PM, Kang WS, Jeon M, Taira E, Tang W, Baraban JM. Somatodendritic localization of Translin, a component of the Translin/Trax RNA binding complex. J Neurochem 75: 1754–1762, 2000. doi: 10.1046/j.1471-4159.2000.0751754.x. [DOI] [PubMed] [Google Scholar]
  • 13.Frisoli TM, Schmieder RE, Grodzicki T, Messerli FH. Salt and hypertension: is salt dietary reduction worth the effort? Am J Med 125: 433–439, 2012. doi: 10.1016/j.amjmed.2011.10.023. [DOI] [PubMed] [Google Scholar]
  • 14.Fu X, Shah A, Baraban JM. Rapid reversal of translational silencing: Emerging role of microRNA degradation pathways in neuronal plasticity. Neurobiol Learn Mem 133: 225–232, 2016. doi: 10.1016/j.nlm.2016.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fukuda Y, Ishida R, Aoki K, Nakahara K, Takashi T, Mochida K, Suzuki O, Matsuda J, Kasai M. Contribution of Translin to hematopoietic regeneration after sublethal ionizing irradiation. Biol Pharm Bull 31: 207–211, 2008. doi: 10.1248/bpb.31.207. [DOI] [PubMed] [Google Scholar]
  • 16.Ha SK. Dietary salt intake and hypertension. Electrolyte Blood Press 12: 7–18, 2014. doi: 10.5049/EBP.2014.12.1.7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Haque MZ, Majid DS. High salt intake delayed angiotensin II-induced hypertension in mice with a genetic variant of NADPH oxidase. Am J Hypertens 24: 114–118, 2011. doi: 10.1038/ajh.2010.173. [DOI] [PubMed] [Google Scholar]
  • 18.Hori D, Dunkerly-Eyring B, Nomura Y, Biswas D, Steppan J, Henao-Mejia J, Adachi H, Santhanam L, Berkowitz DE, Steenbergen C, Flavell RA, Das S. miR-181b regulates vascular stiffness age dependently in part by regulating TGF-β signaling. PLoS One 12: e0174108, 2017. doi: 10.1371/journal.pone.0174108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Jung SM, Jandu S, Steppan J, Belkin A, An SS, Pak A, Choi EY, Nyhan D, Butlin M, Viegas K, Avolio A, Berkowitz DE, Santhanam L. Increased tissue transglutaminase activity contributes to central vascular stiffness in eNOS knockout mice. Am J Physiol Heart Circ Physiol 305: H803–H810, 2013. doi: 10.1152/ajpheart.00103.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kaess BM, Rong J, Larson MG, Hamburg NM, Vita JA, Levy D, Benjamin EJ, Vasan RS, Mitchell GF. Aortic stiffness, blood pressure progression, and incident hypertension. JAMA 308: 875–881, 2012. doi: 10.1001/2012.jama.10503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kang H, Hata A. MicroRNA regulation of smooth muscle gene expression and phenotype. Curr Opin Hematol 19: 224–231, 2012. doi: 10.1097/MOH.0b013e3283523e57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Laurent S, Alivon M, Beaussier H, Boutouyrie P. Aortic stiffness as a tissue biomarker for predicting future cardiovascular events in asymptomatic hypertensive subjects. Ann Med 44, Suppl 1: S93–S97, 2012. doi: 10.3109/07853890.2011.653398. [DOI] [PubMed] [Google Scholar]
  • 23.Laurent S, Boutouyrie P, Asmar R, Gautier I, Laloux B, Guize L, Ducimetiere P, Benetos A. Aortic stiffness is an independent predictor of all-cause and cardiovascular mortality in hypertensive patients. Hypertension 37: 1236–1241, 2001. doi: 10.1161/01.hyp.37.5.1236. [DOI] [PubMed] [Google Scholar]
  • 24.Liao YC, Wang YS, Hsi E, Chang MH, You YZ, Juo SH. MicroRNA-765 influences arterial stiffness through modulating apelin expression. Mol Cell Endocrinol 411: 11–19, 2015. doi: 10.1016/j.mce.2015.04.006. [DOI] [PubMed] [Google Scholar]
  • 25.Lin J, He S, Sun X, Franck G, Deng Y, Yang D, Haemmig S, Wara AK, Icli B, Li D, Feinberg MW. MicroRNA-181b inhibits thrombin-mediated endothelial activation and arterial thrombosis by targeting caspase recruitment domain family member 10. FASEB J 30: 3216–3226, 2016. doi: 10.1096/fj.201500163R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu Y, Ye X, Jiang F, Liang C, Chen D, Peng J, Kinch LN, Grishin NV, Liu Q. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation. Science 325: 750–753, 2009. doi: 10.1126/science.1176325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mattace-Raso FU, van der Cammen TJ, Hofman A, van Popele NM, Bos ML, Schalekamp MA, Asmar R, Reneman RS, Hoeks AP, Breteler MM, Witteman JC. Arterial stiffness and risk of coronary heart disease and stroke: the Rotterdam Study. Circulation 113: 657–663, 2006. doi: 10.1161/CIRCULATIONAHA.105.555235. [DOI] [PubMed] [Google Scholar]
  • 28.Meneton P, Jeunemaitre X, de Wardener HE, MacGregor GA. Links between dietary salt intake, renal salt handling, blood pressure, and cardiovascular diseases. Physiol Rev 85: 679–715, 2005. doi: 10.1152/physrev.00056.2003. [DOI] [PubMed] [Google Scholar]
  • 29.Mitchell GF, Hwang SJ, Vasan RS, Larson MG, Pencina MJ, Hamburg NM, Vita JA, Levy D, Benjamin EJ. Arterial stiffness and cardiovascular events: the Framingham Heart Study. Circulation 121: 505–511, 2010. doi: 10.1161/CIRCULATIONAHA.109.886655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.O'Rourke M. Arterial stiffness, systolic blood pressure, and logical treatment of arterial hypertension. Hypertension 15: 339–347, 1990. doi: 10.1161/01.hyp.37.5.1236. [DOI] [PubMed] [Google Scholar]
  • 31.Okamoto M, Nakamura F, Musha T, Kobayashi Y. Association between novel arterial stiffness indices and risk factors of cardiovascular disease. BMC Cardiovasc Disord 16: 211, 2016. doi: 10.1186/s12872-016-0389-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Parthenakis F, Marketou M, Kontaraki J, Patrianakos A, Nakou H, Touloupaki M, Vernardos M, Kochiadakis G, Chlouverakis G, Vardas P. Low levels of MicroRNA-21 are a marker of reduced arterial stiffness in well-controlled hypertension. J Clin Hypertens (Greenwich) 19: 235–240, 2016. doi: 10.1111/jch.12900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Raij L, Gonzalez-Ochoa AM. Vascular compliance in blood pressure. Curr Opin Nephrol Hypertens 20: 457–464, 2011. doi: 10.1097/MNH.0b013e3283499d7b. [DOI] [PubMed] [Google Scholar]
  • 34.Sanders PW. Vascular consequences of dietary salt intake. Am J Physiol Renal Physiol 297: F237–F243, 2009. doi: 10.1152/ajprenal.00027.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Schiffrin EL. Circulatory therapeutics: use of antihypertensive agents and their effects on the vasculature. J Cell Mol Med 14: 1018–1029, 2010. doi: 10.1111/j.1582-4934.2010.01056.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sikka G, Pandey D, Bhuniya AK, Steppan J, Armstrong D, Santhanam L, Nyhan D, Berkowitz DE. Contribution of arginase activation to vascular dysfunction in cigarette smoking. Atherosclerosis 231: 91–94, 2013. doi: 10.1016/j.atherosclerosis.2013.08.026. [DOI] [PubMed] [Google Scholar]
  • 37.Steppan J, Bergman Y, Viegas K, Armstrong D, Tan S, Wang H, Melucci S, Hori D, Park SY, Barreto SF, Isak A, Jandu S, Flavahan N, Butlin M, An SS, Avolio A, Berkowitz DE, Halushka MK, Santhanam L. Tissue Transglutaminase Modulates Vascular Stiffness and Function Through Crosslinking-Dependent and Crosslinking-Independent Functions. J Am Heart Assoc 6: 6, 2017. doi: 10.1161/JAHA.116.004161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Steppan J, Sikka G, Hori D, Nyhan D, Berkowitz DE, Gottschalk A, Barodka V. Seeking a blood pressure-independent measure of vascular properties. Hypertens Res 39: 27–38, 2016. doi: 10.1038/hr.2015.109. [DOI] [PubMed] [Google Scholar]
  • 39.Steppan J, Sikka G, Jandu S, Barodka V, Halushka MK, Flavahan NA, Belkin AM, Nyhan D, Butlin M, Avolio A, Berkowitz DE, Santhanam L. Exercise, vascular stiffness, and tissue transglutaminase. J Am Heart Assoc 3: e000599, 2014. doi: 10.1161/JAHA.113.000599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sun X, Sit A, Feinberg MW. Role of miR-181 family in regulating vascular inflammation and immunity. Trends Cardiovasc Med 24: 105–112, 2014. doi: 10.1016/j.tcm.2013.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Turczynska KM, Sadegh MK, Hellstrand P, Swärd K, Albinsson S. MicroRNAs are essential for stretch-induced vascular smooth muscle contractile differentiation via microRNA (miR)-145-dependent expression of L-type calcium channels. J Biol Chem 287: 19199–19206, 2012. doi: 10.1074/jbc.M112.341073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Van Huysse JW, Amin MS, Yang B, Leenen FH. Salt-induced hypertension in a mouse model of Liddle syndrome is mediated by epithelial sodium channels in the brain. Hypertension 60: 691–696, 2012. doi: 10.1161/HYPERTENSIONAHA.112.193045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Williams B. Evaluating interventions to reduce central aortic pressure, arterial stiffness and morbidity–mortality. J Hypertens 30, Suppl: S13–S18, 2012. doi: 10.1097/HJH.0b013e328353e523. [DOI] [PubMed] [Google Scholar]
  • 44.Zieman SJ, Melenovsky V, Kass DA. Mechanisms, pathophysiology, and therapy of arterial stiffness. Arterioscler Thromb Vasc Biol 25: 932–943, 2005. doi: 10.1161/01.ATV.0000160548.78317.29. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Heart and Circulatory Physiology are provided here courtesy of American Physiological Society

RESOURCES