Abstract
The AMP-activated protein kinase (AMPK) has important roles in the regulation of energy metabolism, and AMPK activity and its regulation have been the focus of relevant investigations. However, functional characterization of AMPK is still limited in insects. In this study, the full-length cDNA coding AMPKα (TcAMPKα) was isolated from the red flour beetle, Tribolium castaneum. The TcAMPKα gene contains an ORF of 1581 bp encoding a protein of 526 amino acid residues, which shared conserved domain structure with Drosophila melanogaster and mammalian orthologs. Exposure of female adults to oxidative, heat, and cold stresses caused an increase in TcAMPKα mRNA expression levels and phosphorylation of Thr-173 in the activation loop. The RNAi-mediated knockdown of TcAMPKα resulted in the increased sensitivity of T. castaneum to oxidative, heat, and cold stresses. These results suggest that stress signals regulate TcAMPKα activity, and TcAMPKα plays an important role in enabling protective mechanisms and processes that confer resistance to environmental stress.
Electronic supplementary material
The online version of this article (10.1007/s12192-019-01030-x) contains supplementary material, which is available to authorized users.
Keywords: Tribolium castaneum, AMPK, Stress resistance, Phosphorylation, RNAi
Introduction
Effective regulation of energy metabolism is essential for cellular homeostasis. The adenosine 5′-monophosphate-activated protein kinase (AMPK) is a crucial cellular energy sensor and is evolutionarily conserved across all eukaryotic species including yeast (sucrose nonfermenting1, SNF1), Caenorhabditis elegans (AAK-2), and plants (Snf1-related kinase1, SnRK1) (Hardie 2007; Polge and Thomas 2007). The mammalian heterotrimeric AMPK complex consists of a catalytic subunit α and two regulatory subunits, β and γ, each subunit is encoded by multiple genes (α1, α2, β1, β2, γ1, γ2, γ3), and as many as 12 possible AMPK complexes are generated by different combinations of these isoforms. However, in Drosophila melanogaster, each subunit is encoded by a single gene (Pan and Hardie 2002), which makes the fruit fly an appealing organism for elucidating the functional deficiency of AMPK on signaling pathways and phenotypes.
AMPK is activated in response to energy stress by sensing increases in AMP/ATP and ADP/ATP ratios, which leads to the activation of catabolic pathways that produce ATP and the inhibition of anabolic pathways that consume ATP (Hardie 2007; Rider 2016). This allosteric activation of AMPK is regulated by phosphorylation at Thr172 in the activation loop of the catalytic α-subunit in mammals. Stress factors that activate AMPK can be divided into two categories including physiological stresses, such as starvation, exercise, hypoxia, and ischemia, and environmental stresses, such as heat shock, cold environment, oxidative stress, sodium ion stress, and alkaline pH (Hardie et al. 1994; Wilson et al. 1996; Rasmussen and Winder 1997; Choi et al. 2001; Fisher et al. 2002; Platara et al. 2006; Rider et al. 2011). In D. melanogaster, treatment under hypoxic conditions caused a 2-fold increase in DmAMPK activity after 2 and 4 h (Pan and Hardie 2002). Additionally, inhibition of dAMPKα in muscle enhances sensitivity to paraquat and starvation stress (Tohyama and Yamaguchi, 2010). Nevertheless, the involvement of AMPK in response to environmental stresses in other insects is still unclear.
In this paper, we have cloned and characterized AMPK α-subunit gene, TcAMPKα, in the red flour beetle, Tribolium castaneum. The roles of TcAMPKα in response to oxidative, heat, and cold stresses were studied. We also examined the effects of RNA interference (RNAi)-mediated knockdown of TcAMPKα on stress resistance.
Materials and methods
Experimental insects
The Georgia-1 (GA-1) strain of T. castaneum was reared at 30 °C and 50% relative humidity in 5% yeasted flour under standard conditions (Haliscak and Beeman 1983; Li et al. 2011).
Total RNA isolation and reverse transcription
Total RNAs were extracted from the whole body of insects at various developmental stages (such as the eggs, larvae, pupae, and adults) or specific tissues (including ovary, thorax, integument, head, midgut, malpighian tubule, and fat body) of 7-day-old female adults using TRIZOL® Reagent (Invitrogen, Waltham, MA, USA). First-strand cDNA was synthesized from total RNA using the Primescript™ First-Strand cDNA Synthesis kit (TaKaRa, Dalian, China), following the manufacturer’s instructions.
Polymerase chain reaction and RACE
The amino acid sequence of D. melanogaster AMPKα (GenBank: NP_477313) was searched against the whole genome shotgun database (WGS) of T. castaneum in NCBI (https://www.ncbi.nlm.nih.gov/), and the region with the best match was manually annotated to identify the putative transcript. Specific primer pairs were designed based on the identified sequence (Table 1). PCR reactions were performed with LA Taq™ DNA polymerase (TaKaRa, Dalian, China). To complete the cDNA sequences of TcAMPKα, 5′-RACE and 3′-RACE reactions were performed using the SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA), following the manufacturer’s instructions.
Table 1.
Oligonucleotide primers used for RT-PCR, RACE, and RT-qPCR
| Primer name | Sequence (5′ to 3′) | Description |
|---|---|---|
| TcAMPKαF1 | TGTGGGCAGAAGCCAATGAG | TcAMPKα RT-PCR |
| TcAMPKαR1 | GGATTCTTATGACGCACTCT | |
| TcAMPKαR2 | GATACAGCTTGATAATATGCGGGTG | TcAMPKα 5′-RACE |
| TcAMPKαR3 | CGAAACAGCTTCAAGTTCTGAATCT | |
| TcAMPKαF2 | TTAGTATGAGCCCGAGCCCAAGTCC | TcAMPKα 3′-RACE |
| TcAMPKαF3 | GGGAAGAGTTAAGAGGGCTAAGTGG | |
| TcAMPKαF4 | ACATCCTTGGCCAGACTTTG | TcAMPKα RT-qPCR |
| TcAMPKαR4 | GCCGAAACAGCTTCAAGTTC | |
| Tcrps3F1 | ACCGTCGTATTCGTGAATTGAC | rps3 RT-qPCR |
| Tcrps3R1 | ACCTCGATACACCATAGCAAGC | |
| TcAMPKαiF1 | GTTCGGGGGTTGATTACTGCC | TcAMPKα dsRNA |
| TcAMPKαiR2 | GGACTTCCTTCTCCTGCACCC |
Reverse transcription quantitative PCR
Reverse transcription quantitative PCR (RT-qPCR) reactions were performed on the Bio-Rad CFX 96 Real-time PCR system using TB Green™ Premix Ex Taq™ (Takara, Dalian, China) and gene specific primers (Table 1). The stably expressed gene encoding ribosomal protein S3 (rps3, GenBank: CB335975) was used as a reference gene (Arakane et al. 2008). PCR conditions were set as an initial incubation of 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and a final melting curve analysis was performed. The mRNA levels were normalized to reference gene with the 2−ΔΔCT method (Livak and Schmittgen 2001). The means and standard errors for each time point were obtained from the average of at least three biologically independent sample sets.
RNA interference
Gene specific primers (Table 1) with T7 promoter were designed to synthesize the dsRNAs targeting nucleotides 844–1285 (442 bp) of the ORF region of the TcAMPKα using TranscriptAid™ T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The synthesized dsRNAs were diluted in DEPC water with a concentration of 2 μg/μL, and about 200 ng of dsRNA in 200 nL injection buffer was injected into 3-day-old pupae using a Nanoliter 2010 injector system (WPI, Sarasota, FL, USA) under a stereomicroscope. The 4-day-old female adults were used to determine the suppression of TcAMPKα transcripts by RT-qPCR as described for gene expression analysis. The buffer-injected larvae (IB group) and the uninjected wild-type larvae (CK group) were set as controls in all injection experiments. Three biologically independent replicates were carried out with at least 30 insects in each replicate.
Effect of dsTcAMPKα on survival ability of T. castaneum
Because the adult stage of T. castaneum can last for months or even more than a year, a 30-day period was used to compare the adult survival rate across different treatments (Sang et al. 2012). When the dsTcAMPKα-treated pupae entered adulthood, adults were transferred to Petri dishes with food and the daily mortality was counted within 1 month to evaluate the effect of dsTcAMPKα on survival ability of T. castaneums under normal conditions. Three biologically independent replicates were carried out with at least 30 insects in each replicate.
Stress assays
Two kinds of stress assays were conducted in this study, including stress-induced expression assay and stress tolerance assay. In stress-induced expression assay, the 2-day-old female adults were divided into several groups for TcAMPKα expression analysis under various environmental stresses. In the heat and cold stress treatment groups, 50 female adults for each group were reared at 45 and 4 °C condition, respectively. To induce in vivo oxidative stress, the adult individuals were starved for 12 h and then treated with 20 mM paraquat in 1% sucrose. Three insects for each time point were collected after the insects were treated for 0, 1, 2, 4, and 12 h, respectively. In total, three biological replications were carried out for these experiments, and the expression levels of TcAMPKα were measured by RT-qPCR.
The treatments in stress tolerance assay were the same as those in stress-induced expression assay, except that dsTcAMPKα-treated insects were used, and survival rates were investigated in 24 h for paraquat treatment, and every 12 h for heat and cold treatments until all of the insects were dead. The IB group and WT group were set as controls. Three biological replications were carried out for the experiments, and 20 beetles were used in each replicate treatment.
Western blot analysis
Total protein was extracted using tissue protein extraction reagent (ComWin Biotech, Beijing, China), and the protein concentration was determined using BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to manufacturer’s protocol. Equal amounts of protein samples (50 μg) were subjected to SDS-PAGE (8% polyacrylamide), and transferred onto polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA, USA), followed by membrane staining using Ponceau S to visualize transfer result. Discolored membrane was incubated at room temperature for 1 h in Tris-buffered saline with Tween (TBST) containing 5% BSA blocking buffer and then at 4 °C overnight in either anti-AMPKα (Abcam, Cambridge, UK, catalogue number ab80039) or phospho-specific anti-AMPKα Thr-172 primary antibodies (Cell Signaling Technology, Danvers, MA, USA, catalogue number 2535) at 1:1000 dilution in TBS containing 1% BSA and 0.1% Tween-20. Hybridized primary antibody was detected using HRP-conjugated goat anti-rabbit IgG (Bio-Rad, CA, USA, catalogue number 170-6515) at a 1:5000 dilutions in TBS containing 1% non-fat dry milk and 0.1% Tween-20. Hybridized secondary antibody was detected by using ECL reagents and ChemiDoc system (Bio-Rad, CA, USA). α-Tubulin mouse monoclonal antibody (HuaBio, Hangzhou, Zhejiang, China, catalogue number M1501-1) was used as a loading control. The blots were quantified with Image Lab™ software (Bio-Rad, Hercules, CA, USA) and normalized to the corresponding controls. All western blot analyses were repeated at least three times.
Statistical analysis
The data analysis was done using GraphPad Prism 6 by one-way analysis of variance, followed by Tukey’s Honestly Significant Difference test. All data are presented as the mean ± SE.
Results
cDNA cloning and characterization of TcAMPKα in T. castaneum
The full-length cDNA sequence of TcAMPKα was amplified by RT-PCR and RACE. The TcAMPKα cDNA comprises 1962 bp with a 126-bp 5′-untranslated region (UTR), 1581 bp of ORF encoding a 526-amino acid residue protein with molecular mass of 59.49 kDa and an isoelectric point of 7.68, and a 255-bp 3′-UTR (GenBank accession no. MK543269, supplementary Fig. 1). An amino acid sequence alignment shows that TcAMPKα shares 89.6, 78.2, 71.5, and 62.9% identities with DhAMPKα in Dastarcus helophoroides, BmAMPKα in Bombyx mori, DmAMPKα in D. melanogaster, and HsAMPKα in Homo sapiens, respectively (Fig. 1). The phylogenetic tree constructed using the neighbor-joining method cleared showed that TcAMPKα was clustered with other coleopteran insect homologs (Fig. 2).
Fig. 1.
Amino acid sequence alignment of TcAMPKα and representative AMPKαs from Dastarcus helophoroides (DhAMPKα, GenBank: ANT47199), Drosophila melanogaster (DmAMPKα, GenBank: NP_477313), Bombyx mori (BmAMPKα, GenBank: ABQ62953), and Homo sapiens (HsAMPKα, GenBank: AAA64745). Identical residues in the sequences are in black and similar residues are in gray. The conserved domains including the activation loop, AIS, α-RIM, NLS, and NES motif are indicated by a solid line below the alignment and the conserved phosphorylation site of Thr172 is indicated by “▼” above the alignment. Besides, the conserved auto inhibitory domain is indicated by a dotted line below the alignment
Fig. 2.
Phylogenetic analysis of AMPKα from T. castaneum and other insects and mammals. The phylogenetic tree was constructed by MEGA7 using the neighbor-joining method with 1000 bootstrap replicates
The sequence alignments also revealed the conserved domain structure in TcAMPKα and AMPKα from other species (Fig. 1). The kinase domain was located in the amino-terminal half of TcAMPKα with a recognized activation loop structure (ADFGLSNMMSDGEFLRTSCGSPN). The activation loop contains a conservative phosphorylation site (T. castaneum Thr-173; D. melanogaster Thr-184; Human Thr-172) that plays a key role in the kinase catalytic activity of AMPK (Hawley et al. 1996; Pan and Hardie 2002). A β-subunit interaction domain (β-SID) was located in the carboxy-terminal half of TcAMPKα, and a NLS (nuclear localization signal) motif (Lys-(Lys/Arg)-X-(Lys/Arg)) was identified on the β-SID (Hodel et al. 2001; Suzuki et al. 2007). The carboxy-terminus 20 amino acids of TcAMPKα was a NES (nuclear export signal) motif due to its closely matching sequences with leucine-rich CRM1-dependent NESs (Kazgan et al. 2010). Between the kinase domain and β-SID was a regulatory region comprising the auto inhibitory domain (AID) and a α-RIM structure which plays a key role in allosteric regulation of AMPK (Chen et al. 2013).
The genomic structure of TcAMPKα was predicted by comparing the cDNA sequence with the genomic sequence retrieved from contigs in the whole genome shotgun release for T. castaneum. The result showed that the coding region of TcAMPKα contains three exons connected by two introns (Fig. 3). Further analysis showed that the number, location, and length of introns varied in different insects, indicating the diversities of AMPKα gene structure among different insects (Fig. 3).
Fig. 3.
Schematic diagrams of the genomic organization for TcAMPKα and other insect homologs
The temporal and spatial expression patterns of TcAMPKα
The temporal expression patterns of TcAMPKα were analyzed using RT-qPCR. The result showed that TcAMPKα was expressed at all developmental stages tested. The mRNA level of TcAMPKα was the highest in the 1-day-old males, and the 10-day-old larvae exhibited the lowest mRNA level of TcAMPKα (Fig. 4a). The determination of spatial expression patterns showed that TcAMPKα was predominantly expressed in the head and thorax (Fig. 4b).
Fig. 4.
The expression patterns of TcAMPKα in different developmental stages (a) and various tissues of 7-day-old female adults (b). 1-E, 1-day-old eggs; 1-L, 1-day-old larvae; 10-L, 10-day-old larvae; 20-L, 20-day-old larvae; 1-P, 1-day-old pupae; 5-P, five-day-old pupae; 1-M, 1-day-old males; 7-M, 7-day-old males; 1-F, 1-day-old females; 7-F, 7-day-old females. Bars not sharing a common letter are significantly different (p < 0.05)
RNAi phenotypes of TcAMPKα
Injection of dsTcAMPKα during the pupal stage resulted in suppression of transcript level of TcAMPKα by 95.50 ± 1.86% (Fig. 5a) and significantly reduced protein amount as well as phosphorylation of TcAMPKα (Fig. 5b–d). Defects in pupal-adult metamorphosis were observed in dsTcAMPKα-treated insects with the wings spreading to the dorsal side and the pupal cuticles attached to the end of the body (Fig. 5e), and approximately 38.33 ± 10.14% pupae failed to eclose (Fig. 5f).
Fig. 5.
RNA interference (RNAi) of TcAMPKα. a Expressions of TcAMPKα transcripts in the uninjected wild-type larvae (WT group), the buffer-injected larvae (IB group), and the dsRNA injected group. b Representative western blots showing the protein expression and phosphorylation levels of TcAMPKα in WT, IB, and the dsRNA injected groups. α-Tubulin was used as a loading control. c Densitometric quantification of protein abundance of AMPKα (t-AMPKα) relative to α-tubulin. d Densitometric quantification of the ratios of phospho-AMPK (p-AMPKα) to α-tubulin. e Injection of dsTcAMPKα resulted in defective pupal-adult metamorphosis. f Average eclosion rates in WT, IB, and the dsRNA-injected group. Each bar represents the mean ± SE (n = 3) of the ratio for three independent experiments (by Student’s t test, *p < 0.05)
RNAi of TcAMPKα reduced survival rate of T. castaneum
Due to the adult stage of T. castaneum can last for months or even more than a year, we used a period of 30-day following pupal RNAi to assess the effect of dsTcAMPKα on adult survival. All tested adults were viable and no visible phenotype was observed. The results showed that knock down of TcAMPKα significantly decreased the survival rate within 1 month (approximately 32.24 ± 0.12% reduction compared with controls) of T. castaneum (Fig. 6).
Fig. 6.
Effects of dsTcAMPKα treatment on the survival curve (a) and average survival time (b) within 1 month among WT, IB, and the dsRNA-injected groups (by Student’s t test, *p < 0.05)
Response of TcAMPKα to oxidative, heat, and cold stress
The mRNA transcript levels of TcAMPKα under various environmental stresses were quantified using RT-qPCR. The results showed that, after paraquat treatment, the mRNA expression of TcAMPKα significantly increased and reached a peak after 2 h, which was 25.15 ± 3.37-fold higher than the control (Fig. 7). Significant increase of mRNA expression of TcAMPKα was also observed after heat and cold stress treatment (Fig. 7). In agreement with increased mRNA expression level, paraquat, heat, and cold treatment resulted in the increase of protein abundance (Fig. 8a, b).
Fig. 7.

The mRNA expression patterns of TcAMPKα during oxidative, heat, and cold stresses. Tribolium ribosomal protein S3 (rps3) transcript with the same complementary DNA (cDNA) template served as an internal control. Asterisks indicate significant differences compared to the respective controls (by Student’s t test, **p < 0.001)
Fig. 8.
Oxidative, heat, and cold stresses stimulated the phosphorylation of the activation loop threonine (Thr173) of TcAMPKα in T. castaneum. a Representative western blots showing the phosphorylation and total TcAMPKα protein levels (p-AMPKα and t-AMPKα) during different stresses. α-Tubulin was used as a loading control. b Densitometric quantification of the ratios of total-AMPKα (t-AMPKα) to α-tubulin from western blot signals. c Densitometric quantification of the ratios of phospho-AMPK (p-AMPKα) to total-AMPK (t-AMPKα) from western blot signals. Each bar in panels represents the mean ± SE (n = 3) of the ratio for three independent experiments (by Student’s t test, *p < 0.05; **p < 0.001)
We next determined the TcAMPK activity by measuring the amount of phosphorylation at TcAMPKα Thr173 (p-AMPKα) under different stresses. The results showed that paraquat, heat, and cold stresses significantly increased p-AMPKα levels relative to the amount of AMPKα (p-AMPKα/t-AMPKα) with the peak observed after 1 h (grayscale value 3.76 ± 0.83-fold), 4 h (9.95 ± 3.46-fold), and 2 h (1.76 ± 0.12-fold) of treatment, respectively, when compared with the control (Fig. 8c). Collectively, these results indicated that environmental stresses increased TcAMPK activity levels through phosphorylation.
RNAi of TcAMPKα increased sensitivity to stress treatment
The involvement of TcAMPKα in the response to environmental stresses was further tested through RNAi. The results showed that, after exposure to oxidative stress-inducing 20 mM paraquat for 24 h, the survival rate of dsTcAMPKα group was 30.95 ± 2.38%, which was significantly lower than the WT (57.14 ± 7.14%) and IB (61.90 ± 6.30%) groups (supplementary Fig. 2). Similarly, after heat and cold treatment, the survivorship of dsTcAMPKα-treated adults was much lower than WT and IB groups. The adults from dsTcAMPKα group could only survive for a mean ± SE of 26.00 ± 2.00 and 155.33 ± 2.91 h at 45 and 4 °C, respectively, which were much shorter than the WT group (55.00 ± 1.53; 242.67 ± 8.19 h) and IB group (54.83 ± 1.96; 222.00 ± 14.74 h) (Fig. 9).
Fig. 9.
Effects of heat (a) and cold (b) treatments on the survival curve and average survival time in WT, IB, and the dsRNA-injected groups (by Student’s t test, **p < 0.001)
Discussion
AMPK is a highly conserved protein kinase among most eukaryotes. As an energy sensor, AMPK plays an important role in maintaining the energy homeostasis at the cellular and whole body levels and in response to metabolic stress (Hardie et al. 1998; Kahn et al. 2005). While AMPK has been extensively studied in mammals, characterization of insect AMPK is still limited. In this study, the full-length catalytic subunit of AMPK in T. castaneum, TcAMPKα, was cloned for the first time. Sequence analysis revealed that TcAMPKα shares the similar structure with other insect and mammalian orthologs including the kinase domain to activate AMPK and the regulatory region to play a critical role in allosteric regulation of AMPK as well as the β-SID to link with β-subunit. In addition, the NES motif on the terminal of β-SID and NLS motif on the regulatory region were identified in TcAMPKα, indicating that TcAMPKα may travel back and forth between nucleus and cytoplasm in response to the upstream signal and regulate the downstream targets (Leff 2003). Interestingly, while two NLS motifs were found in human AMPKα2 (Suzuki et al. 2007), only one NLS motif was identified in TcAMPKα.
Besides its roles in energy homeostasis and metabolic regulation, AMPK is also involved in the response to environmental stresses (Crozet et al. 2014). In this study, we found that the oxidative, heat, and cold stresses could activate TcAMPKα not only at the mRNA level but also at the phosphorylation level, indicating the regulation of TcAMPKα activity by stress signals. Similar results have been reported in other organisms. For example, AMPK activity was increased under heat stress in rat primary hepatocytes (Corton et al. 1994). The mRNA expressions of AMPKα1 and protein expressions of p-AMPKαThr172 were also up-regulated in the small intestine epithelium cells after 7 or 14 days of heat exposure (He et al. 2018). In Saccharomyces cerevisiae, exposure of cells to oxidative stress caused an increase in Snf1 catalytic activity and phosphorylation of Thr210 (Hong and Carlson 2007). A recent study revealed that the phosphorylation levels of AMPK were significantly enhanced under oxidative stress induced by natural pyrethrins treatment in the HepG2 cells (Yang et al. 2018). On the contrary, heat stress inhibited AMPK activity by dephosphorylation of AMPKα in human and rodent cells (Kodiha et al. 2007; Wang et al. 2010). Down-regulation of AMPK/aak-2 was also observed during oxidative stress induced by tert-butyl hydroperoxide (TBHP) in HEK293T cells and C. elegans (Kosztelnik et al. 2019). The opposite AMPK response to environmental stresses in different species suggested the functional divergence of AMPK despite the cross-species structural conservation.
The regulation of TcAMPKα activity by stress signals indicated the role of TcAMPKα in stress resistance, which was confirmed by functional analysis using RNAi. The dsTcAMPKα treatment resulted in significant increase of mortalities of female adults exposed to oxidative, heat, and cold stresses. This result was consistent with the result from yeast in which snf1 null mutant cultures showed reduced thermo tolerance in the stationary phase (Thompson-Jaeger et al. 1991). Similarly, inhibition of dAMPKα in muscle significantly increased sensitivity to paraquat in female flies (Tohyama and Yamaguchi 2010). In cultured osteoblastoma MG63 cells, inhibition of AMPK by its inhibitor (compound C) or by shRNA-mediated knockdown dramatically enhanced H2O2-induced cell apoptosis (She et al. 2014). The involvement of AMPK in stress resistance might be due to the impact of AMPK on phosphorylation of transcriptional factor and the mRNA expression of stress-related genes, as has been reported that under low glucose conditions, SNF1 complex phosphorylates Hsf1 (heat shock factor 1 transcriptional factor) to response the heat shock stress signal (Hahn and Thiele 2004), and genetic deletion of the AMPK α1 gene in mice resulted in the down-regulation of the expression of antioxidant enzymes including Sod2, catalase, and glutathione peroxidase (GPx-1) (Wang et al. 2010). Further research is needed to determine the role of TcAMPK in the regulation of stress-related genes.
Electronic supplementary material
(DOCX 38 kb)
Author contributions
JW conceived and designed research. HJ, NZ, MC, CJ, HG, and XX conducted experiments. XM, FD, LM, XY, and KQ analyzed data. HJ and JW wrote the manuscript. All authors read and approved the manuscript.
Funding information
This work was supported by the National Natural Science Foundation of China under grant nos. 31572000 and 31871974.
Compliance with ethical standards
Conflict of interest
The authors declare that they have no conflict of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- Arakane Y, Specht CA, Kramer KJ, Muthukrishnan S, Beeman RW. Chitin synthases are required for survival, fecundity and egg hatch in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 2008;38:959–962. doi: 10.1016/j.ibmb.2008.07.006. [DOI] [PubMed] [Google Scholar]
- Chen Lei, Xin Feng-Jiao, Wang Jue, Hu Jicheng, Zhang Yuan-Yuan, Wan Shuo, Cao Lu-Sha, Lu Chang, Li Peng, Yan S. Frank, Neumann Dietbert, Schlattner Uwe, Xia Bin, Wang Zhi-Xin, Wu Jia-Wei. Conserved regulatory elements in AMPK. Nature. 2013;498(7453):E8–E10. doi: 10.1038/nature12189. [DOI] [PubMed] [Google Scholar]
- Choi SL, Kim SJ, Lee KT, Kim J, Mu J, Birnbaum MJ, Kim SS, Ha J. The regulation of AMP-activated protein kinase by H2O2. Biochem Biophys Res Commun. 2001;287:92–97. doi: 10.1006/bbrc.2001.5544. [DOI] [PubMed] [Google Scholar]
- Corton JM, Gillespie JG, Hardie DG. Role of the AMP-activated protein kinase in the cellular stress response. Curr Biol. 1994;4:315–324. doi: 10.1016/S0960-9822(00)00070-1. [DOI] [PubMed] [Google Scholar]
- Crozet P, Margalha L, Confraria A, Rodrigues A, Martinho C, Adamo M, Elias CA, Baena-González E (2014) Mechanisms of regulation of SNF1/AMPK/SnRK1 protein kinases. Front Plant Sci 5(190). 10.3389/fpls.2014.00190 [DOI] [PMC free article] [PubMed]
- Fisher JS, Gao J, Han DH, Holloszy JO, Nolte LA. Activation of AMP kinase enhances sensitivity of muscle glucose transport to insulin. Am J Physiol Endocrinol Metab. 2002;282:E18–E23. doi: 10.1152/ajpendo.2002.282.1.E18. [DOI] [PubMed] [Google Scholar]
- Hahn JS, Thiele DJ. Activation of the Saccharomyces cerevisiae heat shock transcription factor under glucose starvation conditions by Snf1 protein kinase. J Biol Chem. 2004;279:5169–5176. doi: 10.1074/jbc.M311005200. [DOI] [PubMed] [Google Scholar]
- Haliscak JP, Beeman RW. Status of malathion resistance in five genera of beetles infesting farm-stored corn, wheat, and oats in the United States. J Econ Entomol. 1983;76:717–722. doi: 10.1093/jee/76.4.717. [DOI] [Google Scholar]
- Hardie DG. AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev Mol Cell Biol. 2007;8:774–785. doi: 10.1038/nrm2249. [DOI] [PubMed] [Google Scholar]
- Hardie DG, Carling D, Carlson M. The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annu Rev Biochem. 1998;67:821–855. doi: 10.1146/annurev.biochem.67.1.821. [DOI] [PubMed] [Google Scholar]
- Hardie D.Grahame, Carling David, Halford Nigel. Roles of the Snf1/Rkin1/AMP-activated protein kinase family in the response to environmental and nutritional stress. Seminars in Cell Biology. 1994;5(6):409–416. doi: 10.1006/scel.1994.1048. [DOI] [PubMed] [Google Scholar]
- Hawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, Hardie DG. Characterization of the amp-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates amp-activated protein kinase. J Biol Chem. 1996;271:27879–27887. doi: 10.1074/jbc.271.44.27879. [DOI] [PubMed] [Google Scholar]
- He X, Lu Z, Ma B, Zhang L, Li J, Jiang Y, Zhou G, Gao F. Chronic heat stress damages small intestinal epithelium cells associated with the adenosine 5′-monophosphate-activated protein kinase pathway in broilers. J Agric Food Chem. 2018;66:7301–7309. doi: 10.1021/acs.jafc.8b02145. [DOI] [PubMed] [Google Scholar]
- Hodel MR, Corbett AH, Hodel AE. Dissection of a nuclear localization signal. J Biol Chem. 2001;276:1317–1325. doi: 10.1074/jbc.M008522200. [DOI] [PubMed] [Google Scholar]
- Hong SP, Carlson M. Regulation of snf1 protein kinase in response to environmental stress. J Biol Chem. 2007;282:16838–16845. doi: 10.1074/jbc.M700146200. [DOI] [PubMed] [Google Scholar]
- Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab. 2005;1:15–25. doi: 10.1016/j.cmet.2004.12.003. [DOI] [PubMed] [Google Scholar]
- Kazgan N, Williams T, Forsberg LJ, Brenman JE. Identification of a nuclear export signal in the catalytic subunit of AMP-activated protein kinase. Mol Biol Cell. 2010;21:3433–3442. doi: 10.1091/mbc.e10-04-0347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kodiha M, Rassi JG, Brown CM, Stochaj U. Localization of AMP kinase is regulated by stress, cell density, and signaling through the MEK→ ERK1/2 pathway. Am J Physiol Cell Physiol. 2007;293:C1427–C1436. doi: 10.1152/ajpcell.00176.2007. [DOI] [PubMed] [Google Scholar]
- Kosztelnik M, Kurucz A, Papp D, Jones E, Sigmond T, Barna J, Traka MH, Lorincz T, Szarka A, Banhegyi G, Vellai T, Korcsmaros T, Kapuy O. Suppression of AMPK/aak-2 by NRF2/SKN-1 down-regulates autophagy during prolonged oxidative stress. FASEB J. 2019;33:2372–2387. doi: 10.1096/fj.201800565RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leff T. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem Soc Trans. 2003;31:224–227. doi: 10.1042/bst0310224. [DOI] [PubMed] [Google Scholar]
- Li B, Beeman RW, Park Y. Functions of duplicated genes encoding CCAP receptors in the red flour beetle, Tribolium castaneum. J Insect Physiol. 2011;57:1190–1197. doi: 10.1016/j.jinsphys.2011.05.011. [DOI] [PubMed] [Google Scholar]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR andthe 2-ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Pan DA, Hardie DG. A homologue of amp-activated protein kinase in Drosophila melanogaster is sensitive to amp and is activated by ATP depletion. Biochem J. 2002;367:179–186. doi: 10.1042/bj20020703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Platara M, Ruiz A, Serrano R, Palomino A, Moreno F, Ariño J. The transcriptional response of the yeast Na+-ATPase ENA1 gene to alkaline stress involves three main signaling pathways. J Biol Chem. 2006;281:36632–36642. doi: 10.1074/jbc.M606483200. [DOI] [PubMed] [Google Scholar]
- Polge C, Thomas M. SNF1/AMPK/SnRK1 kinases, global regulators at the heart of energy control? Trends Plant Sci. 2007;12:20–28. doi: 10.1016/j.tplants.2006.11.005. [DOI] [PubMed] [Google Scholar]
- Rasmussen BB, Winder WW. Effect of exercise intensity on skeletal muscle malonyl-CoA and acetyl-CoA carboxylase. J Appl Physiol. 1997;83:1104–1109. doi: 10.1152/jappl.1997.83.4.1104. [DOI] [PubMed] [Google Scholar]
- Rider MH. Role of amp-activated protein kinase in metabolic depression in animals. J Comp Physiol B. 2016;186:1–16. doi: 10.1007/s00360-015-0920-x. [DOI] [PubMed] [Google Scholar]
- Rider MH, Hussain N, Dilworth SM, Storey JM, Storey KB. AMP-activated protein kinase and metabolic regulation in cold-hardy insects. J Insect Physiol. 2011;57:1453–1462. doi: 10.1016/j.jinsphys.2011.07.006. [DOI] [PubMed] [Google Scholar]
- Sang W, Ma WH, Qiu L, Zhu ZH, Lei CL. The involvement of heat shock protein and cytochrome p450 genes in response to UV-A exposure in the beetle Tribolium castaneum. J Insect Physiol. 2012;58:830–836. doi: 10.1016/j.jinsphys.2012.03.007. [DOI] [PubMed] [Google Scholar]
- She C, Zhu LQ, Zhen YF, Wang XD, Dong QR. Activation of AMPK protects against hydrogen peroxide-induced osteoblast apoptosis through autophagy induction and NADPH maintenance: new implications for osteonecrosis treatment? Cell Signal. 2014;26:1–8. doi: 10.1016/j.cellsig.2013.08.046. [DOI] [PubMed] [Google Scholar]
- Suzuki A, Okamoto S, Lee S, Saito K, Shiuchi T, Minokoshi Y. Leptin stimulates fatty acid oxidation and peroxisome proliferator-activated receptor α gene expression in mouse C2C12 myoblasts by changing the subcellular localization of the α2 form of AMP-activated protein kinase. Mol Cell Biol. 2007;27:4317–4327. doi: 10.1128/MCB.02222-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thompson-Jaeger S, Francois J, Gaughran JP, Tatchell K. Deletion of SNF1 affects the nutrient response of yeast and resembles mutations which activate the adenylate cyclase pathway. Genetics. 1991;129:697–706. doi: 10.1093/genetics/129.3.697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tohyama D, Yamaguchi A. A critical role of SNF1A/dAMPKα (Drosophila AMP-activated protein kinase α) in muscle on longevity and stress resistance in Drosophila melanogaster. Biochem Biophys Res Commun. 2010;394:112–118. doi: 10.1016/j.bbrc.2010.02.126. [DOI] [PubMed] [Google Scholar]
- Wang T, Yu Q, Chen J, Deng B, Qian L, Le Y. PP2A mediated AMPK inhibition promotes HSP70 expression in heat shock response. PLoS One. 2010;5:e13096. doi: 10.1371/journal.pone.0013096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson WA, Hawley SA, Hardie DG. Glucose repression/derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP: ATP ratio. Curr Biol. 1996;6:1426–1434. doi: 10.1016/S0960-9822(96)00747-6. [DOI] [PubMed] [Google Scholar]
- Yang Y, Gao J, Zhang Y, Xu W, Hao Y, Xu Z, Tao L. Natural pyrethrins induce autophagy of HepG2 cells through the activation of AMPK/mTOR pathway. Environ Pollut. 2018;241:1091–1097. doi: 10.1016/j.envpol.2018.06.049. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX 38 kb)








